3-(2-Chloropropyl amide)-4-methoxy-N-phenylbenzamide inhibits expression of HPV oncogenes in human cervical cancer cell

L17 (HPLC>98%) was synthesized in Chinese Academy of Medical Sciences and Peking Union Medical College and its chemical structure is shown in Fig. 1a. The compound was dissolved in Dimethyl sulfoxide (DMSO) at 100 mg/ml as a stock solution and further diluted in culture medium prior to use.

The CaSki (human cervical cancer cells, HPV 16 positive), HeLa (human cervical cancer cells, HPV 18 positive), C-33A (human cervical cancer cells, HPV negative), HaCaT (Human keratinocyte cells, HPV negative) and the MRC-5 (human lung fibroblast cells, HPV negative) were obtained from American Type Culture Collection (ATCC). CaSki cells were cultured in RPMI 1640 media (Invitrogen, Carlsbad, CA, USA), HaCaT cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen); C-33A, HeLa and MRC-5 cells were cultured in minimum essential medium (MEM, Invitrogen), respectively, containing 10% Fetal Bovine Serum (Gibco, Grand Island, NY, USA), 100 U/ml penicillin G and 100 mg/ml streptomycin [18]. All cells were incubated in humidified atmosphere containing 5% CO₂ at 37 °C.

The cytotoxic effects of L17 on CaSki, HeLa, C-33A, HaCaT and MRC-5 cells were determined with the 3-(4,5-dimethylthiazole-2-yl)-2,5-biphenyl tetrazolium bromide (MTT, Promega, Madison, WI, USA) [19]. Briefly, CaSki cells (1 × 10⁴ per well) HeLa (2 × 10⁴ per well), C-33A (2 × 10⁴ per well), HaCaT (1.5 × 10⁴ per well) and MRC-5 cells (4.5 × 10⁴ per well) were seeded into 96-well culture plates and incubated for 12 h. Then, different concentrations of L17 were applied in duplicate and incubated for 48 h. 20 μl MTT (5 mg/ml) was added to each well and incubated for another 4 h, followed by solubilization in 150 μl DMSO (Promega) and spectrophotometric measurement at 490 nm on Enspire (Perkin Elmer, Waltham, MA, USA). The maximum non-toxic concentration was defined as the concentration that cell survival rate is greater than 90% (survival rate = absorbance of test group/absorbance of untreated controls).

CaSki cells (6 × 10⁵ per well) were seeded into 6-well culture plates and incubated for 12 h. Then, various concentrations of L17 were applied in duplicate and incubated for 12, 24, 36 and 48 h. Total cellular RNA was extracted with RNeasy Mini kit (Qia-gen, Germantown, MD, USA) according to the manufacturer’s protocol. The one-step quantitative RT-PCR (qRT-PCR) was conducted with the ABI 7500 Fast RT-PCR system (Applied Biosystems, Foster City, CA, USA) using SuperScript III Platinum SYBR Green One-step RT-PCR Kit (Invitrogen, Carlsbad, California, USA) with the following procedures: 50 °C for 3 min, 95 °C for 15 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30s [20]. The mRNA expression of HPV16 E6 was determined using primers (F: 5′-CTGCAATGTTTCAGGACCCA-3, R: 5′-TCATGTATAGTTGTGCAGCTCTGT-3′) targeting HPV-16 E6 open-reading frame. The mRNA expression of HPV16 E7 was determined using primers (F: 5′-GAGGAGGAGGATGAAATAGATGGT-3′,R: 5′-CACTTGCAACAAAACGTT ACAATATTG-3′) targeting HPV-16 E7 open-reading frame. β-actin was determined using primers (F: 5′- CCAACCGCGAGAAGATGA-3′, R: 5′- CCAGAGGCGTACAGGGATAG -3′). The ΔΔCt method was used to represent mRNA fold change [21].

CaSki cells (6 × 10⁵ per well) and MRC-5 cells (5 × 10⁵ per well) were seeded into 6-well culture plates and incubated for 12 h. Then, various concentrations of L17 were applied in duplicate and incubated for 48 h. After incubation, whole cell lysates of CaSki and MRC-5 cells were extracted with M-PER mammalian protein extraction reagent (Thermo Fisher Scientific, Waltham, MA, USA). Nuclear fractions of CaSki cells were isolated with NE-PER nuclear and cytoplasmic extraction kit (Beyotime Biotechnology, Shanghai, China). The protein concentrations were determined by the BCA reagents (Thermo Fisher Scientific). The samples, containing 20 μg protein, were boiled for 10 min to denature and resolved on 12% (w/v) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels. Then the proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Milli-pore, Billerica, MA, USA). Immunodetection was performed with HPV16-E6 antibody (1:500) (Santa Cruz, sc-460, mouse monoclonal antibody, Dallas, Texas, USA) [22], HPV16-E7 antibody (1:500) (Santa Cruz, sc-6981, mouse monoclonal antibody) [23], p53 antibody (1:1000) (BD Biosciences, San Diego, CA, USA), Rb antibody (1:1000) (BD Biosciences) and Histone H3 antibody (1:1000) (Cell Signaling Technology, Beverly, MA, USA), followed by incubation with HRP-conjugated antibody (1:5000) (Santa Cruz). β-actin (1:5000) (Cell Signaling Technology) was used as a normalization standard in whole cell lysate fractions. Histone H3 was used to normalize nuclear protein loading [20, 24].

RNA synthesis inhibitor actinomycin D (Sigma-Aldrich, St Louis, MO, USA) was used to determine the effect of L17 on the stability of HPV16 E6 and E7 mRNAs [25]. CaSki cells (6 × 10⁵ per well) grown in 6-well plates were treated with or without L17 (40 μg/ml) for 4 h and then 5 μg/ml actinomycin D was added to 6-well plates. Cells were harvested at 0, 2, 4, 6 and 8 h post-actinomycin D treatment. Total cellular RNA was isolated with RNeasy Mini kit and qRT-PCR analyses of HPV16 E6 and E7 transcript levels were performed. HPV16 E6 and E7 transcript levels before actinomycin D treatment were determined as baselines in the experiment. Since mRNA degradation generally obeys first-order process, the slope for the correlation of E6, E7 mRNA level and time is the degradation constant K_d (lnC = lnC₀ –K_dt, where C₀ is the mRNA concentration at time zero) and the half-life of E6 and E7 mRNA was equal to 0.693/k_d according to previously described method [25‐28].

Translation inhibitor cyclohexamide (CHX, Sigma-Aldrich, USA) was used to determine the effect of L17 on the stability of HPV16 oncoproteins E6 and E7 [25, 29]. CaSki cells (6 × 10⁵ per well) were treated with L17 (40 μg/ml) in the presence or absence of CHX (50 μg/ml). Cells were harvested at 0, 0.5, 1 and 2 h after CHX treatment, and then cell lysates were extracted for Western blot analysis. In all these experiments, HPV16 E6 and E7 protein levels before CHX treatment were determined as baseline.

Flow cytometry analysis was performed to demonstrate the effect of L17 on cell cycle progression. CaSki cells (4 × 10⁵ per well) and MRC-5 cells (4.5 × 10⁵ per well) cells were plated into 6-well culture plates and incubated for 12 h. Then, various concentrations of L17 were applied in duplicate and incubated for 48 h. Then the cells were harvested and fixed in 70% ethanol at 4 °C for 12 h. Before flow cytometry analysis, cells were stained with 1 ml of PI (15 mg/ml) containing RNase (2.5 mg/ml) (Beyotime Biotechnology). DNA content was determined by a Coulter EPICS XL/XL-MCL Flow Cytometry System (Coulter Corp, Brea, California, USA) and the proportion of cells in a particular phase of cell cycle was determined by ModFitLT software.

The chemical structure of L17 is shown in Fig. 1a. We first studied its effects on the viability of CaSki (human cervical cancer cells, HPV 16 positive), HeLa (human cervical cancer cells, HPV 18 positive), C-33A (human cervical cancer cells, HPV negative), HaCaT (Human keratinocyte cells, HPV negative) and the MRC-5 (human lung fibroblast cells, HPV negative). The results showed that the maximum non-toxic concentration of L17 in CaSki, HeLa, C-33A, HaCaT and MRC-5 were 40, 20, 20, 160 and 80 μg/ml, respectively (Fig. 1b).

Next, we studied the effects of L17 on the expression of HPV oncoproteins E6 and E7, which are associated with the development of cervical cancer. Our results showed that L17 down-regulated the expression of HPV E6 and E7 proteins in a dose-dependent manner in CaSki cells (Fig. 1c).

In order to determine how L17 decreased the level of HPV E6 and E7 proteins, we studied the effect of L17 on the stability of E6 and E7 proteins by using cyclohexamide (CHX), a potent translation inhibitor. Decreased stability of E6 protein was observed in presence of L17, whereas stability of E7 protein largely remained unaltered (Fig. 1d).

To examine the effect of L17 on the expression of HPV16 E6 and E7 mRNAs, CaSki cells treated with or without L17 were analyzed by qRT-PCR assay. The results showed that L17 decreased the expression of HPV16 E6 mRNA (Fig. 2a Left) and E7 mRNA (Fig. 2a Right) in a time-dependent and dose-dependent manner.

In order to determine how L17 decreased the HPV16 E6 and E7 mRNA expression, we carried out experiments with actinomycin D, a potent transcription inhibitor. We observed that compound L17 reduced the transcript half-life time from approximately 7.0 h to 3.7 h for E6 (Fig. 2b Left) and from 5.3 h to 3.3 h for E7 (Fig. 2b Right), respectively.

A number of genetic and biochemical studies have shown that p53 and Rb are the most important tumor suppressor proteins in keeping cells from immortalization and transformation [17, 30]. HPV oncoproteins E6 and E7 are known to cause the down-regulation of tumor suppressor proteins p53 and Rb, which is linked to the malignant proliferation of cells [13]. We thus examined the effect of L17 on the expression of p53 and Rb. The results demonstrated that L17 dose-dependently up-regulated p53 and Rb protein expressions in HPV-positive CaSki cells (Fig. 3a). Considering the fact that p53-mediated cell proliferation inhibition depends on its localization in the nucleus [31], it is necessary to examine the effect of L17 on p53 protein level in the nucleus of CaSki cells. We observed that L17 does-dependently increased p53 levels in the nucleus (Fig. 3a), which suggested that p53 exhibited a functional activation in the HPV-positive CaSki cells treated with L17. Interestingly, we found that L17 did not increase p53 and Rb proteins level in HPV-negtive MRC-5 cells (Fig. 3b). These results suggest that reduced expression of E6 and E7 is the key contributor to L17-mediated up-regulation of p53 and Rb.

It has been shown that p53 and Rb played pivotal roles in the negative control of cell cycle progress. Next, we thus performed flow cytometry analysis of PI-stained cells to demonstrate the effect of L17 on cell cycle progression. In line with the increase of p53 and Rb expression in CaSki cells, our results revealed that L17 induced CaSki cells arrest at G₀/G₁ phase in a dose-dependent manner (Fig. 4a). Meanwhile, we didn’t observe obvious change of cell cycle in MRC-5 (Fig. 4b) treated with L17, which is in agreement with the finding that L17 had no effect on the levels of p53 and Rb in normal cells.