A bovine viral diarrhea virus type 1a strain in China: isolation, identification, and experimental infection in calves

A virus isolate was isolated from the nasal swab samples after two blind passages on MDBK cells. The MDBK cells inoculated with nasal swab samples developed obvious cytopathic effects (CPE) as cells appeared aggregated and formed net-like in the monolayers within 48 hours of incubation. The non-inoculated control cells did not show the CPE. Specific fluorescent staining showed the appearance in form of granules distribution all over the cytoplasm in the infected MDBK cells, when an indirect immunofluorescence test was conducted using BVDV1 type-specific monoclonal antibodies (E2/gp53 IgG2a Isotype, VMRD, USA). The control cells did not show any fluorescence (Figure 1).

In virus neutralization assay using BVDV anti-sera, results revealed that the inoculated MDBK cells did not show CPE after mix of the virus fluids with BVDV1 positive serum, but cells inoculated with virus fluid only developed CPE. These results indicate that the virus isolate was a BVDV 1 strain.

The fragment of 288 bp of 5′UTR gene was amplified from the isolated virus by RT-PCR. The amplified product was purified, cloned and sequenced. The sequence of the isolated BVDV1 strain was compared to the reference sequences using BLAST program. Result revealed that the isolated BVDV 1 strain was similar with the BVDV strains Singer, with sequence identity about 95%. The sequence of 5′UTR has been deposited in GenBank with the accession No.JX878887.

Phylogenetic analysis based on 5′UTR revealed the strain HN01 was closed to BVDV1a Singer (L32875). The homology for nucleotide of 5′UTR is 95.3%, and with the strain SH1060 (JN248741) was 89.2%. This result indicates that the newly isolated BVDV strain, HN01, belongs to subgroup BVDV 1a of genotype BVDV1 (Figure 2).

Clinical signs were scored based on clinical severity, included depression, loss of appetite, nasal discharge, distress, excessive salivation, and elevated rectal temperatures. Two of the four BVDV infected calves developed significant clinical signs with nasal discharge and depression beginning at 2 days post-challenge (dpi), and subsequently 3 of four infected calves showed asthma and excessive salivation. Calves in the control group had no clinical signs during the experiment course. The rectal temperature of cattle #655 was over 40°C from 6 dpi to 8 dpi with the highest temperature of 41.4°C. The rectal temperature of cattle #642 was over 40°C at 2, 5 and 6 dpi with the highest recorded temperature of 40.1°C. The rectal temperature of animal #675 was over 40°C from 5 to 7 dpi with the highest temperature of 41.1°C. The rectal temperature of cattle #666 was elevated to 40°C from 2 to 4 dpi with the higest temperature of 40.3°C (Figure 3A).

WBC counts of challenged calves started decreasing from day 2 post-challenge. The WBC counts of 655# dropped significantly from 8.6 (1000 per mm³) at day 0 to 3.6 (1000 per mm³) at 4 dpi, a 58% reduction to the initial number. 642# decreased from 7.2 (1000 per mm³) (0 day) to 3.0 (1000 per mm³) (6 dpi), a 58% reduction to the initial number. The cattle of 675# decreased from 10.3 (1000 per mm³) (0 day) to 4.8 (1000 per mm³) (2 dpi), a 53% reduction to the initial number. The cattle of 666# decreased from 10.1 (1000 per mm³) (0 day) to 4.6 (1000 per mm³) (6 dpi), a 54.5% reduction to the initial number. Average greatest decline of WBC counts among the control animal group was less than 20%, which were significantly less (P < 0.05) than those of the challenge group (Figure 3B).

Viral detection was positive from 2 dpi to 8dpi in nasal samples. Viral shedding was detected by virus isolating in MDBK cells from nasal swabs. Two infected cattle had viral shedding as early as 2 dpi. The long shedding period reached to 8 days after inoculation, and the highest shedding peak was reached at 4-8 dpi.

Two randomly chosen calves (#675 and #642) and one mock calf (#799) were euthanized at 8 dpi for histopathology analysis. Gross pathological findings included hemorrhages in the spleen and mesenteric lymph nodes. Histopathologic changes included thymic and spleen atrophy, the lymph node was lymphadenopathy and hemorrhage, and lymphoid depletion of the Peyer′s patches in all the infected calves (Figure 4). All of the samples from the control cattle did not show pathological changes.

Twenty nasal swabs and blood samples were collected from the cattle that showed mild respiratory clinical signs, such as nasal discharge and cough in Henan province, China in 2010. The nasal swab samples were collected and put into a tube containing 2 ml DMEM (HyClone, USA) supplemented with 10% horse serum (Hyclone, USA), 150 μg/ml gentamicin sulfate (Sigma, USA), 7.5 μg/ml fungizone (Sigma, USA), and Streptomycin at 100 μg/ml. Three milliliter (3 ml) blood samples were collected using an EDTA vacuum blood tube from the jugular vein. All the samples were kept at 2-8°C and quickly transferred to the laboratory. Nasal swabs were inoculated into MDBK cell monolayers in 24-well tissue culture plates for virus isolation. Briefly, following centrifugation at 1500 rpm for 10 min, the samples were filtered through 0.45 μm membrane (Sigma, USA) and then inoculated onto the MDBK cell monolayer cultured in 0.5 ml DMEM (HyClone, USA) supplemented with 6% horse serum (Hyclone, USA) in 24-well cell culture plates, and incubated at 37°C, with 5% CO₂ for 2 hours. Then, the supernatants were discarded, and plates were rinsed twice with PBS (pH7.2, 0.01 mol/L), and 1 ml DMEM (HyClone, USA), with 3.5% horse serum was added. The infected-MDBK cell plates were checked daily and appearance of cytopathic effects (CPE) was observed and recorded. If the CPE was not found, the cultures were frozen and thawed twice and the clarified supernatant was passaged three times in MDBK cells. Un-infected MDBK cultures were included as negative controls and MDBK cells inoculated with BVDV NM01 strain, which was previously isolated and identified by our laboratory, was used as positive control. After 3-4 days of incubation at 37°C, with 5% CO₂ supply, the virus was confirmed by immunofluorescence on cell monolayers as described below.

To identify the isolated virus, virus neutralization (VN) test was conducted using antisera raised in cattle against BVDV1a NM01, a vaccine strain in our laboratory. Briefly, virus fluids were mixed with the equal volume hyperimmune antisera (antibody VN titer ≥ 1∶64) and incubated at 37°C for one hour, and then the mixture was transferred into MDBK cell cultures in the 96-well tissue culture plates. After 4 days of incubation at 37°C, with 5% CO₂ supply, the plates were observed for CPE to determine if the virus isolate was neutralized by the BVDV antisera. The antisera positive control and negative control were also included in this test.

To detect the BVDV in the infected-MDBK culture, an immunofluorescent assay (IFA) was conducted as follows. Briefly, cell lysate was added to each of four wells of a 96-well MDBK tissue culture plate. Positive virus (NM01 strain) and DMEM media (negative control) were also added to 4 wells respectively in the test. Then plates were incubated for 4 days at 37°C, with 5% CO₂ supply. Then, the supernatants were dumped and plates were fixed with the mixture of 80% acetone and 20% methyl alcohol; the fixed plates were incubated with monoclonal antibody specific to anti-BVDV1 (E2/gp53 IgG2a Isotype, VMRD, USA). Finally, the rabbit anti-mouse fluorescein isothiocyanate (FITC)-conjugated immunoglobulin G (IgG) (Sigma, USA) was added to the plates, then incubated in a 37°C humid box for an hour. The plates were examined for fluorescence under a fluorescent microscope (Zeiss Axioskop-40, Germany).

Primers (Forward: 5′ATGCCCTTAGTAGGACTAGCA3′; Reverse: 5′TCAACTCCATGTGCCATGTAC3′) for 5′UTR gene sequence of BVDV were designed according to the BVDV strain Singer (GenBank accession number L32875) and strain NADL (GenBank accession number M31182). Total BVDV RNA was extracted from infected MDBK cell fluids using Trizol reagent (Invitrogen, China) according to the manufacturer′s instructions. The reverse transcription polymerase chain reaction (RT-PCR) was carried out using 5 μl of RNA extraction samples and 1 μl of BVDV reverse primer as reverse transcription primer in a 0.2 ml tube for 5 min at 70°C; and the tube was added with 1 μl (200U) M-MLV reverse transcriptase RNase inhibitor and 2 μl RNAse-free water, and then was incubated for one hour at 42°C. The amplification of cDNA by PCR was carried out in a total volume of 50 μl solution containing 1 μl cDNA, 5 μl 10 × Buffer, 3 μl 2.5 mmol/L dNTP, 0.5 μl each primer, 0.5 μl Platinum Pfx DNA polymerase and 39.5 μl sterile water. Amplification was performed as follows: 95°C for 5 min, and then submitted to 30 cycles of amplification. The conditions for the amplification were 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C, then with a final extension at 72°C for 10 min. The PCR products were detected by electrophoresis through a 1% agarose gel stained with ethydium bromide and visualized under UV light. The target fragment of PCR products were purified and cloned into pMD18-T vector (TaKaRa, Japan), and then transfected into E.coli DH5α cells. The positive clones were selected for sequencing by Shanghai Invitrogen Biotechnology Co., Ltd.

The sequence analysis was performed by computer software DNASTAR (Madison, Wis USA) and MEGA5.1. The 5′UTR gene sequence of the virus isolate was evaluated for further sub-genotype classification and compared to 13 BVDV reference sequences (Table 1) from NCBI database information to develop a phylogenetic tree. Percent identities and divergences were calculated using Neighbor-Joining method of Mega5.1 software.

Three days prior to challenge, all animals were transferred to a bio-level 3 safety facility. Four calves were intranasally inoculated with 6 ml of cell culture medium containing 10^6.8TCID₅₀ per milliliter of the HN01 strain, and other two calves were inoculated with the cell culture medium to serve as the controls. All the culture medium were demonstrated free of adventitious pathogens. The challenge procedure was performed by spraying 3 ml of virus samples into each nostril, using an atomizer, and then the calves were monitored for 8 days. The temperature was taken two times at the same time every day by investigators who were unaware of the treatment codes in each study. Three randomly chosen calves were euthanized at 8 dpi for histopathology analysis.

Calves were clinically observed daily from 1 to 8 days post-challenge. Clinical signs including depression, cough, asthma, and other respiratory disease were recorded and scored using a scale of 0 – 3 (0 = absence; 1 = mild; 2 = moderate; 3 = severe).

White blood cell (WBC) counts were conducted from 2 days pre-challenge through 8 days post-challenge and white blood cell (WBC) counts were conducted by a Vetscan HM5 veterinary hematology system (Abaxis, USA). Deep nasal swab specimens were collected at 1 day prior to challenge through 8 days post-challenge. After collection, swabs were placed into a tube containing 3 ml of transport medium, consisting of DMEM (HyClone, USA) supplemented with 10% horse serum (Hyclone, USA), 150 μg/ml gentamicin sulfate (Sigma, USA), 7.5 μg/ml fungizone and streptomycin at 100 μg/ml. The samples were kept at 2-8°C and quickly transferred to the laboratory. Upon arriving in laboratory, all swab specimens were stored at -70°C or below until they were cultured for virus isolation.

On days 8 dpi, two calves in the infected group and one in the control group were euthanized; tissue samples of liver, spleen, lung, heart, kidney, intestine, mandibular lymph node, and mesenteric lymph node were collected and fixed in 10% buffered formalin for histopathologic analysis in Inner Mongolia agricultural university.