Plasmids
Infectious proviral DNA clone pNL4-3 was obtained from the NIH AIDS reagent and Reference program, Division of AIDS, NIAID, NIH. psiCHECK-2 Plasmid was obtained from Promega corporation. To generate siCHECK Plasmids having the rev site and TGF-β site, DNA sequence corresponding to the siRNA sense strand and its antisense strand with an Xho I site and Not I site overhang was synthesized chemically, annealed, digested with Xho I and Not I and ligated into a similarly digested psiCHECK-2 plasmid.
Generation of TARmiR constructs
All DNA oligonucleotides were purchased from Sigma. The T7-TARmiR expression cassettes were generated as described below.
Anti-Rev site II TARmiR configuration I:
Sense primer: Taatacgactcactata gggcctgtgcctcttcagctaccacagatctgagcctggga
Antisense Primer: ttgggcctgtgcctcttcagctaccaagagagctcccaggctcagatctgtg
Anti-rev site II TARmiR configuration II:
Sense primer: Taatacgactcactata gggcctcgtgcctcttcagctaccacagatctgagcctggga
Antisense primer: ttgggcctgtgcctcttcagctaccaagagagctcccaggctcagatctgtg
Anti-TGF-β TARmiR configuration I
Sense primer: Taatacgactcactata gggcatgtcatcagctgggaagacagatctgagccctggga
Antisense primer: ttgggcatgtcatcagctgggaagaagagagctcccagggctcagatctgtcttc
TAR-miR-perfect stem configuration:
Sense primer: Taatacgactcactata gggcctgtgcctcttcagctaccttcatctgagcctggga
Antisense primer: ttgggcctgtgcctcttcagctaccaagagagctcccaggctcagatg
The sense and antisense primers were annealed as described
Annealing Mix: 9 μl 100 mM Tris-HCl, pH 8.0 15 μl 50 mM MgCl2, 1 nmole sense primer, 1 nmole antisense Oligo, total volume of 90 μl with MQ H2O
In a separate tube, 50 μl 10× PCR Buffer (without Mg), 4 μl 25 mM each dNTP, 2 μl Platinum Taq, 354 μl MQ H2O, Divide into 5 × 82 μl reactions. All tubes were heated to 93°C and then allowed to cool to room temperature. Distribute 18 μl of the annealing reaction into each of the Platinum Taq mixtures.
Extension reaction is carried out at 72°C for 10 minutes. The extension products are purified using Qiagen PCR purification columns and the size confirmed by running on agarose gel electrophoresis.
Dual luciferase assays
HEK 293 cells were transfected with 100 ngs of siCHECK plasmid containing either the rev site II or TGF-β target site and 10 pmoles of in vitro transcribed either anti-site II rev or TGF-β TARmiR. 48 hours post-transfection, cells were harvested for analysis. The expression of Renilla luciferase and normalizing control Firefly luciferase were detected using the Dual-luciferase reporter assay system (Promega, Madison, WI), in accordance with the manufacturer's instructions. All samples were transfected in triplicate, and the experiment was performed a minimum of three times.
Gel retardation assay
TARmiR Configuration I and II were invitro transcribed and labeled as mentioned above. For binding reaction Peptide (TAT or HA2) and RNA were incubated together for 10 min on ice in 10-ml binding reactions containing 10 mM Tris-HCl (pH 7.5), 70 mM NaCl, 0.2 mM EDTA, and 5% glycerol. Peptide-RNA complexes were resolved on 10% polyacrylamide, 0.5 × TBE gels that had been prerun for 1 hr. Gels were electrophoresed at 200 V for 3 hr at 4°C, dried, and exposed to an X-ray Film.
HIV challenges and p24 antigen assay
HEK 293 cells were co-transfected with the infectious proviral DNA clone, pNL4-3 and the anti-site II rev TARmiR, anti-TGF-β TARmiR or anti-site II rev shRNA. 72 hours post-transfection, culture supernatants were collected. The p24 antigen analyses were performed using a Coulter HIV-1 p24 antigen assay (Beckman Coulter, Fullerton, CA) in accordance with the manufacturer's instructions.