A low-molecular-weight compound exerts anticancer activity against breast and lung cancers by disrupting EGFR/Eps8 complex formation

To identify potential candidate compounds that can disrupt EGFR/Eps8 complex formation, the crystal structure of EGFR solved at 2.8-Å resolution was retrieved from the Protein Data Bank (PDB ID code 3GOP) (DOI: https://​doi.​org/​10.​2210/​pdb3GOP/​pdb) [29] and used in this study. The chemical databases used in our virtual screening were provided by TopScience Co., Ltd. Collectively, these databases offer a collection of 390,000 small-molecule organic compounds. The chemical catalogs provide only 2D chemical structures; the 3D structural models were generated by using SYBYL software (Version 7.3, Tripos Associates, St. Louis) with the standard settings. The molecular docking program SYBYL was used to perform the virtual screening. The binding cavity in the EGFR JXM domain was the region targeted for docking. SYBYL software was used to assign the standard AMBER (refers to a set of molecular mechanical force fields for the simulation of biomolecules) atomic partial charges on the EGFR protein and the Gasteiger-Hückel atomic partial charges on each ligand molecule to be docked. The parameters used for modeling docking, which controlled how the docking was performed in our work, were standard settings according to the guidelines of the software [30]. Each molecule in the assessed databases with a molecular weight between 200 and 1000 was docked into the targeted binding site of EGFR. The top 5% scored compounds from each database, as selected by SYBYL, were extracted and combined to provide a total of 18,000 candidate compounds. The preselected 18,000 compounds then were reranked according to their binding affinities as estimated by the total score. Of the best-scored 50 compounds selected by the total score from the 18,000 compounds, physical samples of 29 of these compounds were purchased from TopScience Co., Ltd. PyMOL software (Version 1.6.X, Open-Source) was obtained from the PyMOL website (https://​pymol.​org) [31].

The non-small cell lung cancer cell lines (A549、H460、H1975), breast cancer cell lines (MCF-7、BT549、MDA-MB-468) and multiple myeloma cell line (IM-9) were kept in our laboratory (Hematological Laboratory of Zhujiang Hospital, Guangzhou, China) and genotyped to verify their authenticity. Human normal lung epithelial cell line (BEAS-2B) and human normal mammary epithelial cell line (MCF-10A) were purchased from FuHeng Cell Center (Shanghai, china) and genotyped to verify their authenticity. Normal PBMCs were obtained from 5 unrelated healthy donors at Southern Medical University (Guangzhou, China). MCF-10A cell line was cultivated in MEpiCM medium (Cat No. 7611, ScienCell, San Diego, California, USA) and other cell lineswere cultivated in DMEM or RPMI 1640 medium (Invitrogen, Grand Island, NY, USA) with 10% fetal bovine serum (FBS; Invitrogen) at 37 °C with 5% CO₂.

For testing different compounds, A549 and BT549 cells were plated in a 96-well-plate (5 × 10³ cells/well) and incubated for 24 h before treatment. Then cells were exposed to the compounds for 24 h at a final concentration of 10 μM. After treatment, 10 μl of CCK-8 reagent (Dojindo Laboratories, Japan) was added to each well, and cells were incubated for 3 h at 37°C and 5% CO₂. The optical density (OD) was analyzed at 450 nm. The data obtained are presented as percentage viability in the graph.

The wild-type EGFR (wt-EGFR) sequence was obtained through an NCBI search, the whole length of the gene was synthesized by GENEWIZ, Inc. (Germantown, MD), and the two ends were cloned into the vector PCD531B (SBI) using the restriction site NheI//NotI. At the same time, 30 amino acids in the JXM domain (aa: 650–679) were replaced with a 10 GGS repeating sequence to obtain the new gene sequence mutant-type EGFR (mut-EGFR), which was produced by GENEWIZ, Inc. (Germantown, MD), and both ends were cloned into the vector PCD513B (SBI) by using the restriction site NheI//NotI [32]. The sequence integrity of the completed two vectors were ensured by sequencing. MCF-7 cells were transfected with wt-EGFR, mut-EGFR or PCD531B empty vector using Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocol. Twenty-four hours after transfection, the culture medium was replaced by medium supplemented with 1.0 μg/ml puromycin. Two or 3 days later, the cells that grew to approximately 90% confluency were passed and seeded at a high dilution ratio into 150-mm cell culture dishes. The medium containing puromycin was replaced every 2–3 days until colonies of cells appeared approximately 2 weeks after the initial seeding. Several colonies in each transfection group were selected for further experiments and designated as MCF-7-NC, MCF-7-wt-EGFR or MCF-7-mut-EGFR.

EGFR expression was stably knocked down in A549, H460 and MDA-MB-468 cells via RNA interference (RNAi). The annealed oligonucleotide fragments encoding short hairpin transcripts corresponding to EGFR were as follows: CCGGGCAGATCATCAGAGGAAATATCTCGAGATATTTCCTCTGATGATCTGCTTTTT and CCGGGGAGATAAGTGATGGAGATGTCTCGAGACATCTCCATCACTTATCTCCTTTTT. The nontargeting empty plasmid was used as the control shRNA plasmid. According to the manufacturer’s instructions, A549, H460 and MDA-MB-468 cells (2 × 10⁵cells/well in six-well plates) were transfected separately with the control shRNA plasmid or the EGFR shRNA plasmid using Lipofectamine 2000 (Invitrogen). After 24 h, the culture medium was replaced with medium supplemented with puromycin at a selection concentration. Several colonies in each transfection group were selected for further experiments and designated as A549-NC, A549-EGFR/shRNA1, A549-EGFR/shRNA2, H460-NC, H460-EGFR/shRNA1, H460-EGFR/shRNA2, MDA-MB-468-NC, MDA-MB-468-EGFR/shRNA1 or MDA-MB-468-EGFR/shRNA2.

To test the effects of EE02 on the biological activities of tumor cells and normal cells, tumor cell lines, normal cell lines and normal PBMCs were plated in a 96-well plate (5 × 10³cells/well) and incubated for 24 h before treatment. All cells were then incubated with different concentrations of EE02 (0, 1, 2.5, 5.0, 7.5 or 10 μM) for 24 h.CCK-8 (Dojindo Laboratories, Japan) assays were carried out according to the manufacturer’s instructions. Colonyformation assays were also performed. Cells (A549 and H460 were 300 cells/well, BT549 and MCF-7 were 500 cells/well) were seeded into six-well plates and treated with different concentration’s EE02 or DMSO on the following day. After 2 weeks, the cells were fixed with4% formaldehyde and washed with PBS when colonies were visible. Crystal violet was added to the plates to stain the colonies. The number of apoptotic cells was analyzed by flow cytometry (BD Bioscience) using Annexin V and propidium iodide (PI; BD Biosciences). Cells (1 × 10⁶ cells/well) were seeded in six-well plates and exposed to 10 μM EE02 or DMSO, and they were harvested and processed after 24 h according to the manufacturer’s instructions [33].

All prepared cells were homogenized in IP lysis (CO-IP kit, Thermo Scientific, Cat No. #26149), and debris was removed by centrifugation at 12,000 g for 10 min at 4 °C. The protein concentrations were determined using a Bradford protein assay kit (Beyotime, China, Cat No. #KGP902). After addition of loading buffer, protein samples were electrophoresed, transferred to PVDF membranes (0.2 μm, Millipore, Bedford, MA), and subsequent blocked. The membranes were immunoblotted with rabbit anti-human primary antibody overnight at4 °C. Antibodies of EGFR, Erk, p-Erk, Akt, p-Akt (ser473) and GAPDH were obtained from Cell Signaling Technology (Cat No. #4267, #9102, #9101, #9272, #9271 and #5174 respectively; dilution ratio was 1:1000). Antibody targeting EPS8 was purchased from Biosciences (Cat No. #610143; dilution ratio was 1:1000). After four washes with TBST, the blots were incubated with horseradishperoxidase (HRP)-conjugated secondary antibodies at room temperature for 1 h, and the HRP signal was detected using enhanced chemiluminescence (Pierce Biotechnology, Rockford, IL, USA).

We performed human AKT-1 phosphorylation antibody arrays, which included 18 different antibodies (RayBiotech, Inc., USA) [34, 35]. All the steps are carried out according to the manufacturer’s instructions. Briefly, MDA-MB-468 cells from different groups (EE02 10 μM and DMSO control) were lysed and the total proteins were purified using the Cell and Tissue Protein Extraction Reagent (Kangchen, China). The protein concentrations were tested using a Bradford protein assay kit (Beyotime, China, Cat No. #KGP902). A total of 380 μg protein extract was added into each well and incubated for 3 h at room temperature. Then, the antibody arrays membranes were washed and incubated with HRP-Anti-Rabbit IgG antibody at room temperature for 2 h, and the HRP signal was detected using ImageQuant LAS4000 Scanner (GE Healthcare Corporate, USA). For the coimmunoprecipitation (CoIP) of endogenous proteins, 10 μg of anti-EGFR (Cat No. #4267, CST) or IgG (Cat No. #2729, CST) antibody was added to AminoLink plus coupling resin (Thermo Fisher Scientific, Pierce CoIP kit, Cat No. #26149) for antibody immobilization at room temperature for 100 min. Cells were lysed in cell lysis buffer at 4 °C for 30 min [36]. A total of 1000 μg protein extract was added into each tube of control agarose resin and incubated for 1 h at 4 °C. Then, the protein was centrifuged from the control agarose tube, and the protein-containing liquid was added to the antibody incubation tube, and the mixture was incubated at room temperature for 2 h. Immunoprecipitants were separated by SDS-PAGE after washing with the same buffer and were analyzed by immunoblotting with an anti-Eps8 antibody [37].

Erlotinib was purchased from Selleckchem, dissolved in DMSO at a final concentration of 50 mg/ml and stored at − 20 °C.

Thirty-five male and thirty-five female specific pathogen-free (SPF) BALB/c mice were randomly assigned to seven groups: six treatment groups and one vehicle control group, with five male and five female mice per group. The vehicle control group received DMSO in a volume of 5 mL/kg body weight (b.w.) by intraperitoneal injection. EE02 was dissolved in DMSO and administered to the mice at doses of 75.00, 86.25, 99.19, 114.19, 131.75 or 151.51 mg/kg b.w., and all animals were observed every day for symptoms and mortality for two weeks. The vehicle control group was observed at the same time. All of the surviving animals were euthanized at the end of the study. The vital organs of both the mouse that died and those that were euthanized were individually observed for overt pathology by necropsy, and the 50% lethal dose (LD₅₀) was calculated by the Bliss method on day 14. The vital organs were removed, fixed, and embedded in paraffin for histopathological analyses [38, 39].

All animal experiments complied with Southern Medical University’s Policy on the Care and Use of Laboratory Animals. Five-week-old athymic BALB/c nu/nu male mice were used for in vivo experiments. The animals were housed at a constant room temperature with a 12 h light/12 h dark cycle and fed a standard rodent diet and water. H460 cells were harvested and injected subcutaneously (5 × 10⁶ cells in 100 μl of phosphate-buffered saline (PBS)) into the mice. Treatment began after the size of the H460 tumors reached 50 mm³, and the treatments consisted of intraperitoneal (i.p.) injections of DMSO, EE02 (5 mg/kg b.w. in 100 μl of DMSO), EE02 (10 mg/kg b.w. in 100 μl of DMSO) or erlotinib (10 mg/kg b.w. in 100 μl of DMSO). The treatment was performed every 2 days. Tumor growth was monitored by a digital caliper, and the maximum tumor volume was not allowed to exceed 1500 mm³. At the end of the experiment, the animals were sacrificed, and the tumors were removed. The tumor volumes were determined by measuring the tumor length (L) and width (W) and calculating the volume (V = 0.5 × L × W²), [40]. Tumor samples were excised, fixed, and embedded in paraffin for immunohistochemical (IHC) analyses [41, 42].

Statistical significance was evaluated using SPSS 21.0 software. P < 0.05 was considered statistically significant. * Represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001.

The EGFR binding region of EPS8 is predicted to target the JXM domain of EGFR. We hypothesized that a small molecule that binds to the JXM domain of EGFR will compete with EPS8, consequently blocking the EGFR/EPS8 interaction. With the aid of structure-based virtual screening, we chose a crystal structure of EGFR (PDB ID code 3GOP) that includes the kinase region and the JXM domain. Using SYBYL software to predict and generate the docking pocket of EGFR (Fig. 1a), we narrowed our interest from a total of 390,000 compounds to 50 top candidate compounds and were able to obtain chemical samples of 29 of the top 50 compounds. We first tested the effects of these 29 molecules on the proliferation of A549 and BT549 cell lines by using CCK-8 assays in vitro. Of the 29 compounds tested, the most promising compound was EE02 (ChemDiv No. 0884–0022), which was obtained from TopScience Co., Ltd. (Fig. 1e and f). EE02 is a synthetic compound with a molecular weight of 767 (Fig. 1d). The model of EE02 binding to EGFR was generated by SYBYL software and refined by structural organization using PyMOL software. The refined model, shown in Fig. 1b and c, predicted that EE02 binds the JXM domain and the meshed area where the JXM domain intersects with the kinase domain and forms a number of hydrogen bonds with nearby residues, including Ser-671 and Arg-807 (Fig. 1c).

Initially, to screen the expression levels of EGFR and EPS8 in cancer and normal cell lines, we performed a western blot analysis. The results indicated EGFR overexpression in the MDA-MB-468, H460, A549 and BT549 cell lines; moderate EGFR expression in the H1975 cell line; and very low EGFR expression in the MCF-7, IM-9, MCF-10A and BEAS-2B cell lines. EPS8 was overexpressed in all six breast cancer and NSCLC cell lines (MDA-MB-468, H460, A549, H1975, MCF-7 and BT549), moderate expressed in normal cell lines (MCF-10A and BEAS-2B) and very low expressed in IM-9 cell line (Fig. 2a). Then, to assess the activity of EE02, A549, H460, H1975, BT549, MDA-MB-468 and MCF-7 cells were treated for 24 h with increasing concentrations of the inhibitor EE02 (0–10 μM). The dose-dependent antiproliferative effect of EE02 was determined using CCK-8 assays (Fig. 2c). However, at a 10 μM concentration, the antiproliferative effect of the inhibitor EE02 on the proliferation of the A549, H460, H1975, BT549 and MDA-MB-468 cancer cells was significantly stronger than that on the proliferation of the MCF-7 cells, which overexpress EPS8 but not EGFR (P = 0.003, 0.008, 0.008, 0.008 and 0.009, respectively, t-tests) (Fig. 2a and c). We then examined the effect of EE02 on the colony formation capability of the breast carcinoma and NSCLC cells and found that the inhibitor EE02 significantly reduced colony numbers of A549 (P < 0.001, one-way ANOVA), H460 (P < 0.001, one-way ANOVA), H1975 (P < 0.001, one-way ANOVA) and BT549 (P < 0.001, one-way ANOVA) in a dose-dependent manner (Fig. 2b). At 5 μM, the inhibitory effect of EE02 on the colony formation capability of the A549, H460 and BT549 cancer cells was stronger than that on the colony formation capability of the MCF-7 cells (Fig. 2b). Moreover, EE02 did not result in significant suppression in normal cell lines (MCF-10A and BEAS-2B, less than 40% suppression) and peripheral blood mononuclear cells (PBMCs) from 5 untreated healthy volunteers (less than 30% suppression), suggesting that EE02 possesses specificity toward cancer cells that overexpress EGFR and EPS8 (Fig. 2d and e).

To examine the apoptotic effect of EE02, A549, H460, MDA-MB-468 and MCF-7 cells were treated with DMSO or EE02 for 24 h and then stained with annexin V and propidium iodide (PI). As is shown in Fig. 3a, after 24 h of exposure to 10 μM EE02, a significant increase in the apoptosis rates of A549 (P = 0.005, t-test), H460 (P = 0.026, t-test), MDA-MB-468 (P = 0.003, t-test) and MCF-7 (P = 0.004, t-test) cell lines were observed (Fig. 3a). The ability of EE02 to promote apoptosis was significantly stronger in the A549, H460 and MDA-MB-468 cancer cells than in the MCF-7 cells (P = 0.037, 0.045 and 0.016, respectively, t-test) (Fig. 3a). Moreover, EE02 did not result in a significant promotion of apoptosis in normal cell lines (MCF-10A and BEAS-2B, less than 7% apoptotic cells) and PBMCs from 5 untreated healthy volunteers (less than 5% apoptotic cells), suggesting that EE02 possesses specificity toward cancer cells that overexpress EGFR and EPS8 (Fig. 3b and c).

To verify that the antitumor effect of EE02 on cancer cells was related to the EGFR protein, we knocked down EGFR expression in H460, A549 and MDA-MB-468 cells; performed western blotting and gray values analysis; and compared the results with those of the vehicle-treated H460, A549 and MDA-MB-468 cells. As shown in Fig. 4b, the EGFR expression in the H460-EGFR/shRNA1 and H460-EGFR/shRNA2 cells was significantly downregulated compared to that in the H460-NC cells, and the same was true of the A549 and MDA-MB-468 cell lines. Subsequently, to detect whether the sensitivity of tumor cells to EE02 was reduced after knocking down EGFR, the cancer cells were treated for 24, 48 or 72 h with increasing concentrations of the inhibitor EE02 (H460: 0–3.0 μM; A549: 0–5.0 μM; and MDA-MB-468: 0–2.5 μM), and CCK-8 assays were then performed. The results showed that the sensitivity of the A549, H460 and MDA-MB-468 cells to the inhibitor EE02 was significantly decreased after the knockdown of EGFR expression, suggesting that the antitumor effect of EE02 is related to EGFR (Fig. 4d).

To verify that the inhibitor EE02 acts as an antitumor agent by targeting the EGFR JXM domain, we designed a mutant receptor, mut-EGFR, in which the JXM domain is replaced by a (GGS)₁₀ sequence (Fig. 4a). The (GGS)₁₀ sequence has been demonstrated to lack a regular secondary structure and to be very flexible. The plasmid was created as described in the Methods. Briefly, amino acids 650–679 of EGFR were replaced by the (GGS)₁₀ sequence.

MCF-7 cells were transfected with wt-EGFR, mut-EGFR, or the empty vector. The transfected cells were analyzed by western blotting and gray values analysis, and the results were compared with those of the vehicle-treated MCF-7 cells. As shown in Fig. 4b, the EGFR expression levels in the MCF-7-wt-EGFR and MCF-7-mut-EGFR cells were significantly upregulated compared to those in the MCF-7-NC cells. Subsequently, to detect whether the sensitivity of tumor cells to EE02 increased after the overexpression of EGFR, the cancer cells were treated for 24 h, 48 h or 72 h with increasing concentrations of the inhibitor EE02 (0–5.0 μM), and then CCK-8 assays were performed. The results showed that the sensitivity of the MCF-7-wt-EGFR cells to the inhibitor EE02 was significantly higher than that of the other transfected cells, but there was no significant difference between the sensitivities of the MCF-7-mut-EGFR and MCF-7-NC cells. The results indicate that the antitumor effect of EE02 is mediated by targeting the EGFR JXM domain (Fig. 4d).

Previous results have shown that EE02 inhibits the proliferation of tumor cells by targeting the JXM domain of EGFR. EGFR is a transmembrane protein, and EPS8 is an intracellular protein. We assume that Eps8 interacts with the JXM domain of EGFR, which is intracellular and close to the membrane. The coimmunoprecipitation results showed that in A549, H460 and MDA-MB-468 cells, which express both EGFR and EPS8, Eps8 interacted with EGFR to form an EGFR/EPS8 complex (Fig. 4c). Can the inhibitor EE02 disrupt the EGFR/EPS8 interaction by binding to the JXM domain of EGFR? To test this hypothesis, MDA-MB-468 cells expressing high levels of endogenous EGFR and EPS8 were treated with EE02 (10 μM) for 24 h. Coimmunoprecipitation was performed using an anti-EGFR antibody. The results indicated that the treatment with EE02 resulted in EGFR/EPS8 complex dissociation. As is shown in Fig. 4c, little EPS8 was detected in the EGFR immunoprecipitants after the treatment with the inhibitor EE02. Our results showed that EE02 is a potent inhibitor that was predicted to bind to the EGFR JXM domain and block the EGFR/EPS8 complex.

EE02 blocks EGFR/EPS8 complex formation by competitively binding to the JXM domain of EGFR. What effects does EE02 have on the signaling pathway downstream of this complex? To further examine the inhibitory effect of EE02 on EGFR/EPS8 complex downstream signaling, we detected the expression of EGFR/EPS8 complex target proteins by protein chip assays. MDA-MB-468 is a breast cancer cell line that expresses high levels of EGFR and Eps8. We examined protein levels after these cells were treated with EE02 (10 μM) for 24 h. We also included a control group treated with DMSO. The protein chip results showed that the levels of p-Akt, p-4E-BP-1, p-Erk1/2, p-Gsk3β, p-mTOR, p-p70S6K, p-PRAS40 and p-RPS6 were apparently decreased after the treatment with EE02 compared with that after the treatment with DMSO, but there was no difference between the EE02 group and the DMSO control group in the expression of other proteins on these protein chips (Fig. 5a).

To further identify the inhibitory effect of EE02 on downstream MAPK/Erk and PI3K/Akt signaling, we measured EGFR, Eps8, Akt, p-Akt, Erk and p-Erk protein expression in MDA-MB-468 and H460 (NSCLC cell line) cells after EE02 treatment for 24 h. The Akt, p-Akt, Erk and p-Erk protein levels were inhibited in a dose-dependent manner in these two cell lines, while the total EGFR and Eps8 protein levels were unaffected (Fig. 5b and c).

The results of the intraperitoneal single-dose toxicity study are summarized in Table 1. No mice died after receiving an intraperitoneal dose of up to 75.00 mg/kg b.w. EE02. Conversely, both female and male mice died when given an intraperitoneal dose of 150.85 mg/kg b.w. EE02. In other groups, different numbers of mice died, and as the dose increased, the number of mice that died gradually increased (Table 1). According to these results, the approximate LD₅₀ in the mice was determined to be 101.92 mg/kg b.w. by the Bliss method, and the 95% confidence interval was 93.67 mg/kg b.w. to 110.49 mg/kg b.w.. No adverse effects or clinical signs of toxicity were observed in the surviving mice during the study except for slight weight loss during the first week after the EE02 treatment. However, in the second week, the mice gradually gained weight and approached their pretreatment weights (Fig. 6a, b and c).

In addition to lethality, other parameters should be considered and investigated in acute toxicity studies to identify signs of toxicity or toxic potential in specific organs. Therefore, macroscopic and histological analyses were performed in the liver, spleen and kidneys. In addition, the testes of the male mice were also examined. Macroscopic analysis showed no changes in the color or morphology of the liver, spleen, kidneys or testes when the mice were treated intraperitoneally with the different doses of the inhibitor EE02 or DMSO. Further histological analysis showed no gross pathological findings and no significant differences in the liver, spleen, kidneys or testes between the EE02- and DMSO-treated mice (Fig. 6d and e).

The acute toxicity study for EE02 was conducted in mice to establish the potential for acute toxicity and to provide information pertaining to the upper dose limit for longer-term feeding studies. On the basis of the toxicity study results, the estimated LD₅₀ of EE02 in mice is 101.92 mg/kg b.w. Under the conditions of this study, a unique composition of EE02 and DMSO did not produce any acute intraperitoneal toxicological effects. This indicates that EE02 has relatively low toxicity and high potential for development as a new drug.

We next sought to explore whether EE02 exhibited anticancer activity in an orthotopic H460 xenograft mouse model. Compared to the DMSO treatments, the low-dose EE02 (5 mg/kg b.w., P = 0.003, t-test), high-dose EE02 (10 mg/kg b.w., P < 0.001, t-test) and erlotinib (10 mg/kg b.w., P < 0.001, t-test) treatments significantly suppressed tumor growth, as is shown by the photos of the tumors excised at the end of the experiment (Fig. 7e). Compared with low-dose EE02 (5 mg/kg b.w.), both high-dose EE02 (10 mg/kg b.w., P = 0.001, t-test) and erlotinib (10 mg/kg b.w., P < 0.001, t-test) significantly inhibited tumor growth in the H460 xenograft model (Fig. 7b and d). There was no difference between the high-dose EE02 (10 mg/kg b.w.) and erlotinib (10 mg/kg b.w.) treatments (P = 0.236, t-test) (Fig. 7b and d). We monitored mouse body weights over a 20-day period to assess toxicity and found no statistically significant differences in mouse body weight among the four experimental groups, indicating that these inhibitors have very low or no toxicity in vivo (Fig. 7c). As is shown in Fig. 7f, compared to those from the DMSO control mice, the tumors from the EE02-treated mice showed decreased proliferation, as assessed by Akt, Erk, p-Akt, p-Erk and ki-67 staining. These data demonstrated that EE02 is a potential inhibitor that is able to reduce the growth of tumors.