A novel mechanism of lncRNA and miRNA interaction: CCAT2 regulates miR-145 expression by suppressing its maturation process in colon cancer cells

To determine the putative functional properties of CCAT2 in the development of colorectal tumor and its relation to miRNAs expression, pCMV/CCAT2 plasmid was stably transfected in HCT-116 and CR-HT-29 cells. As determined by qRT-PCR (real time PCR) analysis, the expression of CCAT2 was found to be ~25–50-fold higher in the CCAT2 positive cells, compared to those with the empty vector (Fig. 1a and c). We observed overexpression of CCAT2 to cause downregulation of miR-145 and to stimulate miR-21 (Fig. 1b and d).

The next set of experiments was carried out to determine whether knockdown or knockout of CCAT2 increased the expression of miR-145. To conduct the experiments, we utilized siCCAT2, which induced a knockdown of ~30% of CCAT2 compared with corresponding vector (NT-siRNA) controls. CCAT2 knockdown using CRISPR-CAS9, showed ∼80% reduction in CCAT2 levels compared with the corresponding controls (Fig. 1e and f). As expected, CCAT2 knockdown increased the expression of miR-145 and negatively regulated miR-21 in HCT-116 cells (Fig. 2g and h).

Next, we moved on to explore the mechanism of miR-145 regulation by CCAT2. Considering miRNA biogenesis process, we first determined the location of CCAT2 in colon cancer cells. RT-PCR and in situ hybridization was employed for this set of experiments. First, the nuclear and cytoplasmic fractions from stable clones of CCAT2 over-expressing colon cancer cells were isolated and the RNA was extracted from these fractions. The qRT-PCR results show that the expression of CCAT2 was >10 fold higher in the nucleus and only 0.6 fold in cytoplasmic fractions compared with corresponding chemo-resistant CR-HT-29 cells (Fig. 2a). In HCT-116 cells, CCAT2 was 3.5 time higher in nucleus (Fig. 2b). To visualize CCAT2 and its location in the cells, we performed fluorescence in situ hybridization (FISH) by using a biotin-labeled nucleic acid probe against CCAT2 RNA. The fluorescence was detected in both the nucleus and the cytoplasm, with a more intense fluorescence in the nucleus, indicating an obvious enrichment of CCAT2 in the nuclear compartment (Fig. 2c).

In the next set of experiments we tested whether the pre-miR-145 level was associated with expression and location of CCAT2 in the modulated colon cancer cells. We observed that the expression of pre-miR-145 was 97-fold higher in stable clones expressing CCAT2, and 90% lower in CCAT2 knockout HCT-116 cells compared with corresponding HCT-116 cells. However, pre-miR-21 was decreased in both CCAT2 over-expressing and knockout cells (Fig. 3a). pre-miR-145 was enriched in the nuclear fraction of cells (Fig. 3b). The expression of CCAT2 positively correlated with expression of pre-miR-145 but negatively with mature miR-145 that indicating that CCAT2 regulates miR-145 maturation process.

Based on above results, we hypothesized that CCAT2 downregulates miR-145 expression by selectively suppressing its maturation process in colon cancer cells. To test this hypothesis, the pri-miR-145 containing pre-miR-145 and up and down-stream flanking sequence (total 668 nucleotide) was synthesized in vitro by T7 RNA polymerase and labeled by incorporation of digoxigenin-UTP. First, the synthesized pri-miR-145 was digested by the nuclear or cytoplasmic fractionations of HCT-116 cells separately. The enzyme activities in these fractions were maintained to provide conditions similar to those in the cellular environment. The mature miR-145 was highly increased in the reaction containing cytoplasmic fraction (Fig. 4a), which agrees with an earlier observation [35]. Alternately, the synthesized pri-miR-145 was cleaved by recombinant human Dicer enzyme with or without CCAT2. The results of qRT-PCR show that in the presence of CCAT2 the expression of miR-145 was decreased by more the 50% (Fig. 4a and b). Finally, the dig-labeled pri-miR-145 was mixed with the RNA which was isolated from over-expression or knock out CCAT2 colon cancer CR-HT-29 and HCT-116 cells or corresponding controls, and digested by recombinant human Dicer enzyme. The relative levels of pri-, pre- and mature miR-145 within individual reaction are listed in Table 1. qRT-PCR shows that the pri-miR-145 was ~35–100 fold higher in reaction containing RNA from CCAT2 over-expressing cells compared with the corresponding controls (Fig. 5a and b). Pre-miR-145 was determined by the two sets of primers and the resulting PCR products were 83 bp and 71 bp, separately. The results of agarose gel clearly show that the level of pre-miR-145 correlated with CCAT2 in the reactions (Fig. 6a).

To avoid the effect of endogenous production of pri-, pre- and miR-145, the RNAs digested by Dicer were also separated on denaturing polyacrylamide gel, transferred to the PVDF membrane and detected with anti-digoxigenin antibody. The image shows that Dicer cleaves more than ~80–90% of Dig-labed pri-miR-145 (Fig. 6b lane 1 and 2), and RNA which comes from CCAT2 overexpressing clones (Fig. 6b lanes 4 and 6) suppressed the digestion reaction compared with the corresponding controls (lanes 3 and 5) or CCAT2 knockout HCT-116 cells (lane 7).

Human colon cancer HCT-116 and HT-29 cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD). Cells were maintained in Dulbecco’s modified Eagle medium (DMEM; 4.5 g/L d-glucose) supplemented with 10% FBS (Invitrogen, Grand Island, NY) and 1% antibiotic/antimycotic in tissue culture flasks. 5-Fluorouracil and Oxaliplatin (Fu-Ox) resistant [chemo-resistant (CR)] colon cancer HCT116 and HT29 cells were generated as described earlier [15, 33] in our laboratory and were maintained in normal culture medium containing 2× FuOx (50 μM 5-Fu + 1.25 μM Ox) in tissue culture flasks in a humidified incubator at 37 °C in an atmosphere of 95% air and 5% carbon dioxide. The medium was changed two times a week, and cells were passaged using 0.05% trypsin/EDTA (Invitrogen, Grand Island, NY).

pCDNA-CCAT2 plasmid or empty vector DNA alone was transfected into HCT-116 and CR-HT-29 cells by Lipofectamine™ 2000 reagent according to manufacturer’s instructions (Invitrogen Corp, CA). Several independent sublines (colonies) were generated over 8–10 wk of the selection period in the presence of 0.4 mg/ml G418 (Neomycin). Colonies were collected and grown as individual cell lines in the presence of 0.4 mg/ml G418. The cells were subjected to RT-PCR analysis to evaluate CCAT2 expression.

The plasmid vector expressing Cas9 enzyme driven by the CMV promoter and an enhanced GFP-selectable marker was obtained from OriGene (plasmid GE100018, Rockville, MD). CRISPR guide RNA specifically targeting CCAT2 sequence (210–219 Forward) and (1288–1307 Reverse) was cloned into the vector, (forward gRNA GAGCTAAGAGGAAACCACCT and complement strand AGGTGGTTTCCTCTTAGCTC; reverse gRNA CTCCTATTCATACCATATTA and complement strand TAATATGGTATGAATAGGAG) and verified by DNA sequencing. HCT-116 cells were transfected using Lipofectamine 3000 transfection reagent (Invitrogen Corp, CA), and positive cells were sorted for enhanced GFP by flow cytometry and directly seeded into the 96 well plates as single cell per well. Two week after transfection, single clones were isolated and expression of CCAT2 was detected by RT-PCR.

The knock out or overexpressing CCAT2 HCT-116 cells were grown in a 4 chamber slide for 48 h. After washing with PBS, the cells were fixed with 3.7% paraformaldehyde, permeabilized with 70% ethanol, and rehydrated in 2×SSC with 50% formamide for 5 min at room temperature. Cells were hybridized overnight at 42 °C with biotin-labeled CCAT2 probe mixture containing 10% dextran sulfate, 5X Denhardt’s reagent, 2× SSC, 50% formamide and 100 μg/ml denatured fragmented salmon sperm DNA. The non-specific probe was removed by 0.5× SSC containing 50% formamide at 37 °C. The anti-biotin monoclonal antibody and Alexa Fluor® 647–conjugated secondary antibody were used for detecting biotin-labeled CCAT2. Cells were washed with PBS and then placed on cover slips with prolong gold antifade reagent containing DAPI (Cell Signaling Technology, Boston, MA, USA). Stained cells were observed under an Olympus microscope supporting a Hamamatsu 1394 ORCA-ERA video camera and the images were stored using Slidebook Digital Microscopy Software (Intelligent Imaging Innovations).

pCMV-miR-145 plasmid carrying pre-microRNA-145 and 250–300 nts up and down-stream flanking sequence (Origene, Nockville, MD) was linearized with the restriction enzyme (Not I and Xho I) to make a template for in vitro transcription. The pri-miR-145 was synthesized and labeled by incorporation of digoxigenin-UTP (Roche Molecular Biochemicals, Indianapolis, IN) using a Maxiscript T7 in vitro transcription kit (Invitrogen).

In vitro processing of pri-miRNAs was performed using recombinant human Dicer enzyme kit (Genlatis, San Diego, CA) [40]. Briefly, 10 μL of processing reaction contained 4ul dicer reaction buffer, 2 μL of recombinant dicer enzyme, 2.5 mM MgCl₂, 1 mM ATP, and 0.2 μg of Digxigenin labeled pri-miR-145. The reaction mixture was incubated at 37 °C for 90 min. RNA was extracted from the reaction mixture by phenol extraction and was assessed by quantitative RT-PCR for determination of mature miR-145, pre-miR-145 and pri-miR-145. The RNA was also analyzed on 8% denaturing polyacrylamide-8M urea gel, transferred to PVDF membranes and detected with anti-digoxigenin antibody.

Total RNA was extracted from cells, nuclear and cytoplasmic fractions using RNA-STAT solution (Tel Test, Friendswood, TX) according to the manufacturer’s instructions. The total RNA was treated with DNase I and purified with phenol-chloroform. RNA concentration was measured spectrophotometrically at an optical density of 260 nm.

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed using the GeneAmp RNA PCR Kit (Applied Biosystems, Foster City, CA). 5 μl of cDNA products were amplified with SYBR Green Quantitative PCR Master Mix (Applied Biosystems). PCR primers were used as follows: pri-miR-145, forward: 5′-ccaggctaggaactgaatgg-3′, reverse: 5′-caagaaacgcatgcctgat-3′; pre-miR-145-1, forward: 5′-cttgtcctcacggtccagtt-3′ and reverse: 5′-ccatgacctcaagaacagtatttct-3′, pre-miR-145-2 forward: 5′-gtccagttttcccaggaa-3′ and reverse: 5′- ccatgacctcaagaacagtatttct −3′; CCAT2, forward: 5′-tgctccaggcaataactgtg-3′ and reverse: 5′-gaaagtgggctcattccttg-3′; β-actin forward: 5′-cccagcacaatgaagatcaa-3′ and reverse 5′-acatctgctggaaggtggac-3′. Reactions were carried out in Applied Biosystems 7500 Real-Time PCR System. The running conditions for PCR were as follows: for activating the DNA polymerase, hot start was performed for 10 min at 95 °C, and then cycling at 95 °C for 15 s and 60 °C for 1 min for a total of 40 cycles.

TaqMan microRNA assays were used to quantitate miR-21 and miR-145 in different colon cancer cells according to the manufacturer’s instruction (Applied Biosystems, Foster City, CA). Briefly, cDNA synthesis was carried out with the TaqMan MicroRNA reverse transcription kit (Applied Biosystems). The miRNA reverse transcription-PCR (RT-PCR) primers for miR-21, miR-145 and endogenous control RNU6B were purchased from Applied Biosystems. Real-time quantitative RT-PCR (qRT-PCR) analysis was carried out using Applied Biosystems 7500 Real-time PCR System. The PCR mix containing TaqMan 2× Universal PCR Master Mix were processed as follows: 95 °C for 10 min and then 95 °C for 15 s, 60 °C for 60 s for up to 40 cycles. Signal was collected at the endpoint of every cycle. The gene expression ΔC _T values of miRNAs from each sample were calculated by normalizing with internal control RNU6B and relative quantitation values were plotted.

The ability of miR-145-overexpressing and parental HCT-116 cells to form spheres in suspension was evaluated as described previously [41].