Introduction
While the
p53 gene is the most commonly mutated gene in human cancers [
1],
p53 mutations in breast cancers occur in only 20% of cases [
2‐
4]. Breast cancer cells with wild-type
p53 often have high levels of the oncogenic protein Mdm2 suggesting that Mdm2 might block the function of p53 [
5‐
7]. In addition, elevated expression of Mdm2 occurs in estrogen receptor α positive (ERα +) breast cancer cells independently of p53 using evolutionarily conserved AP1 and ETS family transcription factors [
8]. Two-thirds of breast cancers demonstrate estrogen-dependent growth [
9]. In response to estrogen, ERα induces transcription of target genes to activate cell proliferation and survival [
10,
11]. This could be, in part, through coordinated activation of cell proliferation and inhibition of cell death. Estrogen induces expression of the anti-apoptotic gene
bcl-2 thus inhibiting apoptosis [
12] and also stimulates Myc expression to aid in cell survival [
11]. In addition, estrogen can influence the p53-pathway because ERα can inhibit p53 transcriptional activity by interacting with p53 on the chromatin [
13,
14]. While Mdm2 has been implicated in estrogen's mechanism of action, the role that Mdm2 plays in this process has not been clearly defined [
6,
15‐
17]. Mdm2 expression is increased in the presence of estrogen [
8,
18] and Mdm2 enhances the function of ERα [
19]. A cancer predisposition single nucleotide polymorphism at position 309 in the
mdm2 gene P2 promoter (T→G) increases binding affinity for the SP1 transcription factor, leading to Mdm2 over-expression [
20]. The Mdm2 SNP309 G allele has also been associated with inhibition of the p53-Mdm2 pathway [
20,
21]. In cancer cells that are homozygous G/G for the Mdm2 SNP309, the Mdm2 protein remains associated with the chromatin as a p53-Mdm2 complex resulting in compromised p53 trans-activation [
21]. Moreover, the
mdm2 SNP309 G allele associates with accelerated tumor formation in a gender-specific and hormone-dependent manner [
6]. Therefore, the connection between estrogen and Mdm2 implicates inhibition of p53 as a possible mechanism of action.
In normal cells
mdm2 transcription is activated by p53 [
22] and Mdm2 protein functions to target p53 for proteolysis [
23,
24]. Mdm2 also inhibits p53 transactivation by blocking p53 association with the transcription machinery [
25‐
28]. Additionally, Mdm2 mediates histone ubiquitination leading to repression of p53 targets [
29]. Mdm2 has also been shown to target p21 for proteasomal turnover independently of ubiquitination [
30]. Mdm2 may impart some of its tumorigenic properties by increasing the degradation of multiple cellular proteins.
If Mdm2 is blocking the p53-pathway in estrogen receptor positive breast cancer cells then the conventional chemotherapeutics that rely on the p53 tumor suppressor, a major cell death regulator [
31], may not activate cell death effectively. p53 acts by promoting expression of numerous genes which control cell cycle arrest, senescence, apoptosis, DNA repair, genomic stability and survival [
32]. p53 also plays a pro-apoptotic role by activating target genes that produce products that dimerize with Bcl-2, one critical target of this type is
puma [
33]. Endocrine therapy is used in ERα+ breast cancers and this reduces Bcl-2 levels, however, due to acquired resistance other treatment options need to be identified [
34]. The involvement of the p53-Mdm2 pathway in estrogen's influences places this pathway at the forefront of our investigation.
Using inducible gene silencing of mdm2 and p53 we examined if the p53-Mdm2 pathway was required for estrogen-mediated cell proliferation. We found that a p53-independent role for Mdm2 participated in estrogen-induced proliferation of MCF-7 and T-47D breast cancer cells. Inducible knockdown of Mdm2 in MCF-7 cells with wild-type p53 decreased cell proliferation and increased p21. Moreover, inducible gene silencing of mdm2 caused a reduction in the estrogen-induced target Bcl-2. Inducible knockdown of Mdm2 in estrogen treated T-47D cells with oncogenic mutant p53 decreased cell proliferation without increasing p21. Our data suggest that estrogen activates cell proliferation using Mdm2 to repress multiple cell cycle checkpoints as evidenced by comparison of MCF-7 and T-47D outcomes following inducible shRNA mediated knockdown of Mdm2.
Materials and methods
Cell culture
MCF-7 (p53 wild-type, mdm2 SNP309 T/G), T-47D (oncogenic mutant p53 L194F, mdm2 SNP309 G/G) and ZR75-1 (p53 wild-type, mdm2 SNP309 T/T) from American Type Culture Collection (ATCC). MCF-7 and ZR75-1 cells were grown in RPMI 1640 medium (Mediatech) and T-47D cells were grown in DMEM medium (Invitrogen, Carlsbad, CA, USA). Both media were supplemented with 10% FBS (Gemini, West Sacramento, CA, USA) and 2,500 units of penicillin-streptomycin (Mediatech, Herndon, VA, USA) at 5% CO2 37°C humidified incubator. We generated constructs with inducible (TET-ON) shRNA for mdm2 and p53 or without the shRNA oligonucleotide (a generous gift from Scott Lowe). Constructs were introduced into the MCF-7 cells (mdm2 or p53 shRNA) and T-47D cells (mdm2 shRNA) by retrovirus mediated gene transfer method. Briefly, Phoenix packaging cells were transfected by calcium phosphate method with either an rtTA plasmid or with a vector containing mdm2, p53 or no shRNA oligo. The generated viruses were harvested and MCF-7 cells or T-47D cells were co-infected with the rtTA plasmid and one of the vectors. After selection with puromycin (vector with shRNA) and hygromycin (rtTA), clonal cell lines were generated by limited dilution method. Clonal cell lines were selected based on the level of Mdm2 or p53 knockdown. Experiments shown were carried out on clonal cell lines. MCF-7 mdm2 shRNA 151656 clone C4; T-47D mdm2 shRNA 151657 clone 3B6; MCF-7 p53 shRNA 2120 clone D11. To induce shRNA expression, cells were treated with 2 μg/ml doxycycline (DOX) for time periods indicated in the figures.
Treatments
Estrogen (17β-estradiol, E2), Etoposide and DMSO were purchased from Sigma, Saint Louis, MO, USA. 24 hours prior to treatments, growth medium was changed to phenol-red-free RPMI 1640 (for MCF-7 cells) or DMEM (for T-47D cells) containing 10% charcoal-stripped FBS (Gemini) and antibiotics. Fresh medium was supplemented every 72 hours.
Quantitative reverse transcription-PCR (qRT-PCR)
RNA was isolated using QIAshredder columns and RNeasy Mini Kit (Qiagen, Valencia, CA, USA). A total of 5 μg of RNA was used for cDNA synthesis using High Capacity cDNA Archive Kit reagents (Applied Biosystems, Foster City, CA, USA). 150 ng of cDNA was combined with Taqman Universal Master Mix (Applied Biosystems, Foster City, CA, USA) and Applied Biosystems Assays on Demand primers/probes for puma (Hs00248075_m1), mdm2 (Hs00242813_m1), p21 (Hs00355782_m1) or ACTIN (4352935E). PCR reaction was carried out in 7500 Sequence Detection System (Applied Biosystems). P-values were calculated by student t-test.
Cells were lysed in RIPA buffer (0.1% SDS, 1% NP-40, 0.5% Deoxycholate, 150 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 50 mM Tris-Cl pH8) with 1 mM PMSF, 8.5 μg/ml Aprotinin and 2 μg/ml Leupeptin following standard protocol.
Western blot
A total of 50 μg of protein extract were separated by 10% SDS-PAGE and electro-transferred to nitrocellulose membrane. Immunoblotting was done with p53 antibodies (a 1:1:1 mix of hybridoma supernatants, pAb421, pAb240 and pAb1801); Mdm2 in MCF-7 and ZR75-1 cells (SMP-14 Santa Cruz sc-965, Santa Cruz Biotechnology, Santa Cruz, CA, USA); Mdm2 in T-47D cells (a 1:1:1 mix of hybridoma supernatants, 4B2, 2A9 and 4B11); Bcl-2 (100 Santa Cruz sc-509); PUMA (Cell Signaling 4976, Danvers, MA, USA); p21 (Ab-1 Oncogene Research Science OP64, Gibbstown, NJ, USA); Actin (Sigma A2066). To detect p21 protein in T-47D cells, 100 μg of protein extract was transferred to a PVDF membrane.
Immunofluorescence
Cells, grown and treated on coverslips, were fixed with 4% Formaldehyde and permeabilized with 0.5% Triton-X-100. Immunohistochemistry was done with p53 (FL-393 Santa Cruz sc-6243) and Mdm2 (SMP-14 Santa Cruz sc-965) antibodies followed by incubation with FITC-conjugated anti-mouse (Jackson ImmunoResearch 715-095-150, West Grove, PA, USA) and Alexa-conjugated anti-rabbit (Invitrogen A11037). Coverslips were mounted onto slides using Vectashield mounting medium with DAPI (Fisher Scientific NC9524612, Pittsburgh, PA, USA). Images were collected by PerkinElmer UltraVIEW ERS Spinning Disc Microscope, Waltham, MA, USA.
Chromatin immunoprecipitation (ChIP)
Cells were incubated with 1% Formaldehyde for 30 minutes at 5% CO
2 37°C humidified incubator, followed by 0.125 M Glycine treatment for 5 minutes. Cells were lysed in RIPA buffer with 1 mM PMSF, 8.5 μg/ml Aprotinin, 2 μg/ml Leupeptin and Phosphatase Inhibitor Cocktail 1 (Sigma)). Lysates were sonicated 10 times (one minute pulse and one minute rest) in a Branson Digital Sonifier, Danbury, CT, USA and spun down for 30 minutes 13,000 rpm at 4°C. 400 μg of protein from cell lysates were subjected to overnight incubation at 4°C with 2 μg of p53 (Ab-6 Calbiochem OP43, Gibbstown, NJ, USA); Mdm2 (N-20 Santa Cruz sc-813); or non-specific IgG (Santa Cruz, IgG mouse sc-2025, IgG rabbit sc-2027). 50 μl of 25% beads slurry of protein A/G Plus Agarose beads (Santa Cruz sc-2003), pre-blocked with 0.3 mg/ml sheared herring sperm DNA (Invitrogen, 15634-017), were added to immunoprecipitation samples for two hours at 4°C, followed by washes:
(1) 0.1% SDS, 1% Triton-X-100, 20 mM Tris pH8.1, 150 mM NaCl;
(2) 0.1% SDS, 1% Triton-X-100, 20 mM Tris pH8.1, 500 mM NaCl;
(3) 0.25 M LiCl, 1% NP-40, 1% Deoxycholate, 1 mM EDTA, 10 mM Tris pH8; and
(4) twice with TE pH8. Immunoprecipitated chromatin was de-crosslinked overnight at 65°C with 1 mg/ml ProteinaseK, 1% SDS and 0.1M NaHCO
3. For total DNA input, 40 μg were similarly de-crosslinked. DNA fragments were purified using Qiagen QiaQuick kit (Qiagen) and amplified by real-time quantitative PCR in 7500 Sequence Detection System (Applied Biosystems). Primers and probes sequences are based on [
35], and are provided below:
puma:
forward primer: GCGAGACTGTGGCCTTGTGT;
reverse primer: CGTTCCAGGGTCCACAAAGT;
probe: TGTGAGTACATCCTCTGGGCTCTGCCTG.
mdm2:
forward primer: GGTTGACTCAGCTTTTCCTCTTG;
reverse primer: GGAAAATGCATGGTTTAAATAGCC;
probe: GCTGGTCAAGTTCAGACACGTTCCGAA.
p21:
forward primer: GTGGCTCTGATTGGCTTTCTG;
reverse primer: CTGAAAACAGGCAGCCCAA;
probe: TGGCATAGAAGAGGCTGGTGGCTATTTTG.
mdm2siRNA transfection
Cells were seeded in media with no antibiotics. After 24 hours, 10 μl Lipofectamine2000 (Invitrogen) was incubated for 5 minutes with 240 μl Optimem (Invitrogen). 0.2 nmol (100 nM) of non-specific or mdm2 siRNA (Dharmacon) were resuspended in 250 μl Optimem and combined with Lipofectamine2000. After 20 minutes, 500 μl siRNA-Lipofectamine2000 mix was added to cells with 1.5 ml Optimem. Six hours later, complete growth media was supplemented.
Cell proliferation
Number of cells was determined by the Guava Viacount assay according to manufacturer's protocol (Millipore, Lincoln Park, NJ, USA). Graphs show means and standard errors of three independent experiments. P-values were calculated by student t-test.
Fluorescence activated cell sorting (FACS)
FACS was performed on a FACScan (BD Biosciences, San Jose, CA, USA). After treatments, cells were harvested, washed, resuspended in PBS containing 2% bovine serum albumin, 0.1% sodium azide, fixed in 30% ethanol, and stored overnight at 4°C. Before sorting, propidium iodide staining and RNase treatment were performed for 30 minutes at 37°C.
Cell culture in matrigel
MCF-7 cells were seeded at a density of 5 × 103 cells per chamber in an eight chamber slide on top of 50 μl solidified matrigel (BD Biosciences) in MEBM basal medium without phenol red (Lonza CC-3153, Walkersville, MD, USA) supplemented with bullet kit components except for BPE (Lonza CC-4156), 10% charcoal FBS and 2% matrigel, in the presence of 10 nM estrogen and in the absence or presence of 2 μg/ml doxycycline. Medium was changed every three days. Brightfield pictures show mass structures that MCF-7 cells form in matrigel after three weeks. MCF-7 cells were also fixed directly in culture with 4% Formaldehyde and stained with propidium iodide. Confocal analysis was performed using Laser scanning spectral confocal microscope TCS SP2. Large, intermediate and small mass structures were counted and presented as percent of the total population.
Discussion
Estrogen receptor α (ERα) positively regulates growth and development of various tissues, and promotes increased proliferation of breast cancer cells [
10]. Based on emerging data, the delicate balance between the opposing functions of p53 and ERα appears to be disrupted in breast cancer cells that over-express the Mdm2 oncogene. Soon after Mdm2 was discovered, ERα was shown to associate with high levels of Mdm2 in breast tumors [
7,
43,
44]. In addition, the estrogen-dependent increase in Mdm2 has been associated with p53 and ERα recruitment to the
mdm2 gene promoter [
8,
18]. Our current work has addressed the central dogma of the relationship between Mdm2 upregulation by estrogen and its direct influence on wild-type p53 protein function and breast cancer cell proliferation.
We studied the mechanism by which estrogen might influence the p53 pathway in breast cancer cells with wild-type
p53 by determining p53 and Mdm2 protein levels and the trans-activation properties of p53 in the MCF-7 (
mdm2 T/G SNP309) breast cancer cell line. We also examined the influence of estrogen on isogenic MCF-7 cell lines with inducible ("tet-on") short-hairpin RNA to knockdown
p53 or
mdm2. We observed that when MCF-7 cells were treated with estrogen, the Mdm2 protein level increased; however unlike in the central p53-Mdm2 dogma, the p53 protein level did not decrease (but slightly increased). Interestingly the ability of p53 to activate transcription was decreased by estrogen and this was relieved by knockdown of Mdm2. The increase in Mdm2 protein in the presence of estrogen was in agreement with previously published data, however, the sustained p53 protein stability with increased Mdm2 has not been previously reported and suggests a higher level of complexity for the Mdm2 oncogenic targets. The negative auto-regulatory feedback loop that exists between p53 and Mdm2 has been shown to be disrupted in cells that carry the G allele in the
mdm2 gene promoter (SNP309) [
15]. The trans-activation ability of p53 varies with the nature of p53-activating stimuli, the cell type and the duration of the activation signal [
45,
46]. Our data implicates estrogen and ERα as variables that can decrease the trans-activation ability of p53.
In a recent study of gene expression profiles that co-cluster with ERα in breast tumors, it was shown that
puma is among the genes that are down-regulated after estrogen treatment [
47]. Estrogen has been shown to inhibit apoptosis in MCF-7 cells by inducing
bcl-2 [
12]. We observed that estrogen increased proliferation potentially by blocking cell cycle checkpoints. It was interesting that we saw a coordinated up-regulation of Bcl-2 and down-regulation of PUMA protein levels in MCF-7 cells suggesting a need to signal for the inhibition of apoptosis during this increased proliferation. Estrogen-derived oxidants cause DNA damage by oxidative stress and DNA adduct formation [
48‐
50] that could signal for apoptosis. It is possible that the DNA-damaging effects of estrogen in combination with suppression of multiple cell cycle checkpoints set the stage for cancer cells to emerge from cell populations sustaining DNA damage. It is highly likely that estrogen acts in a number of coordinated ways to block cell cycle checkpoints through the p53 and Rb/E2F pathways. Estrogen induces transient cyclical DNA methylation of active promoters that leads to transcription inhibition by changing the histone code [
51,
52]. Estrogen inhibits resveratrol-activated p53 in MCF-7 cells in part by interfering with post-translational modifications of p53 which are essential for p53-dependent DNA binding and consequent stimulation of downstream pathways [
53]. Additionally, the estrogen-mediated increase in Mdm2 protein might lead to p300/CREB transcription co-activators ubiquitination and degradation that would result in reduced acetylation of p53 [
54,
55]. The
puma gene is regulated by p300 [
56]. Importantly, ERα can bind to p53 directly and repress p53 transcription activation [
13,
14]. In addition to p53, p73 has been shown to activate
puma expression [
57], therefore it is possible that ERα and Mdm2 inhibit p73 transactivation. Estrogen has been shown to up-regulate Myc [
37] and the
puma gene contains E boxes for Myc binding adjacent to the location of the p53 binding site [
58]. This coordinated binding of Myc and p53 or its family members could have implications for the inhibition of
puma transcription. However, the cooperation of Myc with Mdm2 may have even greater implications for tumor promotion through cross-talk with the RB/E2F pathway as well as the p53 pathway.
We have addressed the impact of estrogen on Mdm2 signal transduction that is both p53-dependent and p53-independent. When either siRNA or shRNA was used to knockdown Mdm2 in MCF-7 cells, the p53 protein level did not increase, but the p53 target gene
p21 was up-regulated, suggesting activation of p53 transcriptional activity. We demonstrated that knockdown of Mdm
2 inhibited estrogen-induced proliferation of the MCF-7 cell line. While estrogen promoted MCF-7 cell proliferation, knockdown of wild-type p53 in MCF-7 cells did not. Moreover, knockdown of Mdm2 in MCF-7 cells inhibited cell proliferation to the same extent as the DNA damaging agent etoposide and in combination with etoposide it provoked a robust G1 arrest. Taken together these data suggest that estrogen provokes both a p53-independent and a p53-dependent role for Mdm2 activating the growth of MCF-7 cells. As further evidence for the p53-independent role of Mdm2 in estrogen mediated proliferation, we demonstrated that knockdown of Mdm
2 inhibited estrogen-induced proliferation of the mutant p53 containing cell line T-47D. While estrogen treatment of T-47D cells resulted in reduced p21 protein the knockdown of Mdm2 in T-47D cells did not increase p21 protein as it did in MCF-7 cells. Recently many breast cancer cell lines were classified as a subtype called senescent cell progenitors (SCPs), which associates with cellular senescence following loss of ERα expression and increased expression of p21 [
59]. MCF-7 and T-47D cells fall into the SCP subtype. For the SCP subtype activation of ERα by estrogen protects the cells from senescence. It would be interesting to determine if knockdown of Mdm2 would induce senescence of SCP subtype breast cancers. Combination therapies involving re-activation of checkpoint pathways blocked by Mdm2 (by decreasing Mdm2 protein) may increase the efficacy of killing ERα+ breast cancers. A p53-independent role of Mdm2 has been documented to confer TGFβ resistance in human mammary epithelial cells [
60].
The proliferative advantage conferred by estrogen was observed for both the MCF-7 breast cancer cells and the T-47D breast cancer cells. Moreover, we reproducibly observed a more robust influence of estrogen on MCF-7 cells than on T-47D cells. It is possible that this is due to the fact that T-47D cells have mutant p53 and therefore estrogen would only influence p53-independent signal transduction. In MCF-7 cells, with wild-type p53, estrogen can impact both p53-dependent as well as p53-independent pathways. The estrogen proliferative advantage conferred to MCF-7 cells was visible in 3D culture as well as in 2D culture. MCF-7 cells have a mass-like morphology in matrigel, that is similar in size to the acinus, but has a filled lumen indicative of an intermediate aggressive breast cancer cell morphology [
42]. We observed that MCF-7 cells formed large mass-like structures in 3D and that these structures were replaced with small structures when Mdm2 was knocked down, suggesting that Mdm2 may be important for invasive behavior of breast cancer cells. Further studies on the role of Mdm2 in aggressive metastatic cells need to be conducted.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
JB and AB wrote the manuscript. JB conceptualized and designed the study. AB designed and carried-out the experiments. JB, AB, AP and NK worked on vector-shRNA cloning and generation of clonal MCF-7 and T-47D cell lines with inducible mdm2 and p53 shRNA constructs. KES contributed to study conception and design, and set-up of estrogen treatment conditions. All authors read, critiqued and approved the final manuscript.