Skip to main content
main-content

01.12.2017 | Methodology | Ausgabe 1/2017 Open Access

Virology Journal 1/2017

A rapid virus-induced gene silencing (VIGS) method for assessing resistance and susceptibility to cassava mosaic disease

Zeitschrift:
Virology Journal > Ausgabe 1/2017
Autoren:
Getu Beyene, Raj Deepika Chauhan, Nigel J. Taylor
Wichtige Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12985-017-0716-6) contains supplementary material, which is available to authorized users.
Abbreviations
ACMV-CM
African cassava mosaic Cameroon virus
CBSD
Cassava brown streak disease
CMD
Cassava mosaic disease
CMG
Cassava mosaic geminivirus
CP
Coat protein
DPI
Days post inoculation
EACMV
East African cassava mosaic virus
FEC
Friable embryogenic callus
MePSY2
Manihot esculenta phytoene synthase 2
MeSEC
Manihot esculenta SECRET AGENT
MeSPY
Manihot esculenta SPY
SEC
SECRET AGENT
SPY
SPINDLY
TPR
Tetratricopeptide repeat
VIGS
Virus-induced gene silencing
WPI
Weeks post inoculation

Background

The starchy storage root of cassava serves as a staple food for millions of people in Africa. In 2014, over 50% of the world’s cassava production took place in sub-Saharan Africa, where 146.8 million tons were harvested [1]. While cassava is resilient to abiotic stresses such as prolonged drought [2], its production is constrained by the two viral diseases, cassava mosaic disease (CMD) and cassava brown streak disease (CBSD) [3]. Cassava mosaic disease is caused by a cassava mosaic geminivirus (CMG) complex. CMGs are single-stranded bipartite DNA viruses in the family Geminiviridae, genus Begomovirus, comprised of 11 species, two of which are present in the Indian sub-continent, with the rest endemic to Africa [4, 5].
Improvement programs for development of CMD-resistant cassava germplasm include introgression of polygenic recessive resistance from the related species Manihot glaziovii (CMD1), identification of monogenic dominant resistance in West African cassava landraces (CMD2), and more recently, production of highly resistant cultivars carrying a quantitative trait loci (CMD3) [69]. Screening cassava germplasm for resistance to CMD traditionally involves cultivation under field conditions with exposure to transmission of CMGs mediated by the whitefly vector Bemisia tabaci for a growth cycle of 12–18 months [6, 10, 11]. Under contained conditions in the greenhouse or growth chamber, inoculation of cassava with CMGs can be achieved by a) graft inoculation from a CMG-infected host to healthy plants [1214]; b) delivery of DNA genomes as infectious clones via microparticle bombardment [1517]; c) Agrobacterium-mediated inoculation of plants with cloned infectious DNA genomes [18]; or d) mechanical transmission of cloned viral DNA genomes by abrasion [19]. Irrespective of the inoculation method employed, CMD symptom development and severity is scored over a period lasting 12–22 weeks from the time of inoculation through the potential disease recovery process [15, 18]. During this time the resistant/tolerant cultivars are identified based on displayed recovery phenotype on newly formed leaves, while the susceptible cultivars remain symptomatic throughout.
Methods currently available for evaluating resistance and susceptibility to CMD in new cultivars, breeding lines or transgenic and gene edited events are therefore lengthy, space inefficient and require frequent assessment of leaf symptoms by skilled personnel. We report here the development of a simple screening system for determining resistance or susceptibility to CMD that can be completed within 2–4 weeks from the time of inoculation. This rapid screening system is based on virus-induced gene silencing (VIGS) of an endogenous MeSPY gene. The method described saves time and space in the greenhouse and enhances capability to allow screening of a large number of plants in a short period of time.

Methods

Construction of infectious VIGS clones

VIGS clones were generated from the virulent infectious clone EACMV-K201 described previously by Patil and Fauquet [20]. EACMV-K201 was produced from East African cassava mosaic virus (EACMV-KE[KE:Msa:K201:02]), DNA-A GenBank: AJ717541; and DNA-B GenBank: AJ704953 [21]. The EACMV-K201 DNA-A infectious clone was digested with Hin dIII/Eco RI (2082 bp) and Eco RI/Bam HI (1157 bp), and cloned into pBlueScript vector (Stratagene) as Hin dIII/Bam HI in a three-way ligation. The resulting construct was named p8200. p8200 was modified to introduce restriction sites Nhe I and Avr II near the 5′-region, and Sbf I near the 3′-region within the coding sequence of the coat protein (CP) gene using QuickChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Inc.) with the primers listed in Table 2. The mutagenized infectious clone was confirmed by sequencing and named p8202.
The Manihot esculenta homolog of A. thaliana SPINDLY (SPY) gene (MeSPY1 accession number Manes.09G052300.1) was cloned into p8202 at the CP site. A 452 bp fragment of MeSPY1 (406–857 counted from start codon ATG) was amplified from plasmid p8103 that harbors the 2781 bp coding sequence of MeSPY1 by introducing restriction sites Nhe I and Sbf I on the forward and reverse primer pairs, respectively (Table 2). The PCR product was cloned into Zero Blunt Topo (Invitrogen) first and positive clones digested and cloned into the Nhe I/Sbf I site of p8202 to generate the p8250 (hereafter named MeSPY1-VIGS). A non-target VIGS control was produced by amplification of 453 bp (235–687 bp counted from start codon ATG) from the erGFP [22] sequence of a binary vector erGFP-pCAMBIA2300 by introducing Nhe I and Sbf I sites on forward and reverse primer pairs, respectively, and cloned into p8202 to generate p8223 (GFP-VIGS). In order to generate a VIGS vector targeting cassava phytoene synthase (MePSY2 gene, Manes.01G124200.1), a 452 bp fragment (350–801 bp counted from start codon ATG) was amplified introducing a Sbf I and Nhe I restriction site and cloned into the Sbf I and Nhe I site of 8202 to produce p8375 (MePSY2-VIGS).

Cultivars and greenhouse growth conditions

Cassava cultivars used in this study are shown in Table 1 and included the CMD-susceptible cultivars 60444, Ebwanateraka and TME 7S; and CMD-resistant cultivars TME 3, TME 7 (Oko-iyawo), TME 204 and TMS 98/0505. Additional lines included CMD-susceptible plants [15] regenerated from friable embryogenic callus (FEC) of TME 204, TME 3 and TME 7 and CMD-resistant plants of cultivar TMS 98/0505 recovered from FEC following the method described by Chauhan, et al. [23]. All plants were micropropagated and established in the greenhouse as described previously [15, 24].
Table 1
Cassava cultivars and lines used for MeSPY1-VIGS, GFP-VIGS and MePSY2-VIGS challenge
Cultivar/line
Response to CMD
Remark
TME 204
Resistant
Recovers from CMD
TME 3
Resistant
Recovers from CMD
TME 7
Resistant
Recovers from CMD
TMS 98/0505
Resistant
Recovers from CMD
FEC- TMS 98/0505
Resistant
Recovers from CMD
60444
Susceptible
Does not recover from CMD
TME 7S
Susceptible
Does not recover from CMD
Ebwanateraka
Susceptible
Does not recover from CMD
FEC-TME 204
Susceptible
Does not recover from CMD
FEC-TME 3
Susceptible
Does not recover from CMD
FEC-TME 7
Susceptible
Does not recover from CMD

Inoculation of VIGS clones and assessment of phenotype in the greenhouse

Four- to 6-week-old greenhouse-grown plants were inoculated with plasmid DNA of MeSPY1-VIGS, GFP-VIGS or MePSY2-VIGS vectors plus the DNA-B component of EACMV-K201 using a Helios® Gene Gun (BioRad, Hercules, California), following Beyene, et al. [15]. Approximately 75 ng each of the VIGS (DNA-A and DNA-B) components were used to inoculate each plant. Symptom and phenotype scoring after inoculation was performed in three manners. Plants challenged with GFP-VIGS were scored for development of CMD symptoms using an established visual scoring system with a scale of 0–5 [25]. Plants were scored starting 7–10 days post inoculation (DPI) and every 3–7 days thereafter for a total of 12 weeks [15]. For plants challenged with MePSY2-VIGS, visual assessment was made for presence or absence of chlorosis/bleaching. In the case of plants challenged with MeSPY1-VIGS, a new scoring system was employed by which plants were assessed for death of the shoot apical meristem (whole plant) starting 7–10 DPI and every 2–3 days thereafter for a maximum of 4 weeks. Data was expressed as incidence of plants showing shoot-tip necrosis/dead plants presented as the percent of the total number of plants inoculated at the end of the 4-week observation period.

Nucleic acid extraction, qPCR and RT-qPCR

Plants were sampled for nucleic acid extraction by collecting leaves and shoot material 9 DPI with VIGS constructs. Tissues from three plants were pooled in a 50 mL Falcon tube and immediately flash frozen in liquid nitrogen. A total of four pooled samples collected from 12 plants were analyzed per treatment. Frozen samples were ground in a mortar and pestle to fine powder and freeze-dried overnight. Approximately 20–30 mg of freeze-dried tissue were used for nucleic acid extraction. Genomic DNA was extracted using DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and the resulting genomic DNA quantified and used for virus titer determination by qPCR and Southern blot analysis [15]. Total RNA was isolated using the Spectrum™ Plant Total RNA Kit, followed by on-column DNAse I treatment per manufacturer instructions (Sigma-Aldrich, St. Louis, MO). One microgram of total RNA was reverse transcribed using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara Bio Inc., Japan). Expression levels of MeSPY in MeSPY1-VIGS-inoculated plants and control GFP-VIGS plants were quantified by RT-qPCR [26] using the primer pairs listed in Table 2, with approximately 10 ng reverse transcriptase template and SsoAdvanced™ Universal SYBER® Green Supermix (Bio-Rad Laboratories Inc.). The cassava PP2A gene was employed as an internal control for RT-qPCR [27].
Table 2
Primers used for in vitro mutagenesis, PCR, qPCR and RT-qPCR in this study
Primer number
Sequence
Target Gene (construct)
Purpose
Reference
823
CTTCCCAACTCTATGGGTGATGGCTAGCCTAGGAGTAACATCACTGACACATCG
EACMV-K201 (DNA-A)
Mutagenesis primer (introduces Avr II and Nhe I)
This study
824
CGATGTGTCAGTGATGTTACTCCTAGGCTAGCCATCACCCATAGAGTTGGGAAG
825
ATAGATGCGTATTTTAAGCGTCGCACCTGCAGGATTTGAGGCATGTGTACATGC
EACMV-K201 (DNA-A)
Mutagenesis primer (introduces Sbf I)
This study
826
GCATGTACACATGCCTCAAATCCTGCAGGTGCGACGCTTAAAATACGCATCTAT
857
GCTAGCCCAACACTTGTCACTACTTTC
erGFP
GFP-VIGS
This study
858
CCTGCAGGGAAAGGGCAGATTGTGTGGA
907
GCTAGCGCTGAGTCATATCAGAAGGC
MeSPY1/Manes.09G052300.1
MeSPY1-VIGS
This study
908
CCTGCAGGATACCTTGATTGATGTCTCC
1260
CCTGCAGGTAGACGTGAAACCAGATATTGTGC
MePSY2/Manes.01G124200.1
MePSY2-VIGS
This study
1261
GCTAGCAACACTCATTAATCCAACCGTCCC
1066
CAAAGGTTAAATTGGAGGGAGACATC
MeSPY1/Manes.09G052300.1
RT-qPCR
This study
1067
GCATTTCACCATATGCAACACCAAGA
833
TTGCAGAGGAAGATAGTGGGAATG
EACMV-K201 (DNA-A)
Probe for Southern blot
Beyene, et al. [15]
834
GAACGTGATGGGTTCCGCTG
837
TGCAAGGCTCACACTTTCATC
MePP2A/Manes.09G039900.1
Reference gene for qPCR
Moreno, et al. [27]
838
CTGAGCGTAAAGCAGGGAAG
1046
GGTCTTCCCTGTACGACTATC
EACMV-K201 (DNA-A)
qPCR (virus load)
Beyene, et al. [15]
1047
GGAACTTGAAGTCTGGGTTTCC

Results

Production of EACMV-K201 VIGS clones and verification of infectivity

A VIGS system was developed by modifying the CP nucleotide sequence of the DNA-A component of the virulent infectious clone EACMV-K201 [20] to generate the VIGS construct p8202. Mutations were designed to introduce restriction sites Avr II, Nhe I and Sbf I (Fig. 1a) in order to allow introduction of target sequences. The introduced mutations were confirmed by sequencing both strands of the modified CP sequences as shown (Fig. 1a) and further confirmed by restriction analysis (data not shown). To check infectivity of the p8202 VIGS vector, a 452 bp fragment from the coding sequence of the cassava carotenoid biosynthetic gene phytoene synthase (MePSY2) was cloned at the Nhe I/Sbf I site of p8202 to generate MePSY2-VIGS. In addition, a GFP-VIGS DNA-A component was generated by cloning a 453 bp sequence from erGFP [22] into the restriction sites generated within the CP sequence.
Five-week-old plants of the CMD-susceptible cassava line TME 7S were inoculated by Helios® Gene Gun microparticle bombardment of the modified DNA-A component plus the infectious clone of DNA-B. TME 7S is a CMD-susceptible version of TME 7 previously described by Kuria, et al. [28]. Plants inoculated with MePSY2-VIGS developed visible chlorosis/bleaching on the challenged leaves and then subsequently on systemic leaves within 10–15 days after bombardment (Fig. 1b). Bleaching of leaves persisted throughout the experimental period of 12 weeks (Fig. 1b). Plants challenged with GFP-VIGS (which does not have a target gene sequence within the cassava genome) showed typical but mild CMD symptoms on systemic leaves that persisted throughout the study period (Fig. 1b). Response of inoculated plants to MePSY2-VIGS and GFP-VIGS confirms that the VIGS constructs made by modifying EACMV-K201 are both infectious and efficacious in silencing gene expression in cassava.

Silencing of MeSPY gene is lethal in CMD-susceptible cassava cultivars

Using the Arabidopsis SPY gene (AT3G11540.1) [29, 30] as a bait, two sequences, Manes.09G052300.1 (named MeSPY1) and Manes.08G028400.1 (named MeSPY2), were identified from the cassava v6.1 genome sequence [31]. The MeSPY1 and MeSPY2 sequences are 81% identical to Arabidopsis SPY at the amino acid level. Both MeSPY1 and MeSPY2 carry the conserved N-terminal tetratricopeptide repeat (TPR) domain, plus the novel serine and threonine O-linked N-acetylglucosamine transferase (OGT) [30] at the C-terminus of the protein (data not shown). The coding region of MeSPY1 and MeSPY2 genes are 91.80 and 90.78% identical to each other at the nucleotide and amino acid levels, respectively. The target sequence (452 bp) cloned into the VIGS vector from MeSPY1 was obtained closer to the 5′-end, within the conserved TPR region. As MeSPY1 and MeSPY2 share high sequence identity (94.69%) at this selected region, both can be targeted for simultaneous silencing by MeSPY1-VIGS.
The susceptible cassava cultivar TME 7S was challenged with MeSPY1-VIGS by Helios® microparticle bombardment. Inoculated plants did not show typical CMD symptoms but instead underwent wilting and withering of one or more leaves just above the inoculation site within 10–15 DPI. This was followed by shoot-tip necrosis within 12–21 DPI. Defoliation then progressed downwards to mature leaves below the inoculation site and along the main stem continuing until most of the plants had died within 2–4 weeks after inoculation with MeSPY1-VIGS (Fig. 2a). TME 7S plants challenged with the control GFP-VIGS showed typical CMD symptom development without shoot tip necrosis (Fig. 2a). In order to determine if this was a cultivar-specific response, the CMD2-type cultivar TME 204 (Table 1) was challenged with MeSPY1-VIGS and GFP-VIGS. Two types of TME 204 plants were used: wild-type TME 204, which shows development of CMD symptoms followed by recovery; and FEC-TME 204 lines. The latter TME 204 plants that were recovered through somatic embryogenesis lost their inherent resistance to CMD and showed no recovery from CMD after challenge with CMGs [15]. After challenge with MeSPY1-VIGS, all plants (10/10) of wild-type TME 204 displayed transient reduction in growth compared to the GFP-VIGS plants and then resumed normal growth without showing typical CMD symptoms. No shoot-tip necrosis was observed. In contrast, all FEC-derived TME 204 plants (8/8) displayed a similar phenotype to that described above for TME 7S, whereby elongation of the shoot was reduced, resulting in compact shoot-tips and wilting and withering of leaves just above the inoculation site. This was followed by death of the shoot-tip and wilting and defoliation of leaves that progressed downwards from the youngest to the oldest leaves. Time-lapse video of the process of shoot-tip necrosis and whole plant death in susceptible FEC-TME 204 and survival of the resistant wild-type TME 204 plant lines is presented (Additional file 1). All plants displayed shoot-tip necrosis with most plants dying within 2–4 weeks after challenge (Fig. 2b). Inoculation with GFP-VIGS resulted in plants of both the susceptible and resistant lines of TME 204 developing CMD symptoms. Wild-type TME 204 plants then underwent recovery from CMD to show no symptoms on newly formed leaves by 16 weeks after challenge. FEC-derived plants remained symptomatic throughout, in a manner consistent with previous observations [15]. This data indicates that silencing of MeSPY is lethal in the two susceptible cassava lines TME 7S and FEC-derived TME 204, but not in the resistant wild-type TME 204.
Additional file 1: Time-lapse video showing response of wild-type TME 204 (resistant to cassava mosaic disease, CMD) and FEC-TME 204 plants (susceptible to CMD) to inoculation with MeSPY1-VIGS. Both plant types were challenged with the modified EACMV-K201 (MeSPY1-VIGS) along with infectious DNA B clone. Images of challenged plants were captured every hour beginning from the 5th day after inoculation for a total of 22 days using 5MP camera boards controlled by Raspberry Pi microcomputers. Images were then converted to a movie file using Apple iMovie. Only pictures collected every 2 hours and during daytime were presented. Note the susceptible FEC-TME 204 plants die while the wild-type TME 204 survive MeSPY1-VIGS challenge. (M4V 14035 kb)
MeSPY1-VIGS’s potential for use as a screening tool to determine resistance or susceptibility to CMD was investigated further by challenging additional cassava cultivars (Table 1). These included: a) CMD2-type resistant wild-type plants of cultivars TME 7 and TME 3, and CMD-susceptible plant lines derived from FEC of TME 7 and TME 3; b) CMD3-type resistant cultivar TMS 98/0505 (wild-type) and FEC-derived TMS 98/0505; and c) CMD-susceptible cassava cultivars 60444 and Ebwanateraka. Inoculation of these cassava accessions with MeSPY1-VIGS showed that CMD-susceptible germplasm (FEC-TME 3, FEC-TME 7, 60444 and Ebwanateraka) underwent wilting of leaves above the inoculation site and necrosis of shoot-tips within 10–21 DPI. This was followed by defoliation, culminating in death of the majority of plants within 4 weeks after inoculation (Figs. 3 and 4). The CMD-resistant wild-type cultivars TME 3, TME 7 and TMS 98/0505 survived challenge with MeSPY1-VIGS and displayed similar phenotype described above for wild-type TME 204 (Figs. 3 and 4). Plants of FEC-derived TMS 98/0505 behaved in a manner identical to wild-type TMS 98/0505 confirming their known resistance to CMD [15]. Likewise, wild-type and FEC-derived plants of CMD1-type cultivars NASE 3 (TMS 30572) and NASE 14 also survive MeSPY-VIGS (data not shown). All plant lines were also challenged with GFP-VIGS. Data collected for development of and recovery from CMD symptoms correlated with that from plants inoculated with MeSPY1-VIGS such that all plant lines that resisted challenge with MeSPY1-VIGS also showed recovery from CMD symptoms after inoculation with GFP-VIGS (Fig. 5).

Suppression of MeSPY and virus titer in challenged plants

Expression of MeSPY after inoculation with MeSPY1-VIGS was quantified by RT-qPCR in the CMD-resistant wild-type cultivar TME 7 and susceptible FEC-TME 7 plants at 9 DPI. At this time, plants challenged with the control GFP-VIGS showed systemic CMD symptoms on young leaves above the inoculation site, while the MeSPY1-VIGS leaves were smaller and shoot-tips were compact relative to the GFP-VIGS. Relative expression of the MeSPY gene was found to be significantly reduced (33%; p < 0.05) in FEC-derived TME 7 plants challenged with MeSPY1-VIGS when compared to TME 7 wild-type plants and to the corresponding GFP-VIGS controls (Fig. 5c). Virus DNA titer was determined by qPCR (Fig. 5b) and Southern blot analysis (Fig. 5a) from the same samples collected at 9 DPI. TME 7 wild-type plants challenged with MeSPY1-VIGS and GFP-VIGS had significantly lower relative virus loads (2.36-fold and 7.23-fold, respectively) compared to the FEC-derived CMD-susceptible TME 7 plants (16.08 and 29.39, respectively). Greater virus DNA was detected in GFP-VIGS inoculated lines than MeSPY-VIGS inoculated lines (Fig. 6a). qPCR virus titer data was seen to be consistent with Southern blot data showing relatively more virus titer in the susceptible FEC-derived TME 7 compared to the wild-type TME 7.

Discussion

Virus-Induced Gene Silencing (VIGS) has been used both in model and non-model plant systems to elucidate gene function [16, 3235]. In cassava, a VIGS system was first reported based on an isolate of African cassava mosaic Cameroon virus (ACMV-CM) [16]. It was reported previously that this ACMV-CM infectious clone is less virulent than EACMV-K201 such that the CMD2-type cultivars TME 204, TME 3 and TME 7 (Oko-iyawo) are infected at low frequencies (0–30%) and develop only mild disease symptoms [15, 28]. This is less than ideal if robust suppression of gene expression is desired within an experimental system. The East African cassava mosaic virus isolate EACMV-K201 [21] is highly virulent and has been shown to infect all cassava genotypes [15, 28]. A new VIGS system was developed, therefore, based on EACMV-K201 by cloning target sequences into the coding region of the CP gene of the DNA-A component. Efficacy of this VIGS vector was confirmed by silencing the endogenous MePSY2 gene in the CMD-susceptible cultivar TME 7S, resulting in visually detectable bleaching and production of chlorotic tissues throughout a 12-week observation period (Fig. 1b).
Screening cassava germplasm for resistance to CMD under field conditions requires many months [10, 36]. Under laboratory or greenhouse conditions this evaluation period is shorter but still needs 12–22 weeks [15, 18] to allow for full disease establishment and expression of the recovery phenotype typical for most cassava cultivars. Data presented here shows that the MeSPY1-VIGS system can be used as a quick screening tool to determine resistance and susceptibility to CMD (Figs. 2, 3 and 4). This was achieved by targeting the cassava SPY gene using a newly developed EACMV-K201-based VIGS vector delivered by biolistic inoculation. The established CMD scoring system for cassava involves visual assessment of symptoms based on a scale of 0–5 [25]. Experienced personnel are required to capture accurate data due to subtle presentation of disease symptoms in some cultivars. The symptom scores are recorded for each individual plant in an experiment often at a frequency of 1–2 times a week for 12–22 weeks depending on the cultivar, virus species and isolate used. Using the MeSPY1-VIGS screening system, only shoot-tip necrosis/death or whole plant death needs be scored, and only once or twice up to 4 weeks post inoculation. On average, this saves 8–18 weeks per inoculation experiment allowing 3–5 times more plants to be tested in the same time period and the same available greenhouse space. This MeSPY-VIGS screening system has been developed using known CMD-resistant and CMD-susceptible cassava cultivars and plant lines that have been well characterized under field and greenhouse conditions [8, 11, 15, 28]. Data generated (Figs. 1, 2, 3 and 4) corroborates accurately with the known CMD response of these cultivars, as further validated with challenge experiment using GFP-VIGS (Fig. 5), showing the robustness of the screening system.
The cause of shoot-tip necrosis that eventually leads to whole plant death in CMD-susceptible cassava lines is not clear. Both virus DNA and MeSPY transcript quantification showed significant differences between the CMD-resistant and CMD-susceptible plant lines, with CMD-susceptible plant lines having greater virus load than resistant lines (Fig. 6a and b) in a manner consistent with our previous report [15]. This viral load corresponded with an expected and significant reduction in MeSPY transcript in CMD-susceptible plants (Fig. 6c). SPY is involved in diverse physiological and developmental roles, including suppression of GA signaling [30], promotion of cytokinin response [37, 38] and enhancement of sensitivity to drought and salinity stress [39]. A SPY mutation in Arabidopsis caused elongation of the stem that phenocopies wild-type plants treated with GA [29, 30]. In Arabidopsis, SPY and SECRET AGENT (SEC) [40, 41] are the only proteins known to have O-linked N-acetylglucosamine transferase activity involved in posttranslational modification of other proteins. We tested if silencing of cassava SEC (MeSEC) mimics what has been observed in plants challenged with MeSPY1-VIGS as shown in this study (Figs. 1, 2, 3 and 4). Silencing of the cassava ortholog of Arabidopsis SEC did not cause lethality or any different phenotype in susceptible or resistant TME 204 and TME 7 cassava cultivars as compared to GFP-VIGS (data not shown), suggesting that MeSPY and MeSEC may not be functionally redundant. The cause of death after challenge with MeSPY1-VIGSs might therefore be due to the crucial role MeSPY plays in plant function and/or due to an unknown interaction with the geminiviruses. Transgenic plants overexpressing MeSPY and RNAi cassava lines are being recovered to further elucidate a putative role of SPY in CMD resistance.
The ability to discriminate between CMD-resistant and-susceptible lines using a simple MeSPY1-VIGS challenge has significant practical application. We recently reported that the CMD2-type cultivars TME3, TME 7 and TME 204 lose inherent resistance to CMD after passage through the process of somatic embryogenesis, and that this phenomenon occurs at an early stage after culture of an explant on auxin-containing media [31]. Meristem tip culture for virus elimination in infected cassava plants to allow movement of plants between countries or within a country, in vitro germplasm preservation and production of transgenic and gene edited plants often employ tissue culture procedures [42, 43]. The rapid CMD screening system developed in this study can easily be applied for determining preservation of CMD resistance after such tissue culture manipulations. Furthermore, the technique can be applied for high throughput screening of large numbers of progenies in a breeding pipeline under controlled greenhouse conditions. Besides understanding the molecular mechanisms involved in the phenotype observed in susceptible cassava lines reported here, investigation into the utility of SPY-VIGS as a screening tool in other plant-virus interactions is needed.

Conclusion

A rapid and reliable screening method for determining resistance to CMD, one of the most important cassava viral diseases, has been developed. This screening system utilizes an EACMV-K201-based VIGS system to target the MeSPY gene and has proven effective across diverse cassava cultivars and lines. With this screening system in place, 3–5 times more plant lines can be screened with the same resources compared to previously available methods. It is therefore well suited for application for high throughput screening of breeding lines and transgenic and gene edited lines under controlled growth conditions.

Acknowledgments

We thank Amita Rai, Theodore Moll, Miriam Khalil, Maxwell Braud, Jackson Gehan, Collin Luebbert, Jennifer Winch, Jacquelyn Leise, Stephanie Lamb, Claire Albin and Mary Lyon at the Donald Danforth Plant Science Center for their technical assistance.

Funding

Funding for this research was provided by the Bill and Melinda Gates Foundation (OPPGD1485), the United States Agency for International Development from the American people (USAID Cooperative Agreement No. AID-EDH-A-00-09-00010), and the Monsanto Fund. The funders had no role in the design of the study; collection, analysis, or interpretation of data; nor in the writing of the manuscript.

Availability of data and materials

All data generated or analyzed during this study are included in this published article and its supplementary information files.

Authors’ contributions

GB and NT conceived the project. RC generated FEC-derived plants. GB, RC and NT designed the project, carried out the experiments, and generated and analyzed the data. GB, RC and NT wrote the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
Über diesen Artikel

Weitere Artikel der Ausgabe 1/2017

Virology Journal 1/2017 Zur Ausgabe


 

Neu im Fachgebiet Innere Medizin

Meistgelesene Bücher aus der Inneren Medizin

2017 | Buch

Rheumatologie aus der Praxis

Entzündliche Gelenkerkrankungen – mit Fallbeispielen

Dieses Fachbuch macht mit den wichtigsten chronisch entzündlichen Gelenk- und Wirbelsäulenerkrankungen vertraut. Anhand von über 40 instruktiven Fallbeispielen werden anschaulich diagnostisches Vorgehen, therapeutisches Ansprechen und der Verlauf …

Herausgeber:
Rudolf Puchner

2016 | Buch

Ambulant erworbene Pneumonie

Was, wann, warum – Dieses Buch bietet differenzierte Diagnostik und Therapie der ambulant erworbenen Pneumonie zur sofortigen sicheren Anwendung. Entsprechend der neuesten Studien und Leitlinien aller wichtigen Fachgesellschaften.

Herausgeber:
Santiago Ewig

Mail Icon II Newsletter

Bestellen Sie unseren kostenlosen Newsletter Update Innere Medizin und bleiben Sie gut informiert – ganz bequem per eMail.

© Springer Medizin 

Bildnachweise