Skip to main content
main-content

01.12.2012 | Methodology | Ausgabe 1/2012 Open Access

Malaria Journal 1/2012

A yeast expression system for functional and pharmacological studies of the malaria parasite Ca2+/H+ antiporter

Zeitschrift:
Malaria Journal > Ausgabe 1/2012
Autoren:
J Enrique Salcedo-Sora, Steve A Ward, Giancarlo A Biagini
Wichtige Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1475-2875-11-254) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

JES-S designed the study and performed experiments. JES-S and GAB wrote the initial draft of the manuscript. SAW and GAB edited and revised the manuscript, and provided materials and equipment. All authors read and approved the final manuscript.

Abstract

Background

Calcium (Ca2+) signalling is fundamental for host cell invasion, motility, in vivo synchronicity and sexual differentiation of the malaria parasite. Consequently, cytoplasmic free Ca2+ is tightly regulated through the co-ordinated action of primary and secondary Ca2+ transporters. Identifying selective inhibitors of Ca2+ transporters is key towards understanding their physiological role as well as having therapeutic potential, therefore screening systems to facilitate the search for potential inhibitors are a priority. Here, the methodology for the expression of a Calcium membrane transporter that can be scaled to high throughputs in yeast is presented.

Methods

The Plasmodium falciparum Ca2+/H+ antiporter (PfCHA) was expressed in the yeast Saccharomyces cerevisiae and its activity monitored by the bioluminescence from apoaequorin triggered by divalent cations, such as calcium, magnesium and manganese.

Results

Bioluminescence assays demonstrated that PfCHA effectively suppressed induced cytoplasmic peaks of Ca2+, Mg2+ and Mn2+ in yeast mutants lacking the homologue yeast antiporter Vcx1p. In the scalable format of 96-well culture plates pharmacological assays with a cation antiporter inhibitor allowed the measurement of inhibition of the Ca2+ transport activity of PfCHA conveniently translated to the familiar concept of fractional inhibitory concentrations. Furthermore, the cytolocalization of this antiporter in the yeast cells showed that whilst PfCHA seems to locate to the mitochondrion of P. falciparum, in yeast PfCHA is sorted to the vacuole. This facilitates the real-time Ca2+-loading assays for further functional and pharmacological studies.

Discussion

The functional expression of PfCHA in S. cerevisiae and luminescence-based detection of cytoplasmic cations as presented here offer a tractable system that facilitates functional and pharmacological studies in a high-throughput format. PfCHA is shown to behave as a divalent cation/H+ antiporter susceptible to the effects of cation/H+ inhibitors such as KB-R7943. This type of gene expression systems should advance the efforts for the screening of potential inhibitors of this type of divalent cation transporters as part of the malaria drug discovery initiatives and for functional studies in general.

Conclusion

The expression and activity of the PfCHA detected in yeast by a bioluminescence assay that follows the levels of cytoplasmic Ca2+ as well as Mg2+ and Mn2+ lend itself to high-throughput and quantitative settings for pharmacological screening and functional studies.
Zusatzmaterial
Additional file 1: PfCHA and VCX1 RNA yeast expression. A. The expression of Plasmodium PfCHA as well as yeast VCX1 was observed by reverse transcription PCR using total RNA from the reference strain BY4741n, the vcx1Δ mutant carrying the expression plasmid only (p505) and the same mutant carrying the recombinant plasmid with either VCX1 or PfCHA. Forward and reverse primer position and sequences: PfCHA (64 - 488nt) (5’- AAAAATGTGCCCCCTATGAA, 5’-TCCATTAAATTACCAAACGTAGCA), VCX1 (269 - 666nt) (5’-GTAACACCATTGGGGGACTG, 5’-ATGGCTCCCTAGCTGGAAAT), and yeast S. cerevisiae actin YFL039c (130 - 533 nt) (5’- ATGGTCGGTATGGGTCAAAA, 5’- ATTCTCAAAATGGCGTGAGG). B. Real-time PCR using total RNA from the vcx1Δ mutant carrying recombinant plasmids with VCX1 or PfCHA following the amplification of either a fragment or the full gene for VCX1– 666 bp and VCX1-1236 bp respectively. Likewise for the PfCHA (488 bp fragment or entire gene of 1321 bp). Primers for total length genes as in Methods. Evidently, RNA levels of PfCHA as full size gene are present around three-fold lower than its homologous counterpart VCX1 while the difference in the levels of shorter (truncated) transcribed fragments is only half that difference. (PDF 199 KB)
12936_2012_2450_MOESM1_ESM.pdf
Additional file 2: Phenotypic rescue of yeast Saccharomyces cerevisiae vcx1Δ inhibited in presence of glucose. Conditions and strains as in Figure 1A except that the culture medium contained D-glucose instead of D-galactose which suppresses the activity of the GAL1 promoter present in pGREG505. (PDF 18 KB)
Authors’ original file for figure 1
12936_2012_2450_MOESM3_ESM.tiff
Authors’ original file for figure 2
12936_2012_2450_MOESM4_ESM.tiff
Authors’ original file for figure 3
12936_2012_2450_MOESM5_ESM.pdf
Authors’ original file for figure 4
12936_2012_2450_MOESM6_ESM.pdf
Authors’ original file for figure 5
12936_2012_2450_MOESM7_ESM.tiff
Literatur
Über diesen Artikel

Weitere Artikel der Ausgabe 1/2012

Malaria Journal 1/2012 Zur Ausgabe

Neu im Fachgebiet Innere Medizin


 

Meistgelesene Bücher aus der Inneren Medizin

2017 | Buch

Rheumatologie aus der Praxis

Entzündliche Gelenkerkrankungen – mit Fallbeispielen

Dieses Fachbuch macht mit den wichtigsten chronisch entzündlichen Gelenk- und Wirbelsäulenerkrankungen vertraut. Anhand von über 40 instruktiven Fallbeispielen werden anschaulich diagnostisches Vorgehen, therapeutisches Ansprechen und der Verlauf …

Herausgeber:
Rudolf Puchner

2016 | Buch

Ambulant erworbene Pneumonie

Was, wann, warum – Dieses Buch bietet differenzierte Diagnostik und Therapie der ambulant erworbenen Pneumonie zur sofortigen sicheren Anwendung. Entsprechend der neuesten Studien und Leitlinien aller wichtigen Fachgesellschaften.

Herausgeber:
Santiago Ewig

Mail Icon II Newsletter

Bestellen Sie unseren kostenlosen Newsletter Update Innere Medizin und bleiben Sie gut informiert – ganz bequem per eMail.

© Springer Medizin 

Bildnachweise