Background
Pim1, Pim2 and Pim3 belong to a small family of serine/threonine protein kinases and are evolutionarily conserved in multicellular organisms. Pim1 and Pim2 were originally identified from cloning the retroviral integration sites in murine Moloney Leukemia virus (MuLV)-induced lymphomas [
1,
2]. Pim3 was identified through high throughput retroviral tagging in tumors of c-Myc transgenic mice deficient for Pim1 and Pim2 [
3]. Although Pim kinase genes are located on different chromosomes, they encode proteins with a high degree of sequence homology [
4,
5]. Additionally, the functions and expression patterns of Pim kinases overlap significantly with each other [
4,
6,
7]. For example, Pim3 can compensate for the loss of Pim1 and Pim2 in MuLV-induced lymphomagenesis [
3]. EμMyc-EμPim2 double transgenic mice develop B cell lymphoid tumors similar to those seen in EμMyc-EμPim1 double transgenic mice [
8,
9]. Pim kinases are constitutively active and play an important role in tumor cell cycle regulation and in cancer cell survival [
5].
Over the last two decades, several genetically modified mice were generated to facilitate the studies of the functional roles of Pim kinases. These animal models included Eμ-Pim1 transgenic mice [
8], Pim1
−/− single knockout (KO) mice [
10], Pim2
−/− single KO mice [
11], and Pim1
−/−2
−/−3
−/− triple KO (TKO) mice [
4]. Pim1
−/− and Pim2
−/− single KO mice do not show any anatomic or developmental defects likely in part due to the functional redundancy and overlap of Pim kinases. Pim single or triple KO mice are all viable and show subtle hematological changes such as anemia, erythrocyte microcytosis, reduced peripheral T- and B- cell numbers, and impaired T- and B- cell responses to IL-2, IL-3 and IL-7 stimulation [
4,
10]. Grundler, et al. [
12] recently found that Pim1 was important in regulating the surface expression of CXCR4 chemokine receptor in hematopoietic stem cells (HSCs). Pim1 phosphorylates serine 339 of the intracellular domain of CXCR4, a site critical for CXCR4 recycling [
12]. However, very little is known about the effects of Pim kinases on hematopoiesis and the roles of Pim kinases in the expansion and proliferation of primitive HSCs.
We recently reported a quantitative real-time PCR-based technique for determination of donor cell engraftment in a competitive murine transplantation model [
13]. Our PCR method measures the Y chromosome specific gene, i.e., Zfy-1, and can be used for any strain of mouse transplantation models. In the current study, we performed serial transplant experiments and competitive transplant experiments to analyze the hematopoietic phenotypes of Pim TKO mice. We showed that Pim TKO HSCs are deficient in self-renewal and long-term repopulation. These defects are at least in part due to reduced cell proliferation and increased cell apoptosis in the most primitive HSC compartment in Pim TKO mice.
Discussion
Hematopoiesis is regulated by many different molecular pathways [
17]. In the current study, we examined the role of Pim kinases in regulating the primitive HSCs in mice. We used serial transplant experiments, competitive transplant assay, and in vivo and in vitro proliferation assays to investigate the long-term repopulating HSCs in Pim TKO mice. Our study provides direct evidence for an important role of Pim kinases in hematopoiesis. Our findings are consistent with and support previous observations reported by others [
4,
10‐
12]. For instance, we found that Pim TKO mice had reduced body size, displayed erythrocyte microcytosis, and had reduced T cell numbers. We did not observe significant changes in the peripheral B- cell number. This is also consistent with previous observation by Mikkers, et al., who found that in young Pim TKO mice, peripheral B- cell numbers were reduced whereas in older animals, the B- cell number was unaltered [
4]. Importantly, our current study extended our observations beyond previous results. We demonstrated that: 1). Deletion of Pim kinases affects multiple lineages of hematopoietic cells including platelet counts (Figures
1). 2). Deletion of Pim kinases affects the self-renewal and long-term repopulating capacity of HSCs (Figures
3,
4,
5). 3). Deletion of Pim kinases affects the proliferation of the most primitive HSCs in vivo and in vitro (Figure
6). and 4). Deletion of Pim kinases increases apoptotic cell death of HSCs (Figure
6). Our study provides new insights into the roles of Pim kinases in the regulation of HSCs.
The reasons the effects of Pim kinases in HSCs were not previously reported are: 1) Previous studies had been focused on the effects of Pim kinases on T- and B- cells. This seemed logical because overexpression of Pim1 kinase induced clonal T cell lymphoma/leukemia [
8]. 2) Pim- deficient mice were generated on FVB/J background [
4,
10,
11]. FVB/J mice lack readily available surface markers to separate donor-derived cells from congenic recipient-origin cells. This presents a technical challenge in determining the long-term repopulating capacity and self-renewal of HSCs in transplantation models. 3) The percentage of LSK cells in the BM of Pim TKO mice was comparable to that in WT controls, as we showed in Figure
2E. In the absence of serial transplant experiments, this finding may lead investigators to assume that HSC population is unaltered in Pim-deficient mice. The PCR-based method that we reported recently [
13] allows us to reliably determine donor cell engraftment in our transplant experiments.
Several published studies suggested a potentially important role of Pim kinases in hematopoiesis and in HSCs. For example, Pim1 is highly expressed in human fetal hematopoietic tissues [
18]. Additionally, Pim1 kinase is a key target for HOXA9, a homeoprotein important in hematopoiesis [
19]. Pim1 and Pim3 were found to be important in maintaining the self-renewal of mouse embryonic stem cells, and loss of Pim1 and Pim3 led to cell differentiation [
20]. Furthermore, overexpression of Pim kinase protected hematopoietic cells from apoptosis [
21], and enhanced growth factor- independent survival in myeloid cells [
22,
23]. Recent study by Grundler, et al. [
12] suggested that Pim1 kinase was critical in CXCR4 expression and HSC homing. Using transplant models, our study provides direct evidence for an important role of Pim kinases in hematopoiesis.
Pim kinases regulate diverse signal pathways in both hematological and non-hematological malignant cells. Pim kinases promote cell proliferation by regulating enzymes that are important in cell cycle progression, including Cdc25A [
24,
25] and p27kip1 [
26]. Pim kinases regulate cell survival by phosphorylating the apoptotic protein BAD [
27] and ASK1 [
27]. Furthermore, Pim1 kinase regulates PRAS40 phosphorylation and increases the activities of mammalian target of rapamycin protein kinase [
29]. Pim kinase was found to be important in controlling energy metabolism and cell growth [
30]. Consistent with these observations in cancer cells, our studies suggest that Pim kinases are important in the regulation of cell proliferation and survival in HSCs.
Our study has important implications. Pim kinases are being investigated as a potential target in the drug development for the treatment of cancer [
31]. Several compounds including pan- Pim inhibitors are currently under development and have shown interesting preclinical activities in multiple cancer histologies. Clinical data and safety profiles of these inhibitors in human are very limited. Our current studies suggest that it would be important to understand and monitor the potential hematological side effects when using Pim kinase inhibitors.
Materials and methods
Antibodies and reagents
APC-conjugated anti- mouse CD117 antibody (c-Kit, 2B8), APC-H7-conjuagted anti- mouse c-Kit antibody (2B8), PE- conjugated anti- mouse Sca-1 antibody (E13-161.7), APC-conjugated anti- mouse CD3e (145-2C11), PE-conjugated anti mouse Gr-1 (RB6-8C5), PE-Cy7-conjugated Ki67 antibody (B56), FITC- labeled Caspase3 (C92-605) antibody and FITC-BrdU Flow kit were purchased from BD Pharmingen (San Diego, CA). FITC- conjugated anti- mouse B220 (RA3-6B2); PerCP-eFluor 710- labeled anti- mouse CD135 (A2F10) and eFluor 450- conjugated anti- mouse CD34 (RAM34) antibodies were purchased from eBiosciences (San Diego, CA). Magnetic murine lineage cell depletion kit was purchased from Miltenyi Biotec (Auburn, CA). Aqua Live/dead fixable dye was purchased from Invitrogen (Grand Island, NY).
Mice
Pim TKO mice
Pim1
−/−2
−/− and Pim2
−/−3
−/− double KO mice were generated by Mikkers, et al. [
4] and were a kind gift of Drs Paul B. Rothman (Johns Hopkins University) and Anton Berns (The Netherlands Cancer Institute). Pim1
−/−2
−/−3
−/− TKO mice were generated by systematically breeding the Pim1
−/−2
−/− and Pim2
−/−3
−/− double KO mice and were on FVB/J background. Pim TKO mice and WT controls were maintained in our specific pathogen-free animal facility. The genotype of each mouse used in the study was confirmed by PCR genotyping of tail DNA.
FVB/J mice
WT FVB/J transplant recipient mice were purchased from the Jackson Laboratory. All our studies were performed in accordance with Medical University of South Carolina Institutional Animal Care and Use Committee approved- procedures.
Peripheral blood cell subset analysis
Whole blood hematological parameters including white blood cell count, hemoglobin concentration, hematocrit, platelet count, mean corpuscular volume (MCV), and mean corpuscular hemoglobin (MCH) were measured using Scil ABC plus hematology analyzer (scil animal care company Ltd.) as per the manufacturer’s instructions. Peripheral blood cell subsets were quantified using flow cytometry as described previously [
25]. Briefly, 50 μl blood was stained with monoclonal antibodies against various cell subsets [APC- CD3 (145-2C11), APC-Cy7- CD4 (GK1.5), PE-Cy7-CD8 (53–6.7), FITC- B220 (RA3-6B2), PE- Gr-1 (RB6-8C5)]. Equal volume (50 μl) of Flow-Count fluorospheres (Beckman-Coulter) was added before flow cytometric analysis. The absolute cell counts were calculated using the following formula: Absolute count (cells/μL blood) = (Total number of cells counted/Total number of fluorospheres counted) × Flow-Count fluorosphere concentration.
CFU assays were performed in complete M3434 methylcellulose medium (Stem Cell Technologies) following the manufacturer’s instructions. Briefly, BM cells from Pim TKO mice or WT controls were resuspended in complete M3434 medium and plated in 6-well plates at 1 × 105 cells/well. The assays were done in triplicate and the number of CFUs-GM, BFUs-E and CFUs-GEMM was counted at day 7, day 9 and day 12, respectively.
In vivo BrdU incorporation assay
In vivo BrdU incorporation was performed as described previously with minor modifications [
32,
33]. Briefly, mice were intraperitoneally injected with 2 doses (at 8 and 2 hours before sacrifice) of bromodeoxyuridine (5-bromo-2-deoxyuridine [BrdU]; BD Biosciences) at 50 μg/gram of body weight. BM cells were then isolated and enriched for Lin
- cell population using lineage cell depletion kit (Miltenyi Biotec). At least 1.5×10
6 Lin
- BM cells were labeled with PE –conjugated anti- mouse Sca-1, APC- conjugated anti mouse c-Kit, PerCP-eFluor- conjugated anti mouse CD135, and eFluor 450- conjugated anti mouse CD34 antibodies, followed by fixation and staining with FITC–conjugated BrdU antibody (BrdU Flow Kit, BD Pharmingen), according to the manufacturer’s protocol.
Hematopoietic stem cell transplantation (HCT)
For primary HCT, BM cells were isolated from male TKO mice or age matched WT controls. The red blood cell (RBC)- depleted BM cells were injected (cell doses were indicated in the text) via tail-vein to lethally irradiated (11Gy) female FVB/J recipient mice. Animal survival was monitored daily. To determine hematological recovery, peripheral blood was collected from transplant recipient mice by retro-orbital sampling under anesthesia condition. Whole blood cell counts were measured using a Scil ABC plus hematology analyzer as per the manufacturer’s instructions.
For secondary HCT, BM cells were obtained from primary transplanted recipient mice at 4 months post transplantation, and 1×107 BM cells/recipient were injected into lethally irradiated female FVB/J mice. Male donor cell engraftment was measured.
For competitive repopulation assay, 5×105 male BM donor cells from Pim TKO mice or WT controls were mixed with 2×105 female competitive BM cells from FVB/J mice, and transplanted into lethally irradiated female FVB/J mice.
Analysis of donor cell engraftment
Male donor cell engraftment in female transplant recipients was determined as described [
13,
16]. Briefly, genomic DNA was extracted from RBC- lysed peripheral blood cells or BM cells using the DNeasy Kit (QIAGEN), and further purified using Ethanol precipitation method. Twenty ng of genomic DNA were mixed with SYBR Green PCR master mix reagents (Bio-Rad) and real time PCR was performed. Donor cell engraftment was estimated by percentage of male DNA calculated from the standard curve by PCR for sex-determining region Y (Zfy1) [
16]. Bcl-2: 5’-AAGCTGTCACAGAGGGGCTA and 5’-CAGGCTGGAAGGAGAAGATG or Actin: 5’-TGTTACCAACTGGGACGACA and 5’- ACCTGGGTCATCTTTTCACG were used as reference genes.
Cell sorting for CD3e+ T cells, Gr-1+ granulocytes, and B220+ B cells
Peripheral blood samples (150 μl/mouse) were collected from each group (5 mice/group) at 4 months post competitive BM transplant and pooled. After RBC depletion, the leukocytes were stained with APC- conjugated anti mouse CD3e, PE –conjugated anti mouse Gr-1 and FITC -conjugated anti mouse B220 antibodies and subjected to cell sorting on Mo-Flo sorter (DakoCytomation). Sorted CD3e+ T cells, Gr-1+ granulocytes and B220+ B cells were processed for genomic DNA isolation. Male donor cell engraftment in each cell subset was determined by real time PCR analysis as described above.
In vitro culture of LSK cells and cell proliferation and apoptosis assay
RBC-depleted total BM cells obtained from Pim TKO mice or WT control mice were first enriched for Lin- cells by Lineage selection kit. Lin- cells were then stained with Scal-1 and c-Kit antibodies and sorted on flow cytometry for LSK cells. LSK cells (6,000/well) were cultured in StemSpan SFEM medium (StemCell Technologies) supplemented with 100 ng/mL of murine stem cell factor (SCF), murine Thrombopoietin (TPO), and murine Flt3 (all from Invitrogen) for 2 days. Cells were then stained with Aqua Live/dead fixable dye (Invitrogen) followed by fixation and permeabilization (BD Cytofix/Cytoperm kit) according to the manufacturer’s instructions. The fixed cells were then stained with PE-Cy7-conjugated Ki-67 antibody and FITC-labeled caspase 3 antibody.
Statistical analysis
The values were reported as Mean ± SEM of multiple experiments or Mean ± SD from a representative experiment. Differences were analyzed by Student’s t test. p < 0.05 was regarded as significant.
Ningfei An, PhD, is a postdoctoral research associate at the Medical University of South Carolina. Andrew Kraft, MD, is a professor of medicine and the director of the Hollings Cancer Center, Medical University of South Carolina. Yubin Kang, MD, is an assistant professor and a hematologist/oncologist at the Hollings Cancer Center, Medical University of South Carolina.
Acknowledgements
We thank Richard Peppler at the HCC Flow Cytometry Core for performing flow cytometry analysis. We thank Dr. Woodrow J. Coker III for critical reading of the manuscript. This work is supported by MUSC Hollings Cancer Center Startup Fund, Hollings Cancer Center ACS IRG (YK), ASCO Conquer Cancer Foundation Career Development Award (YK), NIH 1K08HL 103780-01A1 (YK), and NIH 3P30CA138313-01S3. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health or other funding agents.
Competing interests
The authors declare no competing financial interests.
Authors’ contribution
NA performed research and analyzed data. ASK designed research. NA and YK designed research and wrote the paper. All authors reviewed and approved the final manuscript.