Background
Oxidative stress is classically described as an imbalance of redox homeostasis, resulting from the overproduction of free radicals relative to the innate ability of cells to scavenge them. This detrimental event causes damage to cellular components and alterations in cellular function that ultimately contribute to cell death [
1,
2]. Reactive oxygen species (ROS) are the most common type of free radicals produced in the human body and play an important role in cellular injury in various tissues, particularly the central nervous system (CNS), which is highly sensitive to oxidative damage due to its large dependence on oxygen consumption [
3,
4]. In fact, oxidative stress is associated with aging and is a common pathological feature of age-related neurodegenerative diseases, such as Alzheimer’s disease (AD), Parkinson’s disease (PD), and amyotrophic lateral sclerosis (ALS), in which ROS accumulation is implicated in the mechanism of neuronal loss [
5‐
7]. Currently, many researchers believe that compounds or drugs possessing powerful antioxidant activity could be effective in treating such ROS-related diseases [
8‐
10].
Glutamate, the principal excitatory neurotransmitter in the brain, has been suggested as a critical trigger of neuronal cell death in several CNS disorders and neurodegenerative diseases [
11]. In addition to its involvement in many aspects of normal brain functions, glutamate can also act as a neurotoxin when it is present in excessively high concentrations in the brain extracellular space, causing cellular damage in the context of neurodegeneration. One of the main mechanisms underlying the neurotoxic effects of glutamate is an oxidative stress-induced programmed cell death pathway called oxytosis [
12]. In this cell death paradigm, glutamate at pathological levels induces inhibition of cystine uptake via the cystine/glutamate antiporter (system Xc
−), leading to impaired production of the endogenous antioxidant glutathione (GSH) and thereby enhancing accumulation of ROS as well as oxidative stress. Subsequently, the elevated ROS level disrupts mitochondrial membrane integrity and results in the release of apoptosis-inducing factor (AIF), which eventually triggers neuronal death via a caspase-independent pathway [
13,
14]. Therefore, suppression of glutamate-induced oxidative stress-mediated neuronal cell death may have the potential to provide a beneficial therapeutic approach for the treatment of neurodegenerative diseases.
At the present time, there is growing worldwide use of herbal medicines for preventive and therapeutic applications based on historical knowledge. In connection with the aforementioned mechanism of glutamate-induced oxidative toxicity, medicinal plants or naturally derived compounds with antioxidant and antiapoptotic effects are currently being researched as neuroprotective agents [
15‐
19].
Acanthus ebracteatus Vahl. (AE), commonly known as “Sea Holly”, is a medicinal mangrove plant in the family Acanthaceae and is widely distributed in Southeast Asia, including China, India, and Australia [
20,
21]. All parts of this plant have been used historically for a variety of medicinal purposes, such as hair root nourishment, reduction of cough and fever, expulsion of kidney stones, relief of rheumatoid arthritis pain and inflammation, and treatment of hypertension, cancer, skin diseases such as rash, chronic wounds and snakebites [
22‐
26]. Interestingly, AE is also used as an important ingredient in traditional Thai longevity and neurotonic remedies for improving brain and body functions [
23,
27]. Moreover, previous chemical investigations on this plant revealed the presence of some bioactive components possessing considerable antioxidant activity, neuromodulatory function or memory-improving effects [
28‐
32]. However, currently, there is no conclusive evidence to substantiate its brain and neural health promotion properties. Thus, the present study was conducted to investigate, for the first time, the neuroprotective effect of AE leaf extract against glutamate-induced oxidative cytotoxicity and to further elucidate its underlying protective mechanisms using the mouse hippocampal neuronal HT22 cell line as a cellular model of neurodegeneration.
Methods
Plant material and preparation of the extracts
The plant material used in this study is the leaves of A. ebracteatus collected from the Princess Maha Chakri Sirindhorn Herbal Garden (Rayong Province, Thailand). The plant was authenticated by Professor Dr. Thaweesakdi Boonkerd and deposited with voucher specimen number A013422(BCU) at the herbarium of Kasin Suvatabhandhu (Department of Botany, Faculty of Science, Chulalongkorn University, Thailand). The extraction was carried out twice using hexane and absolute ethanol as extracting solvents. Briefly, the leaves were dried in a ventilated incubator at a temperature of at 40 °C and ground into a fine powder. Then, the extracts were prepared by macerating 35 g of the dried leaf powder in 350 mL of each solvent for 48 h under agitation at room temperature (RT), followed by filtration. The residue powder was re-extracted by a similar process, and all filtrates were subsequently combined before removing the solvent by vacuum evaporation. The yield of hexane extract (AEH) and ethanolic extract (AEE) of A. ebracteatus leaves was found to be 2.14% and 7.98% (w/w), respectively. Each resulting extract was dissolved in dimethyl sulfoxide (DMSO) as a stock solution of 100 mg/mL, stored at − 20 °C, and protected from light until further analysis.
Determination of total flavonoid content
The total flavonoid content was determined using the aluminum chloride colorimetric method modified for a microplate format as described previously [
33]. In brief, 50 μL of the extract sample (1 mg/mL) was made up to 200 μL with 95% ethanol, and mixed well with 10 μL of 10% (
v/v) AlCl
3 solution and 10 μL of 1 M NaOAc solution. After the reaction was allowed to stand for 40 min in the dark, the absorbance of the reaction mixture was measured at 415 nm using a microplate reader (Perkin-Elmer). Quercetin (Sigma-Aldrich) was used as a standard to construct the calibration curve for quantification, and the content of total flavonoids was reported as mg of quercetin equivalent (QE) per g of dry weight extract.
Determination of total phenolic content
The total phenolic content was determined using the Folin-Ciocalteu method adapted for analysis with a microplate reader, as previously described [
33]. Briefly, 50 μL of the extract sample (1 mg/mL) was mixed thoroughly with 50 μL of 10-fold diluted Folin-Ciocalteu’s phenol reagent (Sigma-Aldrich). After 20 min of incubation, the mixture was neutralized by addition of 50 μL of a 7.5% (
w/
v) Na
2CO
3 solution and then kept in the dark at RT for a further 20 min. Finally, the absorbance was measured at 760 nm using an EnSpire® Multimode Plate Reader (Perkin-Elmer). The content of total phenolics was calculated from a standard calibration curve using gallic acid (TCI America, Portland, OR, USA), and the results are expressed as mg of gallic acid equivalent (GAE) per g of dry weight extract.
LC-MS analysis
The extract was submitted to Institute of Systems Biology (Universiti Kebangsaan Malaysia, Malaysia) for screening of phytochemical constituents using Liquid Chromatography-Mass Spectrometry (LC-MS) analysis. The analytical system used was a Dionex™ UltiMate 3000 UHPLC system (Thermo Fisher Scientific) coupled with a high-resolution micrOTOF-Q III (Bruker Daltonik GmbH, Bremen, Germany). The chromatographic separation was performed on an Acclaim™ Polar Advantage II C18 column (3 μm, 3 mm × 150 mm) (Thermo Fisher Scientific) with a gradient mobile phase consisting of 0.1% formic acid in water (A) and 100% acetonitrile (B). The elution program was as follows: 5% B (0-3 min); 80% B (3-10 min); 80% B (10-15 min) and 5% B (15-22 min). The flow rate was 400 μL/min and the injection volume was 1 μL. The MS instrument was operated in the positive electrospray ionization (ESI) mode with the parameters setting as follows: drying gas flow at 8 L/min, drying gas temperature at 200 °C, nebulizer pressure at 1.2 bar, capillary voltage at 4500 V, and m/z scan range of 50 to 1000. For identification of putative compounds, the observed (experimental) m/z values were compared with the METLIN and the KNApSAcK databases as well as with the calculated (theoretical) mass values of previously reported compounds in A. ebracteatus, with an accepted difference of less than 30 parts-per-million (ppm). Relative amount is expressed as the percentage of peak area relative to total area of all peaks observed in the chromatogram.
Cell culture
The immortalized mouse hippocampal HT22 cell line, which served as an in vitro model of neurodegeneration, was a generous gift from Prof. David Schubert at the Salk Institute (San Diego, CA, USA). The HT22 cell line was originally a glutamate-sensitive subclone of the HT-4 cell line, which was derived from the immortalization of primary mouse hippocampal neuronal tissues with a temperature-sensitive SV40 T-antigen [
34]. These cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% (
v/v) fetal bovine serum (Sigma-Aldrich), 100 units/mL penicillin, and 100 μg/mL streptomycin (Gibco, Waltham, MA, USA) in a humidified atmosphere of 5% CO
2 at 37 °C. The culture medium was replaced every two days. Upon reaching approximately 80% confluency, the cells were passaged by trypsinization and subcultured into fresh medium to maintain their exponential growth.
MTT reduction assay
The MTT assay measures cell viability based on the metabolic activity of viable cells to reduce the yellow tetrazolium salt, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), to a purple formazan product. HT22 cells were seeded at a density of 6 × 103 cells/well in a 96-well plate and incubated overnight prior to treatment with 5 mM glutamate (Sigma-Aldrich) alone or glutamate in combination with different concentrations of the extracts for 24 h. After the exposure period, the MTT solution (Biobasic, Markham, Ontario, Canada) was added to each well at a final concentration of 0.5 mg/mL and incubated for an additional 4 h in the dark. The generated formazan crystals were dissolved in a DMSO-ethanol mixture (1:1, v/v) after the supernatants were carefully removed from the wells. Finally, the absorbance was determined at 550 nm by using an EnSpire® Multimode Plate Reader (Perkin-Elmer, Waltham, MA, USA). The results are expressed as a percentage relative to control (untreated) cells.
LDH leakage assay
The LDH assay determines cell viability based on the release of cytoplasmic lactate dehydrogenase (LDH) from damaged cells, which converts the colorless tetrazolium salt, 2-(p-iodophenyl)-3-(p-nitrophenyl)-5-phenyl tetrazolium chloride (INT), into a red formazan product. HT22 cells were seeded at a density of 6 × 103 cells/well in a 96-well plate and incubated overnight prior exposure to 5 mM glutamate alone or glutamate in combination with different concentrations of the extracts for 24 h. After treatment, the amount of LDH released into the culture medium was measured using the CytoTox 96® assay (Promega, Madison, WI, USA) according to the manufacturer’s instructions. In brief, the culture supernatant was incubated with reconstituted substrate mix in the dark for 30 min at RT, followed by addition of the stop solution before measurement. The absorbance was then recorded at 490 nm by a microplate reader (Perkin-Elmer). The results are expressed as a percentage of maximum LDH release obtained by complete lysis of control (untreated) cells.
Flow cytometric determination of apoptotic cells
Apoptotic cell death was determined based on the externalization of phosphatidylserine to the outer cell surface and increased plasma membrane permeability to dye by using an FITC Annexin V apoptosis detection kit with propidium iodide (PI) (BioLegend, San Diego, CA, USA) according to the manufacturer’s protocol. Briefly, HT22 cells were seeded onto a 6-well plate at a density of 1.5 × 105 cells/well and incubated overnight prior to treatment with 5 mM glutamate alone or glutamate in combination with the extracts for 18 h. At the end of the exposure period, the harvested cells were washed twice with phosphate-buffered saline (PBS), re-suspended in the binding buffer, and stained by the solution of FITC-conjugated annexin V and PI for 15 min in the dark. The fluorescence intensity of stained cells, at least 10,000 cells per group, was immediately analyzed by a BD FACSCalibur™ flow cytometer (BD Bioscience, Heidelberg, Germany). The results are expressed as a percentage of annexin V-positive/PI-negative cells (early apoptosis) plus annexin V/PI-positive cells (late apoptosis).
In vitro radical scavenging assay
The radical scavenging assay was performed using the DPPH and ABTS methods for evaluation of antioxidant activity of the sample based on its hydrogen atom- or electron-donating capacity to neutralize the free radicals. A working solution of stable free radical 2,2-diphenyl-1-picrylhydrazyl (DPPH•) (Sigma-Aldrich) was dissolved in ethanol to a final concentration of 0.2 mg/mL. The cation radical ABTS• + working solution was generated by the oxidation of 7 mM 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) (Sigma-Aldrich) with 2.45 mM potassium persufhate at a 1:1 (v/v) ratio. The reaction mixture was allowed to stand for 16–18 h in the dark prior to dilution with ethanol until the absorbance reached between 0.7 and 0.8 at 734 nm. For the assay protocol, the DPPH• or ABTS• + working solution was added to the extract sample (1 mg/mL) at a ratio of 9:1 (v/v). The reaction mixture was incubated in the dark at RT for 15 min or 30 min, and the absorbance was recorded using a microplate reader (Perkin-Elmer) at 517 nm or 734 nm for the DPPH or ABTS assay, respectively. Ascorbic acid (vitamin C) (Calbiochem, San Diego, CA, USA) was used as a reference standard in both assays. Radical scavenging activity was expressed as the percent inhibition of free radicals calculated by the following equation: % Inhibition = 100 - [(Abs of sample - Abs of blank) × 100/ Abs of control]. The antioxidant capacity is expressed as vitamin C equivalent antioxidant capacity (VCEAC) in mg per g of dry weight extract.
Assay for intracellular ROS level
Measurement of the intracellular ROS level was performed using oxygen-sensitive 2′,7′-dichloro-dihydrofluoroscein diacetate (H2DCFDA) (Molecular Probes, Eugene, OR, USA) based on the ability of ROS to oxidize the cell-permeant, non-fluorescent H2DCFDA molecule into a highly fluorescent 2′,7′-dichlorofluorescein (DCF) molecule. HT22 cells were seeded at a density of 1 × 104 cells/well in a 96-well plate and incubated overnight prior to exposure to 5 mM glutamate alone or glutamate in combination with different concentrations of the extracts for 14 h. After treatment, the cells were loaded with 5 μM H2DCFDA, incubated at 37 °C for another 30 min, and then washed three times with Hank’s balanced salt solution (HBSS) (Gibco). Fluorescence was immediately determined using an EnSpire® Multimode Plate Reader (Perkin-Elmer), and photographs were obtained using an Axio Observer A1 fluorescence microscope (Carl Zeiss, Jena, Germany), with an excitation wavelength of 485 nm and an emission wavelength of 535 nm. Data are expressed as the percentage of fluorescence intensity relative to control (untreated) cells.
Quantitative real-time PCR analysis
At the end of treatments, the total RNA from HT22 cells in each group was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The amount of RNA was quantified by measuring absorbance at 260 nm, and then 1 μg of total RNA was reverse transcribed to cDNA using oligo(dT)17 primer and AccuPower RT PreMix (Bioneer, Daejeon, South Korea). The cDNA was used as a template for subsequent real-time PCR reactions performed on an Exicycler™ 96 real-time quantitative thermal block (Bioneer) by using the GreenStar™ qPCR PreMix (Bioneer) and the specific primers listed in Table
1. The thermal cycling conditions included an initial denaturation step at 95 °C for 10 min, followed by 40 cycles, each consisting of 15 s of denaturation at 95 °C, 15 s at 55 °C for primer annealing, and 30 s at 72 °C for chain elongation. A melting curve analysis was performed after amplification to verify the accuracy of the amplicon. The relative expression level of each target gene was normalized to β-actin expression and analyzed using the 2
-ΔΔCT method.
Table 1
Primers used for real-time PCR
EAAT3 | NM_009199.2 | Forward: ATGATCTCGTCCAGTTCGGC | 202 |
Reverse: TGACGATCTGCCCAATGCTT |
NQO1 | NM_008706.5 | Forward: CGACAACGGTCCTTTCCAGA | 253 |
Reverse: CTCCCAGACGGTTTCCAGAC |
GCLM | NM_008129.4 | Forward: GGAGCTTCGGGACTGTATCC | 236 |
Reverse: CAACTCCAAGGACGGAGCAT |
ACTB | NM_007393.5 | Forward: GGCTGTATTCCCCTCCATCG | 154 |
Reverse: CCAGTTGGTAACAATGCCATGT |
Western blot analysis
Protein expression of target genes was determined by Western blotting. After the treatments, HT22 cells were harvested, washed, and prepared for whole cell lysates as well as cytoplasmic and nuclear fractions. Whole cell lysates were obtained by lysing the cells on ice in NP-40 lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% NP-40, 1 mM PMSF, 1 mM DTT). Cytoplasmic and nuclear fractions were isolated using the NE-PER nuclear and cytoplasmic extraction reagents (Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer’s protocol. Total protein concentrations were measured by the Bradford reagent (Bio-Rad, Hercules, CA, USA) with bovine serum albumin (BSA) as a standard. Equal amounts of proteins were separated by electrophoresis on 10% (v/v) SDS-polyacrylamide gels and electrotransferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked for 1 h with 5% skim milk in TBS-T (Tris-buffered saline, 0.1% Tween 20) and allowed to incubate overnight at 4 °C with primary antibodies specific for nuclear factor erythroid 2-related factor 2 (Nrf2) (1:2000; Santa Cruz Biotechnology, Dallas, Texas, USA), excitatory amino acid transporter 3 (EAAT3) (1:8000; Abcam, Cambridge, UK), apoptotic-inducing factor (AIF) (1:2000; Cell Signaling Technology, Danvers, MA, USA), Lamin B1 (1:2000; Cell Signaling Technology) or β-actin (1:16000; Cell Signaling Technology) and subsequently incubated for an additional 45 min at RT with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:10000; Cell Signaling Technology). Specific protein bands were visualized with an enhanced chemiluminescence (ECL) detection reagent (GE Healthcare, Marlborough, MA, USA). Densitometric analysis of the bands was performed with an image analysis system (Syngene, Cambridge, UK).
Immunofluorescence microscopy
HT22 cells were seeded in 12-well plate at a density of 4 × 104 cells/well prior exposure to 5 mM glutamate alone or glutamate in combination with the extract for 16 h. After treatments, an immunofluorescence technique was performed to determine nuclear translocation of AIF. In brief, the cells were fixed with cold 4% (w/v) paraformaldehyde solution for 20 min, permeabilized in 0.1% (w/v) Triton X-100 for 10 min, and blocked with 5% (w/v) BSA for 30 min. Then, the cells were incubated overnight with anti-AIF antibody (1:400; Cell Signaling Technology) at 4 °C, followed by incubation for 1 h with Alexa Fluor 555-conjugated goat anti-rabbit (1:2000; Sigma-Aldrich) at RT. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) solution for 10 min at RT. Following mounting with ProLong Gold antifade mountant (Thermo Fisher Scientific), stained cells were imaged using an LSM 700 confocal laser scanning microscope (Carl Zeiss, Jena, Germany).
Statistical analysis
All experiments were performed in at least triplicate and the data are represented as means ± standard deviation (SD) or means ± standard error of mean (SEM) as indicated in figures. All of the calculations were performed using SPSS software version 17.0 (SPSS Inc., Chicago, IL, USA). The differences between groups were analyzed using one-way analysis of variance (ANOVA), followed by the post hoc Tukey HSD multiple comparison test. The results were considered statistically significant when P < 0.05.
Discussion
Neurodegenerative diseases are a group of disorders that occur as a result of chronic and progressive degeneration of neurons in the brain areas specific for each disorder, such as Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease (HD), multiple sclerosis (MS), and amyotrophic lateral sclerosis (ALS). Among a variety of neurodegenerative diseases, AD is the most prevalent disorder in the elderly. AD accounts for approximately 60–80% of all dementia cases and is now in the top 10 causes of death in the United States (U.S.) [
38]. Moreover, the number of AD patients is rising dramatically every year, partly owing to a growing aging population worldwide [
39]. The therapeutic action of most of the U.S. Food and Drug Administration (FDA)-approved AD drugs is to inhibit the enzyme acetylcholinesterase (AChE), which may not be effective in preventing or curing this kind of disease. Therefore, the development of an alternative treatment strategy for AD by focusing on other targets is promising and urgently needed for the management of neurodegenerative diseases in the near future. Currently, traditional plant-based remedies, especially in the Ayurveda system, have attracted the attention of society as well as the scientific world for their potential to treat several chronic and uncured illnesses, including neurodegenerative disorders [
40‐
43]. The benefits of plant-derived compounds over synthetic drugs include the ease of availability at low cost and the comparative safety, especially for patients with long-term medication treatment.
Dysregulation of glutamatergic neurotransmission has been implicated as a critical contributor to various neurodegenerative diseases [
11,
44‐
47]. Thus, several recent studies have drawn on the search of new drugs for neurodegenerative disorders by targeting this neurotransmitter. In the central nervous system (CNS), glutamate neurotoxicity is commonly mediated by two major pathways; receptor-dependent (excitotoxicity) and non-receptor-mediated (oxidative toxicity or oxytosis) pathways [
35,
48]. Indeed, oxidative stress is involved not only in oxytosis but also in the mechanism of excitotoxicity, in which high intracellular Ca
2+ influx caused by overstimulation of glutamate receptors could eventually contribute to excessive ROS production [
48]. However, directly inhibiting glutamate receptors may not be a suitable approach as these receptors are important for maintaining normal brain functions [
49]. Unsuccessful treatment of AD patients with mild to moderate symptoms by memantine, an antagonist of the N-methyl-D-aspartate (NMDA)-type glutamate receptor, further supports that oxidative stress, rather than receptor stimulation, plays a key role in the pathogenesis of neurodegenerative diseases [
50]. Interestingly, a previous clinical trial has shown a significant beneficial efficacy of the well-known, powerful antioxidant vitamin E in comparison with memantine for mild to moderate AD cases [
51]. Therefore, in this present study, we exclusively focused on the oxidative toxicity pathway in examining the cytotoxic responses to glutamate.
In researching glutamate-mediated toxicity, various cell lines have been used as model systems, each originating from different brain areas and exhibiting distinct responses to glutamate [
52]. In comparison with other models, the HT22 cell line serves as an appropriate model system for mechanistic studies of oxidative stress-mediated neuronal injury induced by glutamate. Since the HT22 cells do not express the NMDA type of glutamate receptor, toxicity in this model occurs mainly through oxytosis. In this work, our experiments were performed using a high concentration of glutamate (5 mM), which caused a 50% reduction in cell viability relative to a previous report [
33]. The present study also confirmed increased ROS generation and AIF nuclear translocation as the mechanism of cell death in this model. Furthermore, the majority of dead cells observed in this study, likely in the late stage of apoptosis after glutamate treatment for 18 h, is consistent with the previous finding that glutamate-induced apoptotic cell death was relatively late, ranging from 16 to 24 h post-treatment [
35].
Although AE has long been used in traditional remedies, there are unexpectedly few scientific reports regarding its therapeutic usages, particularly for anti-aging and anti-neurodegeneration. This study provides the first scientific evidence on its neuroprotective activity. In this present work, we found that both AE hexane (AEH) and ethanol (AEE) leaf extracts ameliorated the cytotoxic effects of glutamate in neurons, supporting the historical use of AE as a neurotonic agent [
27]. The protective mechanism of AEE against glutamate-induced neuronal cell death could be through lowering intracellular ROS levels, inhibition of nuclear AIF translocation, and activation of the Nrf2/ARE pathway. Moreover, the alteration in Nrf2 levels was observed only in the nucleus after treatment (Fig.
6c), indicating that there might be an increase in both Nrf2 expression and nuclear translocation processes. Unlike AEE, AEH showed lower free radical scavenging activity and did not increase transcription levels of Nrf2-regulated antioxidant genes. The exact mechanism of AEH to mediate neuronal protection is still unclear, and requires further investigation. A limitation of this study is that the effect of AEE upon Nrf2 activation was not directly elucidated by suppressing Nrf2 transcriptional activity using either small interfering RNA or an inhibitor. However, as Nrf2 is a central controlling factor required for mediating positive regulation of NQO1 and GCLM gene expression [
53,
54], the observation that elevated mRNA levels of NQO1 and GCLM occurred upon AEE treatment support possible involvement of Nrf2 in the protective effect of AEE.
The majority of previously reported phytochemical components in AE are polyphenolic in structure [
23,
28], which is generally known to possess strong antioxidant activity [
55,
56]. In agreement with those previous studies, our results of total flavonoids and phenolic contents support the presence of those compounds in AE leaf extract. Additionally, the LC-MS analysis (Table
2) revealed 5 bioactive components previously reported in this plant, which includes adenosine, vicenin-2, verbascoside, isoversbacoside, and leucosceptoside A. Among these compounds, verbascoside (or acteoside) is a molecule of interest, as it has been shown to have antioxidant functions and protective activities in different cell models of neurodegeneration [
30,
31,
57‐
61]. It is noteworthy that this compound also exerts a beneficial effect on cognition and memory enhancement [
32,
62,
63]. Furthermore, we proposed 6 additional compounds, namely, betaine, verbacoside, skimmin, loliolide, andrographolide, and α-linolenic acid, which were identified according to m/z values against the database and selected due to either earlier reports of their antioxidant defense function or their potential neuroprotection roles [
64‐
72]. Nevertheless, due to the complexity of crude extracts and limitations of the single mass analysis, all compounds proposed here need to be confirmed using other identification techniques, such as quantitative HPLC or liquid chromatography-tandem mass spectrometry (LC-MS/MS). In addition, the neuroprotective activity of the AE components should be re-evaluated later both individually and in combination.
Acknowledgments
The authors are very grateful to the Princess Maha Chakri Sirindhorn Herbal Garden (Rayong Province, Thailand) for providing plant material and to Prof. David Schubert (The Salk Institute, San Diego, CA, USA) for his generous gift of HT22 cells. We also thank Varaporn Rakkhitawatthana for her help in plant extraction as well as to Noppadol Sa-Art-Iam for his technical assistance in flow cytometry.