Background
Mucosal-associated invariant T (MAIT) cells are a unique population of innate-like lymphocytes that is restricted by major histocompatibility complex class I-related protein (MR1) and expresses the semi-invariant T-cell receptor (TCR) Vα7.2-Jα33 in humans and Vα19-Jα33 in mice with a limited set of Vβ chains [
1,
2]. Similarly to other innate-like lymphocytes, such as natural killer (NK) cells, γδT cells, and invariant natural killer T (iNKT) cells, MAIT cells rapidly exert effector functions upon activation without the need to undergo clonal expansion [
3,
4]. MAIT cells were originally named after their preferential location at mucosal tissues, where they are involved in the first-line defense against exogenous stimuli [
2]. Interestingly, MAIT cells are absent in the peripheral blood of germ-free mice [
2]. MAIT cells have been shown to react to antigen-presenting cells in the presence of certain types of microbes in vitro and to protect mice against pathogenic bacteria in vivo [
5‐
7]. Therefore, MAIT cells are thought to recognize microbial antigens, and Kjer-Nielsen et al. recently elucidated that bacteria-derived vitamin B
2 metabolites bind to MR1 and activate MAIT cells [
8].
Other recent studies revealed that MAIT cells are abundant in human peripheral blood and constitute between 1% and 10% of all αβT cells [
4,
9]. They express high levels of CD161, an NK receptor also known as NKR-P1A, and exhibit effector memory phenotypes in peripheral blood, presumably owing to their prior exposure to microbial antigens from commensal bacteria. Similarly to other innate-like T cells such as γδT cells and iNKT cells, MAIT cells can be fully activated by cytokines in the absence of exogenous antigens [
10‐
12]. Previously, we demonstrated that murine MAIT cells stimulated with interleukin (IL)-23 produce IL-17, whereas IL-1β induces MAIT cell proliferation [
10]. Human MAIT cells are also activated by the combination of IL-12 and IL-18 and produce interferon (IFN)-γ. These activation mechanisms of MAIT cells indicate that they could be involved in various types of immune responses besides antimicrobial immunity. Indeed, whereas MAIT cells exacerbate joint inflammation in arthritis models, they suppress neuroinflammation in experimental autoimmune encephalomyelitis and colitis in a trinitrobenzenesulfonic acid-induced colitis model [
10,
13,
14].
Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the production of autoantibodies. The activation of autoreactive B and T cells is a hallmark of lupus pathology, although other features include numerical and functional abnormalities of innate immune cells and innate-like lymphocytes. In SLE, the frequencies of NK cells, iNKT cells, and γδT cells are decreased, and the killing activity of NK cells and the cytokine production of iNKT cells are reduced [
15‐
21]. In addition, the proliferative capacity of lupus γδT cells is diminished [
21]. Although it is not known whether these abnormalities are a cause or consequence of the pathological process underlying SLE, the activated status and functional abnormalities are clearly associated with the pathology.
Recently, Cho et al. reported that levels of MAIT cells were reduced in patients with SLE [
22]. MAIT cell deficiency is associated with these cells’ poor responsiveness upon activation and elevated programmed cell death protein 1 (PD-1) expression. Numerical and functional deficiencies of iNKT cells may also contribute to the malfunction of MAIT cells. We also demonstrate that the frequency of MAIT cells was markedly reduced in patients with SLE. However, contrary to the findings of Cho et al., we show that MAIT cells in SLE are greatly activated and that their activation is correlated with disease activity. The reduction of MAIT cell frequency was not due to a downregulation of surface markers, but rather was partially caused by activation-induced cell death. We elucidate two possible mechanisms of MAIT cell activation in SLE. First, we demonstrate that monocytes in patients with SLE have an increased capacity to present MR1 antigens and activate MAIT cells. Second, we show that the plasma levels of IL-6, IL-18, and IFN-α positively correlate with the activated status of MAIT cells in SLE, and that MAIT cells are activated by cytokines, including IL-18 and IFN-α, in the absence of exogenous antigens, indicating that inflammatory cytokines may also be responsible for the activation of MAIT cells in lupus. Taken together, MAIT cells reflect the pathological condition of SLE, and their activated status correlates with presence of disease. These findings suggest that MAIT cells may be associated with the pathogenesis of SLE.
Methods
Human samples
We obtained peripheral blood from a total of 53 patients with SLE (49 females and 4 males, median age 36.0 years [IQR 30.0–43.0], median disease duration 6.0 years [IQR 1.0–11.0]) diagnosed according to the American College of Rheumatology revised criteria for SLE [
23] and 48 healthy control subjects (HCs) after gaining informed consent in accordance with local ethics committee guidelines of Juntendo University. HCs were matched to patients with SLE for sex and age. The characteristics of patients with SLE and HCs are shown in Table
1. Disease activity was measured using the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) [
24], and a SLEDAI score ≥5 was defined as active disease. This study was conducted with the approval of the regional ethics committee at Juntendo University Hospital.
Table 1
Characteristics of healthy control subjects and patients with lupus
Number | 48 | 53 |
Females/males, n
| 43/5 | 49/4 |
Age, years | 37.5 (28.3–43.8) | 36.0 (30.0–43.0) |
Disease duration, years | | 6.0 (1.0–11.0) |
SLEDAI score | | 6.0 (2.0–15.5) |
SLEDAI <5, n
| | 25 |
SLEDAI ≥5, n
| | 28 |
Medications |
Medication-naïve, n
| | 7 |
Prednisone, n
| | 46 |
Prednisone dose, mean ± SD (mg/day) | | 11.0 (5.0–22.5) |
Immunosuppressive agent,a
n
| | 13 |
Flow cytometric analysis
Peripheral blood mononuclear cells (PBMCs) were purified from heparinized blood by centrifugation over a Ficoll-Paque gradient (GE Healthcare, Uppsala, Sweden). PBMCs were incubated with Fc receptor blocking reagent (Miltenyi Biotec, Bergisch Gladbach, Germany), and cell surface staining was performed using the following monoclonal antibodies (mAbs) and tetramers: TCR pan-γ/δ-fluorescein isothiocyanate (FITC), CD8β-phycoerythrin (PE)-Texas Red electron-coupled dye (Beckman Coulter, Indianapolis, IN, USA); CD3-allophycocyanin (APC)-H7, CD4-APC-H7, CD8a-APC-H7, CD3-AmCyan, CD3-BD Horizon V500 (BD Biosciences, San Jose, CA, USA); TCR Vα7.2-PE, TCR Vα7.2-APC, TCRγ/δ-APC, CD3-peridinin chlorophyll (PerCP)/cyanine 5.5 (Cy5.5), CD161-PerCP/Cy5.5, CD161-Brilliant Violet 421, CD4-Alexa Fluor 700, CD69-Alexa Fluor 700, CD69-Brilliant Violet 605, CD95-Brilliant Violet 421, (BioLegend, San Diego, CA, USA); CD161-APC (eBioscience, San Diego, CA, USA); and CD1d/PBS-57 tetramer-APC (National Institutes of Health Tetramer Core Facility, Atlanta, GA, USA). Staining with 7-aminoactinomycin D (7-AAD; BD Biosciences) was performed to discern dead cells. In most experiments, samples were fixed using BD stabilizing fixative (BD Biosciences). Intracellular staining of active caspase-3 was performed using the caspase-3 active form mAb apoptosis kit with FITC (BD Biosciences). Data were acquired by fluorescence-activated cell sorting (FACS) on an LSRFORTESSA (BD Biosciences), and the percentages of each cell population and mean fluorescence intensities (MFIs) were analyzed with FlowJo software (FlowJo LLC, Ashland, OR, USA).
Single-cell polymerase chain reaction
Cells were single-cell-sorted using the BD FACSAria II system (BD Biosciences) into catch buffer (10 mM Tris, pH 8.0) containing 40 U/μl of RNasin ribonuclease inhibitor (Promega, Madison, WI, USA). Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed using a four-primer mixture and the QIAGEN OneStep RT-PCR Kit (QIAGEN, Germantown, MD, USA) following the manufacturer’s instructions. The following primers were used: AV7.2-AJ33-S, CTGGATGGTTTGGAGGAGAA; AV7.2-AJ33-AS, GCGCCCCAGATTAACTGATA; TRAC-A, TGCCTATTCACCGATTTTGA; and TRAC-AS, GCAGCGTCATGAGCAGATTA.
Cell culture
PBMCs were cultured in 96-well flat-bottom plates in RPMI 1640 medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FBS, 2 mM
l-glutamine, 50 U/ml penicillin, and 50 μg/ml streptomycin (all from Thermo Fisher Scientific). PBMCs were stimulated with either immobilized anti-CD3 mAb (OKT3, 1 μg/ml; American Type Culture Collection, Manassas, VA, USA) or IL-6, IL-12p70 (PeproTech, Rocky Hill, NJ, USA), IL-13, IL-15 (BioLegend), IL-18 (Medical & Biological Laboratories Co. [MBL], Nagoya, Japan), granulocyte-macrophage colony-stimulating factor (GM-CSF), IFN-α (R&D Systems, Minneapolis, MN, USA), or a major histocompatibility complex class I-related protein ligand (MR1L; 10 μM). The cytokine concentrations for stimulation were 50 ng/ml, except for IFN-α (100 U/ml). 7-Methyl-8-
d-ribityllumazine was synthesized following previously reported procedures [
25] and used as an MR1L.
Proliferation assay
PBMCs were labeled using the CellTrace Violet Cell Proliferation Kit (Thermo Fisher Scientific) and cultured in 96-well flat-bottom plates coated with anti-CD3 mAb (1 μg/ml) and anti-CD28 mAb (CD28.2, 1 μg/ml; BioLegend). Seven days later, cells were stained with surface markers and 7-AAD, and CellTrace low-dividing cells or 7-AAD-positive dead cells were analyzed by FACS.
Activation of human MAIT cells by MR1L
B cells or monocytes were sorted from PBMCs using anti-CD19 or anti-CD14 microbeads (Miltenyi Biotec), respectively, following the manufacturer’s instructions. MAIT cells were sorted from PBMCs of HCs using the BD FACSAria II system (BD Biosciences) or MoFlo Astrios cell sorter (Beckman Coulter) as described elsewhere [
26]. B cells or monocytes (1 × 10
4 cells) were cultured for 18 h with MAIT cells (5 × 10
4 cells) in the presence of MR1L (10 μM).
Cytokine measurement
Cytokine levels were measured using sandwich enzyme-linked immunosorbent assays for IL-18 (MBL) and IFN-α (PBL Assay Science, Piscataway, NJ, USA) or a Bio-Plex assay (Bio-Rad Laboratories, Hercules, CA, USA) for other cytokines.
Statistical analysis
All data were analyzed using Prism 6 software (GraphPad Software Inc., La Jolla, CA, USA), and differences between the groups were analyzed using the Mann–Whitney U test, the Kruskal-Wallis test followed by Dunn’s multiple comparisons test, or the Wilcoxon rank-sum test. The significance level was set at p < 0.05. Associations between two variables were analyzed using Spearman’s correlation.
Discussion
In the present study, we demonstrated that MAIT cell levels are decreased in the peripheral blood of patients with SLE, and that the reduction of MAIT cells in the periphery was due, at least in part, to activation-induced cell death. MAIT cells in SLE are activated, and the expression of the activation marker CD69 on these cells clearly correlated with disease activity. We revealed that MAIT cell activation was associated with an increased activation capacity of monocytes from patients with lupus. We also demonstrated that the elevated levels of certain inflammatory cytokines correlated with the activated state of MAIT cells in SLE, and that this may elicit the cytokine-mediated activation of MAIT cells. Taken together, our data reveal that MAIT cells reflect the pathogenesis of SLE and that their activated status strongly correlates with presence of disease.
Poor responses of iNKT cells and γδT cells upon stimulation have been reported in SLE, and the low responsiveness of iNKT was shown to be due to cell-intrinsic impairment in these cells, but not antigen-presenting cells [
17,
18,
20,
21]. Authors of a previous report on lupus MAIT cells showed that the elevated PD-1 expression was accompanied by impaired IFN-γ production by these cells [
22]. In our study, MAIT cells from patients with SLE also proliferated poorly upon activation, and this may also be due to PD-1 expression on lupus MAIT cells. However, because they expressed high levels of CD69 and FAS, we speculated that MAIT cells were already activated in vivo and were not able to respond to further stimulation in vitro. We revealed that monocytes exhibited an enhanced MR1-restricted antigen-presenting capacity in patients with SLE. As MR1-restricted antigens are vitamin B metabolites originating from biosynthetic pathways present in various types of microbes, including indigenous bacteria, lupus monocytes may be exposed to such antigens and subsequently induce activation of MAIT cells.
The CD69 expression on MAIT cells was markedly upregulated in patients with active disease, but there was a trend of increased CD69 expression on MAIT cells even in patients with inactive disease. This suggests that chronic activation of MAIT cells may underlie the pathogenesis of SLE. Monocytes exhibit an enhanced antigen-presenting capacity, in both patients with active disease and those with inactive disease, and this may be responsible for the chronic activation of MAIT cells in SLE. CD69 expression on MAIT cells in patients with lupus positively correlated with plasma concentrations of IL-6, IL-18, and IFN-α. Thus, once robust inflammation occurs, MAIT cells are fully activated by cytokines, which are highly expressed in active disease, and this in turn causes CD69 upregulation on MAIT cells.
MAIT cell deficiency in the peripheral blood could be related to the use of immunosuppressive agents, including corticosteroids [
26]. Cho et al. showed that there was no correlation between MAIT cell frequencies and use of steroids or immunosuppressive drugs in patients with SLE. In this study, we also did not observe a correlation between the dose of corticosteroid and the percentage of MAIT cells or CD69 expression on MAIT cells. Reduced frequency of MAIT cells in peripheral blood has previously been demonstrated in patients with other autoimmune diseases, inflammatory disorders, and infectious diseases [
5,
22,
27‐
33]. In many cases, the reduction of peripheral blood MAIT cells appears to be due to their migration into the inflamed tissues because MAIT cells have a propensity to migrate to the site of inflammation. Notably, MAIT cells constitutively express high levels of chemokine receptors such as C-C chemokine receptors CCR5 and CCR6 [
9,
27]. IL-18-stimulated MAIT cells upregulate the surface expression of very late antigen-4, an integrin that mediates T-cell migration through its interaction with vascular cell adhesion molecule-1 (VCAM-1) [
12]. Indeed, MAIT cells accumulate in lesions of patients with multiple sclerosis, rheumatoid arthritis, inflammatory bowel diseases, and mycobacterial infection [
5,
12,
22,
28,
30,
34], and the activated status of MAIT cells positively correlated with both the plasma levels of IL-18 and disease activity in ulcerative colitis [
28]. The reduction of MAIT cell frequency was related to the elevated serum concentration of IL-18 in multiple sclerosis [
12]. Urinary levels of IL-18 and VCAM-1 were reported to be increased and associated with pathological events in lupus nephritis [
35,
36], so MAIT cells may also migrate into inflamed tissues in SLE.
Previously, we demonstrated that human MAIT cells exerted suppressive activity against IFN-γ production by other T cells [
27]. However, under inflammatory conditions, MAIT cells produced more proinflammatory cytokines than anti-inflammatory cytokines. Human adipose tissue MAIT cells produced IL-10, but in obese patients, they produced little IL-10 and more IL-17 [
37,
38]. MAIT cells produce higher levels of IL-17 in patients with inflammatory diseases, including ulcerative colitis, ankylosing spondylitis, diabetes, and obesity [
28,
29,
36‐
38]. Thus, it is possible that MAIT cells recruited to inflamed sites contribute to the organ damage in SLE. Further investigations using animal models are in progress to elucidate the role of MAIT cells in the pathogenesis of lupus.
Acknowledgements
We thank the National Institutes of Health Tetramer Core Facility (contract HHSN272201300006C) for CD1d tetramers and J. L. Croxford for critically reviewing the manuscript.