nach oben

Erschienen in:

Open Access 01.12.2015 | Research

Adenosine A_2AR blockade prevents neuroinflammation-induced death of retinal ganglion cells caused by elevated pressure

verfasst von: Maria H. Madeira, Filipe Elvas, Raquel Boia, Francisco Q. Gonçalves, Rodrigo A. Cunha, António Francisco Ambrósio, Ana Raquel Santiago

Erschienen in: Journal of Neuroinflammation | Ausgabe 1/2015

Abstract

Background

Elevated intraocular pressure (IOP) is a major risk factor for glaucoma, a degenerative disease characterized by the loss of retinal ganglion cells (RGCs). There is clinical and experimental evidence that neuroinflammation is involved in the pathogenesis of glaucoma. Since the blockade of adenosine A_2A receptor (A_2AR) confers robust neuroprotection and controls microglia reactivity in the brain, we now investigated the ability of A_2AR blockade to control the reactivity of microglia and neuroinflammation as well as RGC loss in retinal organotypic cultures exposed to elevated hydrostatic pressure (EHP) or lipopolysaccharide (LPS).

Methods

Retinal organotypic cultures were either incubated with LPS (3 μg/mL), to elicit a pro-inflammatory response, or exposed to EHP (+70 mmHg), to mimic increased IOP, for 4 or 24 h, in the presence or absence of the A_2AR antagonist SCH 58261 (50 nM). A_2AR expression, microglial reactivity and neuroinflammatory response were evaluated by immunohistochemistry, quantitative PCR (qPCR) and enzyme-linked immunosorbent assay (ELISA). RGC loss was assessed by immunohistochemistry. In order to investigate the contribution of pro-inflammatory mediators to RGC loss, the organotypic retinal cultures were incubated with rabbit anti-tumour necrosis factor (TNF) (2 μg/mL) and goat anti-interleukin-1β (IL-1β) (1 μg/mL) antibodies.

Results

We report that the A_2AR antagonist (SCH 58261) prevented microglia reactivity, increase in pro-inflammatory mediators as well as RGC loss upon exposure to either LPS or EHP. Additionally, neutralization of TNF and IL-1β prevented RGC loss induced by LPS or EHP.

Conclusions

This work demonstrates that A_2AR blockade confers neuroprotection to RGCs by controlling microglia-mediated retinal neuroinflammation and prompts the hypothesis that A_2AR antagonists may be a novel therapeutic option to manage glaucomatous disorders.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

MHM, RAC, AFA and ARS conceived and designed the experiments. MHM, FE, RB and FQG performed the experiments. MHM, FE, RB, FQG, RAC, AFA and ARS analyzed the data. RAC, AFA and ARS contributed the reagents/materials/analysis tools. MHM, FE, RB, RAC, AFA and ARS wrote the paper. All contributing authors have read and approved the final version of the manuscript.

ADA

Adenosine deaminase

ATP

Adenosine triphosphate

A_2AR

A_2A receptor

CTCF

Corrected total cell fluorescence

EHP

Elevated hydrostatic pressure

GCL

Ganglion cell layer

Interleukin

iNOS

Inducible nitric oxide synthase

IOP

Intraocular pressure

LPS

Lipopolysaccharide

Nitric oxide

PBS

Phosphate-buffered saline

RGC

Retinal ganglion cell

TNF

Tumour necrosis factor

Background

Glaucoma is the third leading cause of visual impairment and the second cause of blindness worldwide [1]. It is defined as a group of chronic degenerative optic neuropathies, characterized by the irreversible and progressive loss of retinal ganglion cells (RGCs) and damage of the optic nerve (RGC axons). Although glaucoma is a multifactorial disease, elevated intraocular pressure (IOP) is a major risk factor and the current treatments are mainly focused on reducing IOP [2]. However, many patients continue to lose vision despite the control of IOP, and neuroprotective strategies aimed to prevent RGC loss are necessary [3].

Increasing evidence has shown that neuroinflammation has an important role in the pathogenesis of glaucoma [4‐6]. Accordingly, microglial cells display an activated amoeboid-like morphology at the early stages of glaucoma [7‐10]. In parallel, there is an increased expression and release of pro-inflammatory cytokines [e.g. tumour necrosis factor (TNF), interleukin-1β (IL-1β)] and nitric oxide (NO) in the glaucomatous eye [11‐14]. The importance of this microglia-associated neuroinflammation in glaucoma is underscored by the observation that the control of microglia activation [15‐17] or of pro-inflammatory cytokine expression [4, 18] can prevent the loss of RGC in animal models of glaucoma.

Microglia-associated neuroinflammation is also involved in different brain disorders [19]. Adenosine is a neuromodulator, which can control inflammatory reactions [20, 21] and microglia reactivity [22‐24] mainly through the activation of its G-protein-coupled receptor of the A_2A receptor (A_2AR) subtype [25]. Accordingly, A_2AR antagonists afford robust neuroprotection upon ischemia, epilepsy or Alzheimer’s or Parkinson’s disease [25].

All these evidence prompt the hypothesis that A_2AR antagonists may also control the microglia-associated neuroinflammation and loss of RGC in animal models of glaucoma. Therefore, the main aim of this work was to investigate whether A_2AR blockade modulates retinal microglia reactivity, neuroinflammation and loss of RGC triggered by lipopolysaccharide (LPS) or elevated hydrostatic pressure (EHP).

Materials and methods

Animals

Adult Wistar rats were housed in certified local facilities, in a temperature- and humidity-controlled environment, and were provided with standard rodent diet and water ad libitum, under a 12 h light/12 h dark cycle. All procedures involving animals were approved by the Ethical Committee of the Faculty of Medicine of the University of Coimbra/Center for Neuroscience and Cell Biology and are in agreement with the Association for Research in Vision and Ophthalmology statement for animal use.

Organotypic retinal cultures

Wistar rats (8–10 weeks old) were euthanized and their eyes enucleated. Retinas were dissected in a Ca²⁺- and Mg²⁺-free Hank’s balanced salt solution (HBSS (in mM) 137 NaCl, 5.4 KCl, 0.45 KH₂PO₄, 0.34 Na₂HPO₄, 4 NaHCO₃, 5 glucose; pH 7.4) and placed in tissue culture inserts (Millipore; 0.4-μm pore diameter) with the ganglion cell layer (GCL) facing up. The retinas were cultured for 4 days in DMEM-F12 with GlutaMAX I, supplemented with 10 % heat-inactivated foetal bovine serum and 0.1 % gentamicin (all from Life Technologies) at 37 °C, in 5 % CO₂ humidified atmosphere, as previously described [26]. The culture medium was replaced at culture days 1 and 2.

Culture treatments

Organotypic retinal cultures were either incubated with LPS (3 μg/mL, Sigma-Aldrich) or exposed to EHP (70 mmHg above atmospheric pressure) for 4 or 24 h. The concentration of LPS was chosen amongst three tested concentrations of LPS (1, 3 and 5 μg/mL), as the lowest triggering an increase in iNOS immunoreactivity in the majority of microglial cells in organotypic retinal cultures. For the EHP experiments, we used a custom-made humidified pressure chamber equipped with a pressure gauge and a pressure regulator, which allowed maintaining a constant pressure with an air mixture of 95 % air and 5 % CO₂, as described previously [27]. The chamber was placed in an oven at 37 °C. The magnitude of pressure elevation (70 mmHg above atmospheric pressure) was chosen in accordance with previous studies [27, 28]. For ambient pressure experiments, the organotypic retinal cultures were kept in a standard 5 % CO₂ humidified incubator.

The cultures were incubated with a selective A_2AR antagonist (SCH 58261; Tocris Bioscience), tested at a selective and supra-maximal concentration (50 nM) [24], which was added 45 min before exposure to LPS or EHP. To test the role of extracellular adenosine, organotypic cultures were treated with 1 U/mL adenosine deaminase (ADA; Roche Applied Science) which catalyzes the irreversible deamination of adenosine to inosine. In order to investigate the contribution of pro-inflammatory mediators to RGC loss, the organotypic retinal cultures were incubated with rabbit anti-TNF (2 μg/mL; Peprotech) and goat anti-IL-1β (1 μg/mL; R&D Systems) antibodies, or with corresponding immunoglobulin Gs (IgGs), 45 min before exposure to LPS or EHP for 24 h. Organotypic cultures were also incubated with 20 ng/mL TNF and 10 ng/mL IL-1β (ImmunoTools) to evaluate if TNF and IL-1β, by themselves, lead to RGC loss.

Immunohistochemistry

Organotypic cultures were washed with phosphate-buffered saline (PBS (in mM) 137 NaCl, 2.7 KCl, 10 Na₂HPO₄ and 1.8 KH₂PO₄; pH 7.4) and fixed with ice-cold ethanol for 10 min at 4 °C. After washing in PBS, cultures were blocked and permeabilized with 10 % normal goat serum, 3 % bovine serum albumin and 0.1 % Triton X-100 in PBS, for 1 h, and then incubated with the primary antibody (Table 1) for 48 h at 4 °C. After washing, cultures were incubated overnight with the secondary antibody (Table 1), at 4 °C. Retina cultures were then washed and incubated with 4′,6-diamidino-2-phenylindole (DAPI; 1:1000) for 15 min, to stain nuclei. After washing, the preparations were flat-mounted on slides and coverslipped using Glycergel mounting medium.

Table 1

Primary and secondary antibodies used in immunohistochemistry

	Supplier	Host	Dilution
Primary antibodies
Anti-A_2AR	Santa Cruz Biotechnology	Goat	1:100
Anti-CD11b	AbD Serotec	Mouse	1:250
Anti-iNOS	BD Biosciences	Rabbit	1:200
Anti-Brn3a	Chemicon	Mouse	1:500
Secondary antibodies
Alexa Fluor anti-mouse 568	Life Technologies	Donkey	1:200
Alexa Fluor anti-goat 488	Life Technologies	Rabbit	1:200
Alexa Fluor anti-rabbit 488	Life Technologies	Goat	1:200

Image acquisition and densitometric analysis

The preparations were observed with a confocal microscope (LSM 710, Zeiss) on an Axio Observer Z1 microscope using an EC Plan-Neofluar 40x/1.30 Oil DIC M27 objective, and, from each quadrant, at least three images of the GCL were randomly acquired (encompassing central and peripheral retina), in a total of 12 images. The settings and exposure times were kept identical for all conditions within each experiment. Densitometric analysis was performed using the public domain ImageJ program (http://rsb.info.nih.gov/ij/). Corrected total cell fluorescence (CTCF) was calculated as previously described [29] using the following formula:

$$ \mathrm{CTCF} = \mathrm{Integrated}\ \mathrm{density}-\left(\mathrm{area}\ \mathrm{of}\ \mathrm{selected}\ \mathrm{cell}\kern0.37em \times \mathrm{mean}\ \mathrm{fluorescence}\ \mathrm{of}\ \mathrm{background}\ \mathrm{reading}\right) $$

Circularity index and skeleton analysis

Morphological alterations of microglia were estimated as previously described [30] using the confocal images of the retinal organotypic cultures labelled with anti-CD11b. Briefly, the particle measurement feature of ImageJ was used to automatically evaluate the circularity index (CI) of microglia, using the formula CI = 4π(area/perimeter²). A circularity index of 1.0 indicates a perfect circle.

The microglial cell complexity and branch length were assessed by skeleton analysis using ImageJ software, as described previously [31]. Briefly, confocal images were converted to 8-bit format, followed by noise de-speckling to eliminate single-pixel background fluorescence. Then, images were converted to binary images, which were analyzed using AnalyzeSkeleton plugin (http://fiji.sc/AnalyzeSkeleton) to assess the number of microglial cell processes, number of branch endpoints and maximum branch length for each cell. These results were analyzed as average per frame.

ATP quantification

The extracellular levels of adenosine triphosphate (ATP) were quantified with a luciferase ATP bioluminescence assay kit (Sigma-Aldrich) as we previously described [32]. Briefly, the supernatants were collected and immediately stored at −80 °C until used. Then, 80 μL of these supernatant were added to a white 96-well plate (designed for bioluminescence) placed in a VICTOR multilabel plate reader (PerkinElmer). The luciferin-luciferase ATP assay mix (40 μL) was automatically loaded in each well, and the luminescence output was converted to ATP concentration by interpolation of a standard curve, which was linear between 2 × 10⁻¹² and 8 × 10⁻⁵ M. ATP concentration was normalized to the total amount of protein of each retina, which was determined by the bicinchoninic acid assay (Pierce Biotechnology).

NO production assay

The production of NO was quantified by the Griess reaction method in the supernatants of the culture medium. The culture medium was centrifuged (10,000g for 10 min) and the supernatant stored at −80 °C until use. Then, the supernatant was incubated (1:1) with Griess reagent mixture (1 % sulfanilamide in 5 % phosphoric acid with 0.1 % N-1-naphthylethylenediamine) for 30 min at room temperature and in the dark. The optical density was measured at 550 nm using a microplate reader (Synergy HT; Biotek). The nitrite concentration was determined from a sodium nitrite standard curve.

Quantitative real-time PCR

Total RNA was extracted using Qiagen RNeasy Mini Kit (Qiagen), according to the instructions provided by the manufacturer. The concentration and purity of total RNA were determined using NanoDrop ND1000 (Thermo Scientifics). Then, 1 μg of total RNA was reversed transcribed using a NZY First-Strand cDNA Synthesis Kit according to the manufacturer instructions (NZYTech, Portugal). The resultant complementary DNA (cDNA) was treated with RNase-H for 20 min at 37 °C, and a 1:2 dilution was prepared for quantitative PCR (qPCR) analysis. All cDNA samples were stored at −20 °C until further analysis.

Genomic DNA contamination was assessed with a conventional PCR for β-actin using intron-spanning primers (Table 2), as described previously [33]. SYBR Green-based real-time qPCR was performed using a StepOnePlus PCR system (Applied Biosystems). The PCR conditions were as follows: iTaq™ Universal SYBR® Green Supermix (Bio-Rad), 200 nM primers (Table 2) and 2 μL of 1:2 dilution of cDNA, in a total volume of 20 μL. Cycling conditions were a melting step at 95 °C for 15 s, annealing elongation at 60 °C for 45 s and extension at 72 °C, with 40 cycles. A dissociation curve at the end of the PCR run was performed by ramping the temperature of the sample from 60 to 95 °C, while continuously collecting fluorescence data. Ct values were converted to relative quantification using the 2^−ΔΔCt method [34]. Three candidate housekeeping genes (hprt, Ywhaz and GAPDH) were evaluated using NormFinder, a Microsoft Excel Add-in [35], and hprt was the most stable gene throughout all experimental conditions and samples and, therefore, was used as the housekeeping gene.

Table 2

Primers used in qPCR and RT-PCR

Gene	GenBank number	Forward	Reverse	Amplicon size (bp)
Adora2A	NM_053294	5′ - GGCTATCTCTGACCAACA - 3′	3′ - TGGCTTGACATCTCTAATCT - 5′	106
TNF	NM_012675	5′ - CCCAATCTGTGTCCTTCT - 3′	3′ - TTCTGAGCATCGTAGTTGT - 5′	90
IL-1β	NM_031512	5′ - ATAGAAGTCAAGACCAAAGTG - 3′	3′ - GACCATTGCTGTTTCCTAG - 5′	109
Nos II	NM_012611	5′ - AGAGACAGAAGTGCGATC - 3′	3′ - AGAGATTCAGTAGTCCACAATA - 5′	96
hprt	NM_012583	5′ - ATGGGAGGCCATCACATTGT- 3′	3′ - ATGTAATCCAGCAGGTCAGCAA - 5′	76
actb	NM_031144	5′ - GCTCCTCCTGAGCGCAAG - 3′	3′ - CATCTGCTGGAAGGTGGACA - 5′	75

Enzyme-linked immunosorbent assay

Culture media was centrifuged (10,000g for 10 min) and the supernatant was collected and stored at −80 °C until use. The levels of TNF and IL-1β in the culture supernatants were quantified by enzyme-linked immunosorbent assay (ELISA), according to the instructions provided by the manufacturer (Peprotech).

Retinal ganglion cell counting

Retinal ganglion cells were identified by immunohistochemistry staining with an antibody anti-Brn3a (RGC marker), and confocal images of the GCL were acquired (as described above). The number of Brn3a-immunoreactive cells per image was counted using ImageJ Cell Counter plugin (http://rsbweb.nih.gov/ij/plugins/cell-counter.html). Results represent the average of Brn3a-immunoreactive cells per image.

Statistical analysis

The results are presented as mean ± standard error of the mean (SEM). The data were analyzed using the non-parametric Kruskal-Wallis test, followed by Dunn’s multiple comparison test, as indicated in the figure legends. The statistical analysis was performed using the Prism 6.0 software for Mac OS X (GraphPad Software, Inc).

Results

The retinal organotypic culture is particularly useful to evaluate molecular and cellular mechanisms in the retina because the retinal structure is maintained [26]. Thus, we used this experimental model to investigate the ability of A_2AR to control neuroinflammation and RGC death triggered by LPS or EHP (to mimic an increase in IOP).

LPS and EHP increased the expression of A_2AR in retinal microglial cells in the GCL

Since the A_2AR modulation system undergoes a gain of function upon noxious brain conditions [25], we first assessed if this also occurred in the retina. Therefore, we investigated if LPS or EHP up-regulated the expression of A_2AR and bolstered the source of adenosine responsible for the activation of A_2AR, i.e. ATP-derived adenosine [36].

LPS or EHP exposure for 4 h significantly increased A_2AR messenger RNA (mRNA) expression in the retina by 5.3- and 6.0-fold (n = 6–10), respectively (Fig. 1a). Accordingly, 4 h after exposure to LPS or EHP, A_2AR immunoreactivity increased mainly in CD11b-positive cells in the GCL (Fig. 1b), indicating that A_2AR in the GCL are mainly present in microglia.

Extracellular ATP levels in control conditions were 0.6 ± 0.3 pmol/μg protein (n = 8) and significantly increased by 173.8 ± 30 and 215.1 ± 40 % after 24 h of exposure to LPS or EHP (n = 6–8), respectively (Fig. 1c).

A_2AR blockade prevented the alterations of microglia morphology triggered by LPS or EHP

Modification of cell morphology is one of the hallmarks of microglia activation and has been widely used to categorize different activation states [19]. As shown in Fig. 2a, under control conditions, microglial cells (i.e. CD11b-positive cells) in the GCL typically presented a ramified morphology [circularity index (CI) 0.110 ± 0.02, n = 7; Fig. 2b], compatible with a surveying phenotype. After 24 h of exposure to LPS or EHP, microglia morphology changed to a more amoeboid-like morphology (CI 0.242 ± 0.014 and 0.182 ± 0.006, respectively; n = 5–8, P < 0.05 vs. control). Incubation with the selective antagonist of A_2AR (SCH 58261, 50 nM) prevented the LPS- and EHP-induced alterations of microglia circularity index (n = 5–8) (Fig. 2b). In addition, skeleton morphological analysis was used to further document more subtle morphological changes compatible with microglial activation. Retinal microglia from LPS- and EHP-treated cultures presented a decrease in the number of branches (Fig. 2c), endpoints (Fig. 2d) and maximum branch length (Fig. 2e) compared to the control condition. The blockade of A_2AR prevented these alterations, indicating that A_2AR blockade blunted LPS- and EHP-induced microglia reactivity.

Blockade of A_2AR prevented microglia production of NO

Since the activation of microglial cells leads to the production of pro-inflammatory and cytotoxic factors like NO both in vivo and in vitro [37], we tested if A_2AR could control the up-regulation of inducible nitric oxide synthase (iNOS), which plays a critical role in neuroinflammation by generating high amounts of NO in reactive microglia [38].

As expected, the mRNA expression of iNOS significantly increased by 30.5-fold after 4 h of exposure to LPS (n = 6), and this effect was significantly decreased upon A_2AR blockade (n = 4) (Fig. 3a). The exposure to EHP for 4 h also significantly increased iNOS mRNA expression by 4.6-fold over control (n = 5), and the blockade of A_2AR also significantly prevented this effect (n = 6) (Fig. 3a).

In control conditions, the immunoreactivity of iNOS was barely detected in microglia localized in the GCL (Fig. 3b). Exposure to LPS or EHP for 24 h significantly increased iNOS immunoreactivity mainly in CD11b-immunoreactive cells (Fig. 3b, c), confirming that microglial cells are the main producers of NO under these conditions. This effect was abolished by blockade of A_2AR, since iNOS immunoreactivity was similar to control (Fig. 3b, c).

The release of NO was indirectly quantified in the culture medium by Griess reaction 24 h after exposure to LPS or EHP (Fig. 3d). In control conditions, nitrite concentration was 5.64 ± 0.17 μM (n = 6). LPS or EHP significantly increased nitrite concentration to 149.5 ± 11 and 138 ± 3.5 % of the control, respectively (n = 4–5), and these effects were prevented by A_2AR blockade (n = 3–4) (Fig. 3d).

A_2AR blockade mitigated the inflammatory response induced by LPS or EHP

Activation of microglia leads to an increased expression and release of pro-inflammatory cytokines, such as IL-1β and TNF [19]. To further test if A_2AR blockade prevented the LPS- and EHP-induced inflammatory response, we quantified mRNA levels encoding for IL-1β and TNF by qPCR. As shown in Fig. 4a, the exposure of retinal organotypic cultures to LPS or EHP for 4 h significantly increased the transcript levels of IL-1β and TNF (n = 5). Overall, the blockade of A_2AR inhibited the LPS- and EHP-induced increase of IL-1β and TNF mRNA levels (n = 5–7) (Fig. 4a).

We next quantified the levels of IL-1β and TNF in the culture medium by ELISA (Fig. 4b). In control conditions, the concentration of IL-1β in the culture medium was 67.1 ± 5.5 pg/mL and the concentration of TNF was 30.9 ± 53.7 pg/mL (n = 10–15). Incubation with LPS or EHP for 4 h significantly increased IL-1β concentration in the culture medium to 135.3 ± 6.9 and 146.7 ± 9 pg/mL, respectively (n = 6–8), and the TNF concentration to 317.6 ± 40.6 and 162.8 ± 42.6 pg/mL, respectively (n = 6–9) (Fig. 4b). The blockade of A_2AR significantly inhibited the LPS- and the EHP-induced increase of IL-1β or TNF levels in the culture medium (n = 5) (Fig. 4b).

Additionally, we tested if the removal of endogenous extracellular adenosine was equivalent to blocking A_2AR in the control of LPS- or EHP-induced neuroinflammation. We found that the pretreatment of organotypic cultures with ADA (1 U/mL), which removes extracellular adenosine, abrogated the LPS- and EHP-induced increase in the expression (Fig. 4a) and extracellular levels (Fig. 4b) of both TNF and IL-1β (n = 3).

A_2AR blockade prevented RGC death through the control of neuroinflammation

The elevation of the hydrostatic pressure is an experimental strategy to mimic in a retina culture model a situation of IOP increase, which is a major risk factor for glaucoma [2]. Studies from Sappington et al. [27] have already described RGC death under EHP conditions.

Since A_2AR blockade prevented microglia activation and the expression and release of pro-inflammatory cytokines, we next tested if A_2AR blockade also prevented the loss of RGC induced by LPS or EHP in retinal organotypic cultures. Loss of RGCs was evaluated by counting the number of RGC, identified with an antibody against Brn3a (Fig. 5a), a marker of RGCs [39, 40]. The number of Brn3a-immunoreactive cells (Fig. 5a, c) significantly decreased when the retinal explants were exposed to LPS or EHP for 24 h, when compared with the control (190.5 ± 12 Brn3a-immunoreactive cells per field in control vs. 118.9 ± 11 and 113.9 ± 6 Brn3a-immunoreactive cells per field in LPS and EHP conditions, respectively, n = 6–7), indicating that both insults cause RGC loss. This effect was prevented with the treatment with A_2AR antagonist (191.2 ± 7.3 and 184.3 ± 9.3 cells per field, respectively; Fig. 5a, c; n = 4–5).

Since A_2AR blockade prevented both inflammatory responses and RGC loss triggered by LPS and EHP, we next investigated if TNF and IL-1β were necessary and sufficient to induce RGC loss under noxious conditions (LPS or EHP). Organotypic retinal cultures were pretreated with antibodies against TNF and IL-1β before incubation with LPS or exposure to EHP, in order to reduce the levels of both pro-inflammatory cytokines. The incubation of organotypic retinal cultures with antibodies against TNF and IL-1β prior incubation with LPS or exposure to EHP fully prevented the loss of RGCs (180.6 ± 8 and 170.2 ± 4 Brn3a-immunoreactive cells, respectively, n = 5; Fig. 5b, c). As a control, the incubation with rabbit and goat IgGs did not significantly inhibit the decrease in the number of RGC upon exposure to LPS or EHP (n = 4). In addition, incubation with TNF (20 ng/mL) plus IL-1β (10 ng/mL) was sufficient to induce loss of RGC (n = 3) (Fig. 5c) to an extent similar to that triggered by LPS or EHP. Moreover, incubation with the neutralizing antibodies in control conditions did not alter the number of RGCs present in the culture (data not shown). The neutralizing experiments under noxious conditions (LPS or EHP) fully recapitulated the incubation with SCH 58261, further supporting our conclusion that A_2AR blockade control RGC loss through a control of retinal neuroinflammation.

Discussion

The present work demonstrates that the blockade of A_2AR prevented retinal neuroinflammation and death of RGC in an ex vivo model of glaucoma. We exposed retinal organotypic cultures to LPS and EHP, which bolstered microglia reactivity, increased neuroinflammatory response and loss of RGCs. These two noxious conditions up-regulated the A_2AR system, as typified by an increase in the extracellular levels of ATP and increased expression and density of A_2AR in microglia. Concomitantly, the A_2AR system critically contributed to the neuroinflammation and RGC death, since A_2AR blockade prevented the activation of microglia, the production of pro-inflammatory cytokines and the death of RGCs.

We took advantage of retinal organotypic cultures, a suitable model to evaluate cellular and molecular signalling mechanisms in which retinal anatomy is maintained [26] and which has been established as a convenient model for screening potential neuroprotective drugs in the retina [41]. This in vitro system enabled us to demonstrate that EHP changed microglia morphology towards an amoeboid-like form, similar to that caused by LPS, which has been extensively used as a microglial activator. Activation of microglial cells is observed as an early event in animal models of glaucoma [9, 42], in which increased IOP is a main risk factor [2]. In retinal organotypic cultures, the observed EHP- and LPS-induced microglia reactivity was paralleled by an increased expression and release of the pro-inflammatory cytokines IL-1β and TNF. Likewise, an increased production of TNF [11, 43] and IL-1β [44, 45] has been observed in glaucomatous animal models and in human glaucoma. Furthermore, the ability of anti-IL-1β and anti-TNF antibodies to prevent EHP-induced RGC death provided critical evidence that the death of RGCs upon exposure to EHP or LPS in retinal organotypic cultures actually resulted from the impact of pro-inflammatory cytokines. This is in agreement with previous reports demonstrating that the control of microglia reactivity [15‐17] or of pro-inflammatory cytokines [4, 18, 46] prevents the loss of RGC in animal models of glaucoma. Nevertheless, the release of IL-6 by astrocytes and microglia triggered by EHP was reported to protect RGCs [27], although the authors used purified cultures of microglia, astrocytes and RGCs and did not evaluate the possible interactions between these cells in a more complex in vitro model, as the retinal organotypic culture. The globally deleterious role of microglia-associated pro-inflammatory status is further heralded by the report that minocycline, an inhibitor of microglia activation, reduced microglia activation and improved RGC axonal transport and integrity [15]. Overall, this evidence indicates that microglia reactivity is a precocious event and contributes to the pathophysiology of glaucoma by impairing the viability of RGCs.

The main conclusion of this study was the critical role of A_2AR in the control of EHP- or LPS-induced microglia activation, production of pro-inflammatory cytokines and RGC death in retinal organotypic cultures. Indeed, we observed that the blockade of A_2AR prevented the EHP- or LPS-induced modification of the production of pro-inflammatory cytokines and of NO as it was previously observed in the rodent hippocampus [24]. Accordingly, it was already demonstrated that activation of A_2AR potentiates NO release from reactive microglia in culture, an effect that was associated with microglia neurotoxicity, and A_2AR antagonist was suggested as a potential neuroprotective drug [22]. Moreover, we observed that A_2AR blockade prevents EHP-induced microglia morphological alterations, in agreement with recent findings that A_2AR antagonism reduces the retraction of processes in LPS-activated microglia [47].

These conclusions seems to contradict previous studies reporting that the activation of A_2AR reduces microglia reactivity using primary retinal microglia cultures exposed either to LPS, hypoxia or amadori-glycated albumin [48‐50]. Several factors may explain this discrepancy: (1) while others used cultures of microglial cells, we used an organotypic retinal culture in which all retinal cells are present, and thus, an additional contribution from other glial cells cannot be excluded [51, 52]; this is particularly important given that the control by A_2AR of microglia reactivity can be shifted from inhibitory to excitatory by the presence of increased extracellular levels of glutamate [53]; (2) the insults triggering microglia activation are different and the LPS concentrations and time points were different; and (3) CGS 21680, the A_2AR agonist, at the concentration used in those studies (20 and 40 μM) is no longer selective, being proposed to bind also to A₁R [54, 55]. The A₁R is coupled to G_i/o-proteins and often inhibitory, whereas the A_2AR is usually coupled to G_s-proteins, enhancing cAMP accumulation and PKA activity [56]. Nevertheless, the observation of different responses in different models should be taken into account due to the dual role of adenosine receptors and different responses of microglia, which can be elicited with different stimuli and environmental conditions [57]. In fact, in the brain, it is the blockade rather than the activation of A_2AR than reduce microglia activation and neuroinflammation upon different noxious stimuli [58, 24]. This probably contributes to the neuroprotection afforded by A_2AR antagonists in brain diseases with a neuroinflammatory involvement such as ischemia, epilepsy, traumatic brain injury, multiple sclerosis or Alzheimer’s or Parkinson’s disease (reviewed in [25]). Accordingly, we also observed that A_2AR blockade prevented the LPS- and the EHP-induced RGC death in retina organotypic cultures. This might result from the ability of A_2AR to control the activation of microglia and the production of pro-inflammatory cytokines that we showed to be sufficient and necessary to trigger RGC death, but it may also involve an ability of A_2AR to directly control neuronal viability. In fact, neuronal A_2AR can directly affect the degeneration of mature neurons upon exposure to different stimuli (e.g. [59, 60]), namely to pro-inflammatory cytokines [61], whereas they have an opposite effect in immature neurons [62, 63] and during neurodevelopment [64].

In our work, the relevance of the A_2AR modulation system in the control of RGC death through a control of neuroinflammation in the retina is further underscored by the observed up-regulation of this system in retinal organotypic cultures exposed either to LPS or to EHP. In fact, LPS and EHP caused an increase in the extracellular levels of ATP. The cellular source of this extracellular ATP is not clear, but it can be released from different cells in the retina, such as RGCs [65], microglia [66] and Müller cells [67]. Moreover, recent work demonstrated that astrocytes present in the optic nerve head can also release ATP through pannexin channels in response to a mechanical strain, suggesting this mechanism as a source of extracellular ATP under chronic mechanical strain, as occurs in glaucoma [68]. Actually, elevated levels of extracellular ATP have been reported in the retina as a response to an acute rise in ocular pressure [69, 70], and the ATP levels are elevated in the aqueous humour of patients with primary acute and chronic angle closure glaucoma, which presents evidence for a contribution of the purinergic signaling in this disease [71, 72]. The increased levels of ATP can function as a danger signal [73] and can either activate P2 receptors, namely P2X7 receptors in the retina [74, 65, 75, 76], or be extracellular catabolized by ecto-nucleotidases into extracellular adenosine that preferentially activates A_2AR [77, 36]. Remarkably, EHP and LPS not only bolstered the source of adenosine activating A_2AR but also triggered an increased expression of A_2AR, which was translated into an increased density of A_2AR in microglia. This is in accordance with the up-regulation of A_2AR that is observed upon different noxious conditions (reviewed in [78, 25]), namely in microglia [79, 24, 80]. Thus, noxious stimuli such as LPS or EHP triggered an up-regulation of the A_2AR system in retinal microglia, which critically contributes to the development of neuroinflammation and RGC death. We cannot rule out the role of A_2AR present in other cell types of the retinal organotypic culture, but in the GCL, A_2AR was found to be mainly located in microglia. Furthermore, additional studies will be required to determine if A_2AR blockade only affords a prophylactic benefit or may also be therapeutically effective.

Conclusions

The present results demonstrate that EHP can lead to an inflammatory response, similar to LPS, which is associated with the death of RGC. Thus, the organotypic retinal culture exposed to EHP may be an important experimental model to investigate neuroprotective and anti-inflammatory pharmacological strategies against RGC death. Herein, we demonstrate for the first time that A_2AR blockade prevents retinal microglia reactivity and pro-inflammatory responses triggered by LPS or EHP and confers neuroprotection to RGC by controlling retinal neuroinflammation induced by EHP or LPS. This prompts the hypothesis that A_2AR antagonists might have therapeutic potential in the treatment of glaucoma, a proposal re-enforced by the report that IOP could be reduced by a selective A_2AR antagonist, ZM 241385, in mice [81].

Acknowledgments

We are grateful to Fábio Paiva and to Margarida Souto-Carneiro (Center for Neuroscience and Cell Biology, Coimbra, Portugal) for providing the rabbit and goat IgGs. MH Madeira is a recipient of a PhD fellowship from the Foundation for Science and Technology (FCT, Portugal; SFRH/BD/75839/2011). The work was supported by FCT (PTDC/BIM-MEC/0913/2012, PEst-C/SAU/LA0001/2013-2014 and PEst-C/SAU/UI3282/2011-2013), Portugal, and COMPETE-FEDER (FCOMP-01-0124-FEDER-028417), AIBILI and QREN (CENTRO-07-ST24-FEDER-002006). There is no financial disclosure.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.

The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.

The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

Resnikoff S, Pascolini D, Etya’ale D, Kocur I, Pararajasegaram R, Pokharel GP, et al. Global data on visual impairment in the year 2002. Bull World Health Org. 2004;82:844–51.PubMedCentralPubMed

Caprioli J. Glaucoma: a disease of early cellular senescence. Invest Ophthalmol Vis Sci. 2013;54(14):ORSF60–7. doi:10.1167/iovs.13-12716.

Cordeiro MF, Levin LA. Clinical evidence for neuroprotection in glaucoma. Am J Ophthalmol. 2011;152(5):715–6. doi:10.1016/j.ajo.2011.06.015.PubMedCentralPubMedCrossRef

Howell GR, Macalinao DG, Sousa GL, Walden M, Soto I, Kneeland SC, et al. Molecular clustering identifies complement and endothelin induction as early events in a mouse model of glaucoma. J Clin Invest. 2011;121(4):1429–44. doi:10.1172/JCI44646.PubMedCentralPubMedCrossRef

Krizaj D, Ryskamp DA, Tian N, Tezel G, Mitchell CH, Slepak VZ, et al. From mechanosensitivity to inflammatory responses: new players in the pathology of glaucoma. Curr Eye Res. 2013;39(2):105–19. doi:10.3109/02713683.2013.836541.PubMedCentralPubMedCrossRef

Joachim SC, Gramlich OW, Laspas P, Schmid H, Beck S, von Pein HD, et al. Retinal ganglion cell loss is accompanied by antibody depositions and increased levels of microglia after immunization with retinal antigens. PLoS One. 2012;7(7):e40616. doi:10.1371/journal.pone.0040616.PubMedCentralPubMedCrossRef

Neufeld AH. Microglia in the optic nerve head and the region of parapapillary chorioretinal atrophy in glaucoma. Arch Ophthalmol. 1999;117:1050–6.PubMedCrossRef

Wang L, Cioffi GA, Cull G, Dong J, Fortune B. Immunohistologic evidence for retinal glial cell changes in human glaucoma. I Invest Ophthalmol Vis Sci. 2002;43(4):1088–94.

Bosco A, Steele MR, Vetter ML. Early microglia activation in a mouse model of chronic glaucoma. J Comp Neurol. 2011;519(4):599–620. doi:10.1002/cne.22516.PubMedCentralPubMedCrossRef

10.

Taylor S, Calder CJ, Albon J, Erichsen JT, Boulton ME, Morgan JE. Involvement of the CD200 receptor complex in microglia activation in experimental glaucoma. Exp Eye Res. 2011;92(5):338–43. doi:10.1016/j.exer.2011.01.012.PubMedCentralPubMedCrossRef

11.

Tezel G, Wax MB. Increased production of tumor necrosis factor-α by glial cells exposed to simulated ischemia or elevated hydrostatic pressure induces apoptosis in cocultured retinal ganglion cells. J Neurosci. 2000;20(23):8693–700.PubMed

12.

Yuan L, Neufeld AH. Tumor necrosis factor-α: a potentially neurodestructive cytokine produced by glia in the human glaucomatous optic nerve head. Glia. 2000;32:42–50.PubMedCrossRef

13.

Cho KJ, Kim JH, Park HY, Park CK. Glial cell response and iNOS expression in the optic nerve head and retina of the rat following acute high IOP ischemia-reperfusion. Brain Res. 2011;1403:67–77. doi:10.1016/j.brainres.2011.06.005.PubMedCrossRef

14.

Gramlich OW, Beck S, von Thun Und Hohenstein-Blaul N, Boehm N, Ziegler A, Vetter JM, et al. Enhanced insight into the autoimmune component of glaucoma: IgG autoantibody accumulation and pro-inflammatory conditions in human glaucomatous retina. PLoS One. 2013;8(2):e57557. doi:10.1371/journal.pone.0057557.PubMedCentralPubMedCrossRef

15.

Bosco A, Inman DM, Steele MR, Wu G, Soto I, Marsh-Armstrong N, et al. Reduced retina microglial activation and improved optic nerve integrity with minocycline treatment in the DBA/2J mouse model of glaucoma. Invest Ophthalmol Vis Sci. 2008;49(4):1437–46. doi:10.1167/iovs.07-1337.PubMedCrossRef

16.

Yang X, Chou TH, Ruggeri M, Porciatti V. A new mouse model of inducible, chronic retinal ganglion cell dysfunction not associated with cell death. Invest Ophthalmol Vis Sci. 2013;54(3):1898–904. doi:10.1167/iovs.12-11375.PubMedCentralPubMedCrossRef

17.

Wang K, Peng B, Lin B. Fractalkine receptor regulates microglial neurotoxicity in an experimental mouse glaucoma model. Glia. 2014;62(12):1943–54. doi:10.1002/glia.22715.PubMedCrossRef

18.

Roh M, Zhang Y, Murakami Y, Thanos A, Lee SC, Vavvas DG, et al. Etanercept, a widely used inhibitor of tumor necrosis factor-α (TNF-α), prevents retinal ganglion cell loss in a rat model of glaucoma. PLoS One. 2012;7(7):e40065. doi:10.1371/journal.pone.0040065.g001.PubMedCentralPubMedCrossRef

19.

Kettenmann H, Hanisch UK, Noda M, Verkhratsky A. Physiology of microglia. Physiol Rev. 2011;91(2):461–553. doi:10.1152/physrev.00011.2010.PubMedCrossRef

20.

Sitkovsky MV, Lukashev D, Apasov S, Kojima H, Koshiba M, Caldwell C, et al. Physiological control of immune response and inflammatory tissue damage by hypoxia-inducible factors and adenosine A_2A receptors. Annu Rev Immunol. 2004;22:657–82. doi:10.1146/annurev.immunol.22.012703.104731.PubMedCrossRef

21.

Hasko G, Linden J, Cronstein B, Pacher P. Adenosine receptors: therapeutic aspects for inflammatory and immune diseases. Nature Rev Drug Discovery. 2008;7(9):759–70. doi:10.1038/nrd2638.CrossRef

22.

Saura J, Angulo E, Ejarque A, Casado V, Tusell JM, Moratalla R, et al. Adenosine A_2A receptor stimulation potentiates nitric oxide release by activated microglia. J Neurochem. 2005;95(4):919–29. doi:10.1111/j.1471-4159.2005.03395.x.PubMedCrossRef

23.

Minghetti L, Greco A, Potenza RL, Pezzola A, Blum D, Bantubungi K, et al. Effects of the adenosine A_2A receptor antagonist SCH 58621 on cyclooxygenase-2 expression, glial activation, and brain-derived neurotrophic factor availability in a rat model of striatal neurodegeneration. J Neuropathol Exp Neurol. 2007;66(5):363–71. doi:10.1097/nen.0b013e3180517477.PubMedCrossRef

24.

Rebola N, Simões AP, Canas PM, Tomé AR, Andrade GM, Barry CE, et al. Adenosine A_2A receptors control neuroinflammation and consequent hippocampal neuronal dysfunction. J Neurochem. 2011;117(1):100–11. doi:10.1111/j.1471-4159.2011.07178.x.PubMedCrossRef

25.

Gomes CV, Kaster MP, Tomé AR, Agostinho PM, Cunha RA. Adenosine receptors and brain diseases: neuroprotection and neurodegeneration. Bioch Biophys Acta. 2011;1808(5):1380–99. doi:10.1016/j.bbamem.2010.12.001.CrossRef

26.

Kretz A, Hermening SH, Isenmann S. A novel primary culture technique for adult retina allows for evaluation of CNS axon regeneration in rodents. J Neurosci Methods. 2004;136(2):207–19. doi:10.1016/j.jneumeth.2004.01.012.PubMedCrossRef

27.

Sappington RM, Chan M, Calkins DJ. Interleukin-6 protects retinal ganglion cells from pressure-induced death. Invest Ophthalmol Vis Sci. 2006;47(7):2932–42. doi:10.1167/iovs.05-1407.PubMedCrossRef

28.

Sappington R, Calkins DJ. Pressure-induced regulation of IL-6 in retinal glial cells: involvement of the ubiquitin/proteasome pathway and NF-kB. Invest Ophthalmol Vis Sci. 2006;47:3860–9. doi: 10.1167/.PubMedCrossRef

29.

Gavet O, Pines J. Progressive activation of cyclin B1-Cdk1 coordinates entry to mitosis. Dev Cell. 2010;18(4):533–43. doi:10.1016/j.devcel.2010.02.013.PubMedCentralPubMedCrossRef

30.

Kurpius D, Wilson N, Fuller L, Hoffman A, Dailey ME. Early activation, motility, and homing of neonatal microglia to injured neurons does not require protein synthesis. Glia. 2006;54(1):58–70. doi:10.1002/glia.20355.PubMedCrossRef

31.

Morrison HW, Filosa JA. A quantitative spatiotemporal analysis of microglia morphology during ischemic stroke and reperfusion. J Neuroinflamm. 2013;10(1):4. doi:10.1186/1742-2094-10-4.CrossRef

32.

Cunha RA, Almeida T, Ribeiro JA. Modification by arachidonic acid of extracellular adenosine metabolism and neuromodulatory action in the rat hippocampus. J Biol Chem. 2000;275(48):37572–81. doi:10.1074/jbc.M003011200.PubMedCrossRef

33.

Santiago AR, Gaspar JM, Baptista FI, Cristóvão AJ, Santos PF, Kamphuis W, et al. Diabetes changes the levels of ionotropic glutamate receptors in the rat retina. Mol Vis. 2009;15:1620–30.PubMedCentralPubMed

34.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods. 2001;25(4):402–8. doi:10.1006/meth.2001.1262. S1046-2023(01)91262-9.

35.

Andersen CL, Jensen JL, Orntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004;64(15):5245–50. doi:10.1158/0008-5472.CAN-04-0496.PubMedCrossRef

36.

Augusto E, Matos M, Sevigny J, El-Tayeb A, Bynoe MS, Muller CE, et al. Ecto-5′-nucleotidase (CD73)-mediated formation of adenosine is critical for the striatal adenosine A_2A receptor functions. J Neurosci. 2013;33(28):11390–9. doi:10.1523/JNEUROSCI.5817-12.2013.PubMedCentralPubMedCrossRef

37.

Kraft AD, Harry GJ. Features of microglia and neuroinflammation relevant to environmental exposure and neurotoxicity. Int J Environ Res Public Health. 2011;8(7):2980–3018. doi:10.3390/ijerph8072980.PubMedCentralPubMedCrossRef

38.

Brown GC. Mechanisms of inflammatory neurodegeneration: iNOS and NADPH oxidase. Biochem Soc Trans. 2007;35(Pt 5):1119–21. doi:10.1042/BST0351119.PubMed

39.

Nadal-Nicolas FM, Jimenez-Lopez M, Sobrado-Calvo P, Nieto-Lopez L, Canovas-Martinez I, Salinas-Navarro M, et al. Brn3a as a marker of retinal ganglion cells: qualitative and quantitative time course studies in naive and optic nerve-injured retinas. Invest Ophthalmol Vis Sci. 2009;50(8):3860–8. doi:10.1167/iovs.08-3267.PubMedCrossRef

40.

Sanchez-Migallon MC, Nadal-Nicolas FM, Jimenez-Lopez M, Sobrado-Calvo P, Vidal-Sanz M, Agudo-Barriuso M. Brain derived neurotrophic factor maintains Brn3a expression in axotomized rat retinal ganglion cells. Exp Eye Res. 2011;92(4):260–7. doi:10.1016/j.exer.2011.02.001.PubMedCrossRef

41.

Bull ND, Johnson TV, Welsapar G, DeKorver NW, Tomarev SI, Martin KR. Use of an adult rat retinal explant model for screening of potential retinal ganglion cell neuroprotective therapies. Invest Ophthalmol Vis Sci. 2011;52(6):3309–20. doi:10.1167/iovs.10-6873.PubMedCentralPubMedCrossRef

42.

Naskar R, Wissing M, Thanos S. Detection of early neuron degeneration and accompanying microglial responses in the retina of a rat model of glaucoma. Invest Ophthalmol Vis Sci. 2002;43:2962–9.PubMed

43.

Tezel G, Li LY, Patil RV, Wax MB. TNF-α and TNF-α receptor-1 in the retina of normal and glaucomatous eyes. Invest Ophthalmol Vis Sci. 2001;42:1787–94.PubMed

44.

Yoneda S, Tanihara H, Kido N, Honda Y, Goto W, Hara H, et al. Interleukin-1beta mediates ischemic injury in the rat retina. Exp Eye Res. 2001;73(5):661–7. doi:10.1006/exer.2001.1072.PubMedCrossRef

45.

Manni G, Centofanti M, Oddone F, Parravano M, Bucci MG. Interleukin-1beta tear concentration in glaucomatous and ocular hypertensive patients treated with preservative-free nonselective beta-blockers. Am J Ophthalmol. 2005;139(1):72–7. doi:10.1016/j.ajo.2004.08.028.PubMedCrossRef

46.

Sivakumar V, Foulds WS, Luu CD, Ling E-A, Kaur C. Retinal ganglion cell death is induced by microglia derived pro-inflammatory cytokines in the hypoxic neonatal retina. J Pathol. 2011;224(2):245–60. doi:10.1002/path.2858.PubMedCrossRef

47.

Gyoneva S, Davalos D, Biswas D, Swanger SA, Garnier-Amblard E, Loth F, et al. Systemic inflammation regulates microglial responses to tissue damage in vivo. Glia. 2014;62(8):1345–60. doi:10.1002/glia.22686.PubMedCrossRef

48.

Ahmad S, Fatteh N, El-Sherbiny NM, Naime M, Ibrahim AS, El-Sherbini AM, et al. Potential role of A2A adenosine receptor in traumatic optic neuropathy. J Neuroimmunol. 2013;264(1-2):54–4. doi:10.1016/j.jneuroim.2013.09.015.PubMedCrossRef

49.

Ibrahim AS, El-Shishtawy MM, Zhang W, Caldwell RB, Liou GI. A_2A adenosine receptor (A2AR) as a therapeutic target in diabetic retinopathy. Am J Pathol. 2011;178(5):2136–45. doi:10.1016/j.ajpath.2011.01.018.PubMedCentralPubMedCrossRef

50.

Ibrahim AS, El-Remessy AB, Matragoon S, Zhang W, Patel Y, Khan S, et al. Retinal microglial activation and inflammation induced by amadori-glycated albumin in a rat model of diabetes. Diabetes. 2011;60:1122–33. doi:10.2337/db10-1160/-/DC1.PubMedCentralPubMedCrossRef

51.

Johnson TV, Martin KR. Development and characterization of an adult retinal explant organotypic tissue culture system as an in vitro intraocular stem cell transplantation model. Invest Ophthalmol Vis Sci. 2008;49(8):3503–12. doi:10.1167/iovs.07-1601.PubMedCrossRef

52.

Ferrer-Martin RM, Martin-Oliva D, Sierra A, Carrasco MC, Martin-Estebane M, Calvente R. Microglial cells in organotypic cultures of developing and adult mouse retina and their relationship with cell death. Exp Eye Res. 2014;121:42–57. doi:10.1016/j.exer.2014.02.015.PubMedCrossRef

53.

Dai SS, Zhou YG, Li W, An JH, Li P, Yang N, et al. Adenosine A_2A receptor regulation of neuroinflammation and traumatic brain injury. J Neurosci. 2010;30(16):5802–10. doi:10.1523/jneurosci.0268-10.2010.PubMedCentralPubMedCrossRef

54.

Halldner L, Lopes LV, Dare E, Lindstrom K, Johansson B, Ledent C, et al. Binding of adenosine receptor ligands to brain of adenosine receptor knock-out mice: evidence that CGS 21680 binds to A₁ receptors in hippocampus. Naunyn-Schmiedeberg’s Arch Pharmacol. 2004;370(4):270–8. doi:10.1007/s00210-004-0970-1.CrossRef

55.

Casado V, Barrondo S, Spasic M, Callado LF, Mallol J, Canela E, et al. Gi protein coupling to adenosine A₁-A_2A receptor heteromers in human brain caudate nucleus. J Neurochem. 2010;114(4):972–80. doi:10.1111/j.1471-4159.2010.06810.x.PubMed

56.

Fredholm BB, Ijzerman AP, Jacobson KA, Linden J, Muller CE. International Union of Basic and Clinical Pharmacology. LXXXI. Nomenclature and classification of adenosine receptors—an update. Pharmacol Rev. 2011;63(1):1–34. doi:10.1124/pr.110.003285.PubMedCentralPubMedCrossRef

57.

Blum D, Galas MC, Pintor A, Brouillet E, Ledent C, Muller CE, et al. A dual role of adenosine A_2A receptors in 3-nitropropionic acid-induced striatal lesions: implications for the neuroprotective potential of A_2A antagonists. J Neurosci. 2003;23(12):5361–9.PubMed

58.

Li W, Dai S, An J, Li P, Chen X, Xiong R, et al. Chronic but not acute treatment with caffeine attenuates traumatic brain injury in the mouse cortical impact model. Neuroscience. 2008;151(4):1198–07. doi:10.1016/j.neuroscience.2007.11.020.PubMedCrossRef

59.

Silva CG, Porciuncula LO, Canas PM, Oliveira CR, Cunha RA. Blockade of adenosine A(2A) receptors prevents staurosporine-induced apoptosis of rat hippocampal neurons. Neurobiol Dis. 2007;27(2):182–9. doi:10.1016/j.nbd.2007.04.018.PubMedCrossRef

60.

Canas PM, Porciuncula LO, Cunha GMA, Silva CG, Machado NJ, Oliveira JMA, et al. Adenosine A_2A receptor blockade prevents synaptotoxicity and memory dysfunction caused by β-Amyloid peptides via p38 mitogen-activated protein kinase pathway. J Neurosci. 2009;29(47):14741–51. doi:10.1523/jneurosci.3728-09.2009.PubMedCrossRef

61.

Simões A, Duarte JA, Agasse F, Canas P, Tomé AR, Agostinho P, et al. Blockade of adenosine A_2A receptors prevents interleukin-1β-induced exacerbation of neuronal toxicity through a p38 mitogen-activated protein kinase pathway. J Neuroinflamm. 2012;9(1):204. doi:10.1186/1742-2094-9-204.CrossRef

62.

Ferreira JM, Paes-de-Carvalho R. Long-term activation of adenosine A_2A receptors blocks glutamate excitotoxicity in cultures of avian retinal neurons. Brain Res. 2001;900:169–76.PubMedCrossRef

63.

Rebola N, Rodrigues RJ, Oliveira CR, Cunha RA. Different roles of adenosine A₁, A_2A and A₃ receptors in controlling kainate-induced toxicity in cortical cultured neurons. Neurochem Int. 2005;47(5):317–25. doi:10.1016/j.neuint.2005.05.009.PubMedCrossRef

64.

Silva CG, Metin C, Fazeli W, Machado NJ, Darmopil S, Launay PS, et al. Adenosine receptor antagonists including caffeine alter fetal brain development in mice. Science Transl Med. 2013;5(197):12. doi:10.1126/scitranslmed.3006258. 197ra04.CrossRef

65.

Xia J, Lim JC, Lu W, Beckel JM, Macarak EJ, Laties AM, et al. Neurons respond directly to mechanical deformation with pannexin-mediated ATP release and autostimulation of P2X7 receptors. J Physiol. 2012;590(Pt 10):2285–304. doi:10.1113/jphysiol.2012.227983.PubMedCentralPubMedCrossRef

66.

Imura Y, Morizawa Y, Komatsu R, Shibata K, Shinozaki Y, Kasai H, et al. Microglia release ATP by exocytosis. Glia. 2013;61(8):1320–30. doi:10.1002/glia.22517.PubMedCrossRef

67.

Newman EA. Glial cell inhibition of neurons by release of ATP. J Neurosci. 2003;23(5):1659–66.PubMedCentralPubMed

68.

Beckel JM, Argall AJ, Lim JC, Xia J, Lu W, Coffey EE, et al. Mechanosensitive release of adenosine 5′-triphosphate through pannexin channels and mechanosensitive upregulation of pannexin channels in optic nerve head astrocytes: a mechanism for purinergic involvement in chronic strain. Glia. 2014;62(9):1486–501. doi:10.1002/glia.22695.PubMedCrossRef

69.

Reigada D, Lu W, Zhang M, Mitchell CH. Elevated pressure triggers a physiological release of ATP from the retina: possible role for pannexin hemichannels. Neuroscience. 2008;157(2):396–404. doi:10.1016/j.neuroscience.2008.08.036.PubMedCentralPubMedCrossRef

70.

Resta V, Novelli E, Vozzi G, Scarpa C, Caleo M, Ahluwalia A, et al. Acute retinal ganglion cell injury caused by intraocular pressure spikes is mediated by endogenous extracellular ATP. Eur J Neurosci. 2007;25(9):2741–54. doi:10.1111/j.1460-9568.2007.05528.x.PubMedCrossRef

71.

Zhang X, Li A, Ge J, Reigada D, Laties AM, Mitchell CH. Acute increase of intraocular pressure releases ATP into the anterior chamber. Exp Eye Res. 2007;85(5):637–43. doi:10.1016/j.exer.2007.07.016.PubMedCrossRef

72.

Li A, Zhang X, Zheng D, Ge J, Laties AM, Mitchell CH. Sustained elevation of extracellular ATP in aqueous humor from humans with primary chronic angle-closure glaucoma. Exp Eye Res. 2011;93(4):528–33. doi:10.1016/j.exer.2011.06.020.PubMedCentralPubMedCrossRef

73.

Rodrigues R, Tomé A, Cunha R. ATP as a multi-target danger signal in the brain. Front Neurosci. 2015;9:148. doi:10.3389/fnins.2015.00148.PubMedCentralPubMedCrossRef

74.

Hu H, Lu W, Zhang M, Zhang X, Argall AJ, Patel S, et al. Stimulation of the P2X7 receptor kills rat retinal ganglion cells in vivo. Exp Eye Res. 2010;91(3):425–32. doi:10.1016/j.exer.2010.06.017.PubMedCentralPubMedCrossRef

75.

Niyadurupola N, Sidaway P, Ma N, Rhodes JD, Broadway DC, Sanderson J. P2X7 receptor activation mediates retinal ganglion cell death in a human retina model of ischemic neurodegeneration. Invest Ophthalmol Vis Sci. 2013;54(3):2163–70. doi:10.1167/iovs.12-10968.PubMedCrossRef

76.

Sugiyama T, Lee SY, Horie T, Oku H, Takai S, Tanioka H, et al. P2X(7) receptor activation may be involved in neuronal loss in the retinal ganglion cell layer after acute elevation of intraocular pressure in rats. Mol Vis. 2013;19:2080–91.PubMedCentralPubMed

77.

Rebola N, Lujan R, Cunha RA, Mulle C. Adenosine A_2A receptors are essential for long-term potentiation of NMDA-EPSCs at hippocampal mossy fiber synapses. Neuron. 2008;57(1):121–34. doi:10.1016/j.neuron.2007.11.023.PubMedCrossRef

78.

Cunha RA. Neuroprotection by adenosine in the brain: from A₁ receptor activation to A_2A receptor blockade. Purinergic Signalling. 2005;1:111–34.PubMedCentralPubMedCrossRef

79.

Gomes C, Ferreira R, George J, Sanches R, Rodrigues DI, Gonçalves N, et al. Activation of microglial cells triggers a release of brain-derived neurotrophic factor (BDNF) inducing their proliferation in an adenosine A_2A receptor-dependent manner: A_2A receptor blockade prevents BDNF release and proliferation of microglia. J Neuroinflammation. 2013;10(1):16. doi:10.1186/1742-2094-10-16.PubMedCentralPubMedCrossRef

80.

Santiago AR, Baptista FI, Santos PF, Cristovao G, Ambrosio AF, Cunha RA, et al. Role of microglia adenosine A_2A receptors in retinal and brain neurodegenerative diseases. Mediat Inflamm. 2014;2014:465694. doi:10.1155/2014/465694.

81.

Avila MY, Stone RA, Civan MM. A(1)-, A(2A)- and A(3)-subtype adenosine receptors modulate intraocular pressure in the mouse. Br J Pharmacol. 2001;134(2):241–5. doi:10.1038/sj.bjp.0704267.PubMedCentralPubMedCrossRef

Titel: Adenosine A2AR blockade prevents neuroinflammation-induced death of retinal ganglion cells caused by elevated pressure
verfasst von: Maria H. Madeira
Filipe Elvas
Raquel Boia
Francisco Q. Gonçalves
Rodrigo A. Cunha
António Francisco Ambrósio
Ana Raquel Santiago
Publikationsdatum: 01.12.2015
Verlag: BioMed Central
Erschienen in: Journal of Neuroinflammation / Ausgabe 1/2015
Elektronische ISSN: 1742-2094
DOI: https://doi.org/10.1186/s12974-015-0333-5

Neu in den Fachgebieten Neurologie und Psychiatrie

18.04.2024 | Arterielle Hypertonie | Nachrichten

Live-Webinar: Aktuelle Leitlinien bei Herz-Kreislauf-Erkrankungen

Springer Medizin

Adenosine A_2AR blockade prevents neuroinflammation-induced death of retinal ganglion cells caused by elevated pressure

Abstract

Background

Methods

Results

Conclusions

Competing interests

Authors’ contributions

Background

Materials and methods

Animals

Organotypic retinal cultures

Culture treatments

Immunohistochemistry

Image acquisition and densitometric analysis

Circularity index and skeleton analysis

ATP quantification

NO production assay

Quantitative real-time PCR

Enzyme-linked immunosorbent assay

Retinal ganglion cell counting

Statistical analysis

Results

LPS and EHP increased the expression of A_2AR in retinal microglial cells in the GCL

A_2AR blockade prevented the alterations of microglia morphology triggered by LPS or EHP

Blockade of A_2AR prevented microglia production of NO

A_2AR blockade mitigated the inflammatory response induced by LPS or EHP

A_2AR blockade prevented RGC death through the control of neuroinflammation

Discussion

Conclusions

Acknowledgments

Competing interests

Authors’ contributions

Neu in den Fachgebieten Neurologie und Psychiatrie

Antihypertensiva schützen auch alte Menschen noch vor Demenz

Fünf Dinge, die im Kindernotfall besser zu unterlassen sind

Delir kann Demenz begünstigen

Manche Gestagene können das Risiko für Meningeome erhöhen

Live-Webinar: Aktuelle Leitlinien bei Herz-Kreislauf-Erkrankungen

Springer Medizin

Abstract

Background

Methods

Results

Conclusions

Competing interests

Authors’ contributions

Background

Materials and methods

Animals

Organotypic retinal cultures

Culture treatments

Immunohistochemistry

Image acquisition and densitometric analysis

Circularity index and skeleton analysis

ATP quantification

NO production assay

Quantitative real-time PCR

Enzyme-linked immunosorbent assay

Retinal ganglion cell counting

Statistical analysis

Results

LPS and EHP increased the expression of A2AR in retinal microglial cells in the GCL

A2AR blockade prevented the alterations of microglia morphology triggered by LPS or EHP

Blockade of A2AR prevented microglia production of NO

A2AR blockade mitigated the inflammatory response induced by LPS or EHP

A2AR blockade prevented RGC death through the control of neuroinflammation

Discussion

Conclusions

Acknowledgments

Competing interests

Authors’ contributions

Weitere Artikel der Ausgabe 1/2015

NLRP1 inflammasome is activated in patients with medial temporal lobe epilepsy and contributes to neuronal pyroptosis in amygdala kindling-induced rat model

Leucine-rich repeat kinase 2 positively regulates inflammation and down-regulates NF-κB p50 signaling in cultured microglia cells

CCAAT/enhancer-binding protein δ (C/EBPδ) aggravates inflammation and bacterial dissemination during pneumococcal meningitis

Scutellarin regulates the Notch pathway and affects the migration and morphological transformation of activated microglia in experimentally induced cerebral ischemia in rats and in activated BV-2 microglia

Activation of the kynurenine pathway and increased production of the excitotoxin quinolinic acid following traumatic brain injury in humans

Sepsis-induced selective parvalbumin interneuron phenotype loss and cognitive impairments may be mediated by NADPH oxidase 2 activation in mice

Neu in den Fachgebieten Neurologie und Psychiatrie

Antihypertensiva schützen auch alte Menschen noch vor Demenz

Fünf Dinge, die im Kindernotfall besser zu unterlassen sind

Delir kann Demenz begünstigen

Manche Gestagene können das Risiko für Meningeome erhöhen

LPS and EHP increased the expression of A_2AR in retinal microglial cells in the GCL

A_2AR blockade prevented the alterations of microglia morphology triggered by LPS or EHP

Blockade of A_2AR prevented microglia production of NO

A_2AR blockade mitigated the inflammatory response induced by LPS or EHP

A_2AR blockade prevented RGC death through the control of neuroinflammation