Background
Gliomas are the most common primary tumors in the central nervous system (CNS), accounting for approximately 60 to 70% of primary brain tumors [
1]. Glioblastoma multiforme (GBM) represents the highest grade of malignancy. The current treatment for GBM relies on surgical resection followed by radiotherapy combined with chemotherapy. Unfortunately, these treatments have poor effects in GBM patients, and the median survival is only 12 months [
2]. Therefore, new therapeutic strategies are urgently needed. Molecular targeted therapy has become a hot topic in the study of the molecular mechanisms underlying GBM resistance [
3,
4]. However, the blood-brain barrier (BBB) restricts the application of many drugs. Thus, the identification of a drug that could act on new therapeutic targets and, more importantly, penetrate the BBB could benefit many GBM patients.
Recently, increasing attention has been paid to chronic inflammation, such meningitis-associated malignant brain tumor, which has been shown to increase the risk of cancer [
5‐
8]. The inflammatory microenvironment, which is a basic characteristic of malignant tumors, is involved in the modulation of the tumor viability, migration, invasion, and even inflammation [
9‐
11]. Therefore, strategies focused on inhibiting the inflammatory reaction using specific small molecule inhibitors could offer significant therapeutic value in the treatment of malignant tumors.
Cyclooxygenase 2 (COX-2) is associated with inflammatory diseases, carcinogenesis [
9,
12] and resistance to apoptosis [
13,
14], suggesting that COX-2 may play important roles by mediating the protective effects of inflammation. In addition, COX-2 is a target of non-steroidal anti-inflammatory drugs (NSAIDs), and its selective inhibitors could effectively prevent inflammation, proliferation and angiogenesis and induce apoptosis in human cancer cells. The overexpression of COX-2 has been found to be important in the development of several human tumor types, including gliomas [
15,
16], and has been associated with a high tumor aggressiveness and a poor prognosis in patients [
17,
18]. In intracranial tumors, the enhanced expression of COX-2 is correlated with the histopathological grade of the gliomas [
19]. Therefore, the inhibition of the expression of COX-2 might be an effective alternative approach for suppressing glioblastoma growth.
The expression of COX-2 is strictly and specifically controlled by the binding of many trans-factors, such as activator protein-2 (AP-2) and nuclear factor kappa B (NF-κB) [
20,
21], and certain transcriptional coactivators, such as p300 [
22,
23], to corresponding sites on its promoters. The activation of the NF-κB signaling pathway was involved in the overexpression of COX-2 [
24,
25]. Canonical NF-κB activation depends on the degradation of IκB, which is rapidly phosphorylated by an active IκB kinase (IKK) complex. This complex is composed of IKKα and IKKβ catalytic subunits and a regulatory subunit, i.e., IKKγ/NEMO (NF-κB essential modulator) [
26]. However, IKKβ is the major subunit that is responsible for the phosphorylation of the IκB proteins. The phosphorylated IκB subsequently undergoes proteasome-mediated degradation, thereby liberating free NF-κB dimers and allowing these dimers to translocate to the nucleus and promote gene transcription [
27]. Thus, the identification of small molecule inhibitors that selectively target IKKβ and an understanding of the mechanisms regulating the activation of NF-κB are essential.
Alantolactone (ATL), which is a natural sesquiterpene lactone, is largely distributed in the medical herb
Inula helenium and possesses a wide range of biological activities, such as antibacterial, antifungal, anti-inflammatory and hepatoprotective activities [
28], as detailed in the records of the China Pharmacopoeia and European Pharmacopoeia. ATL has a rapid onset and does not cause significant damage to normal animal tissues and organs [
29,
30]. The antitumor properties of ATL have been demonstrated in peripheral tumors, including lung cancer, liver cancer, colon cancer, and leukemia [
31‐
35]. However, to date, the detailed anti-cancer and anti-inflammatory mechanisms by which ATL exerts its effects have not been characterized. Furthermore, ATL, which is a small molecule of volatile oil compounds, is consistent with the traditional Chinese Medicine theory of “upward into the brain” and has a great potential to permeate the BBB.
In this study, we investigated whether ATL inhibits glioblastoma growth by suppressing the expression of COX-2 both in vitro and vivo. In addition, the molecular effects of ALT on glioblastomas was investigated by assessing the changes in the NF-κB signaling pathway. Furthermore, we also assessed ATL levels in the cerebrospinal fluid using a rat model, which confirmed that ATL was able to cross the BBB. Therefore, ATL has potential applications in the treatment of CNS tumors.
Methods
Transwell invasion assay
Cell invasion was analyzed using a Transwell assay [
36]. U87 and U251 cells were plated in 24-well Transwell plates. The upper surface of the polycarbonate filters was coated with Matrigel and incubated for 1 h at 37 °C for gelling. The cells (5 × 10 [
4]) were seeded into the upper chambers in FBS-free DMEM, and the bottom chambers were filled with 600 μL of DMEM with 10% FBS. Both the top and bottom chambers contained the same concentrations of ATL. After 24 h of incubation, the non-invasive cells on the upper membrane surfaces were removed by wiping with cotton swabs. The invading cells were fixed with methanol and stained with a 0.1% Crystal Violet staining solution. Images were taken under a Leica DM 14000B microscope. Cell invasion was counted in five independent areas per membrane. The results are represented as the means calculated from five replicates of each experiment.
Flow cytometry analysis
To determine the distribution of the cells in the cell cycle and the proportion of apoptotic cells, we performed flow cytometry analysis using a flow cytometer (BD FACS Accuri C6, CA, USA). After a 24 h treatment with ATL (0, 10 and 20 μM), the cells were collected, washed with PBS and fixed with ice-cold 70% ethanol at 4 °C for 4 h. The cells were stained with propidium iodide (PI) staining buffer (0.2% Triton X-100, 100 μg/mL DNase-free RNase A, and 50 μg/mL PI in PBS) in the dark for 30 min. For the apoptosis examination, the cells were washed with PBS, collected, and stained using the Annexin V-FITC Apoptosis Detection Kit in the dark at room temperature for 15 min. The cell cycle distribution and the fraction of apoptotic cells were determined using a FACS analysis system. Each experimentwas performed in triplicate.
Western blot analysis
The cell lysate proteins were separated by electrophoresis on a 7.5-12% SDS-PAGE and probed with specific antibodies. The protein bands were detected by enhanced chemiluminescence. The protein concentrations were determined using a BCA protein assay kit (Beyotime Biotechnology, China). Similar experiments were performed at least three times.
Reverse-transcriptase polymerase chain reaction (RT-PCR)
Total RNA was extracted from ATL-treated U87 and U251 cells using the TRIzol reagent, according to the kit protocol (TaKaRa Bio, Dalian, China). The cDNA was reverse-transcribed using the PrimeScript RT Reagent Kit (TaKaRa Bio, Dalian, China), according to the manufacturer’s instructions. The primer pairs were as follows: COX-2, Forward: 5′-TCACAGGCTTCCATTGACCAG-3 and Reverse: 5′-CCGAGGCTTTTCTA CCAGA-3′; β-actin, Forward: 5′-GGCACCCAGCACAATGAA-3′ and Reverse: 5′-TAGAAGCATTTGCGGTGG −3′. The amplification products were analyzed using a 1.5% agarose gel electrophoresis, stained with ethidium bromide, and photographed under ultraviolet light.
Confocal immunofluorescence
Briefly [
37], ATL-treated U87 cells were grown on chamber slides, fixed with 4% paraformaldehyde and permeabilized with 0.2% TritonX-100. The samples were probed with specific antibodies against Cytochrome c (cyt c), p300, p50 or p65 (Santa Cruz) and fluorescein isothiocyanate- and rhodamine-conjugated secondary antibodies Subsequently, the stained samples were mounted with 4′, 6-diamidino-2-phenylindole (DAPI) to counterstain the cell nuclei. After five additional 5-min washes, the samples were examined under a Leica DM 14000B confocal microscope.
Streptavidin-agarose pulldown assay to detect DNA protein binding
The binding assay was performed by mixing 400 μg of the nuclear extract proteins, 4 μg of the biotinylated DNA probe and 40 μl of 4% streptavidin-conjugated agarose beads at RT for 5 h in a rotating shaker. The beads were centrifuged, resuspended with the SDS-PAGE loading buffer and boiled at 95 °C. The supernatant was analyzed by Western blotting.
Chromatin immunoprecipitation (ChIP)
The ChIP assay was performed as previously described [
37]. The specific COX-2 promoter primers were as follows: forward primer: ACGTGACTTCCTCGACCCTC, and reverse primer: AAGACTGAAAA CCAAGCCCA). The resulting 478 bp product of COX-2 was separated by 1.5% agarose gel electrophoresis.
IKKβ kinase activity assay in vitro
ATL-mediated inhibition of IKKβ kinase activity was assessed in vitro using a cell IKKβ kinase activity spectrophotometry quantitative detection kit. Briefly, ALT-treated U87 cells were harvested and lysed with the lysate in the kit. After the protein was quantified, 10 μl of the sample solution (containing 50 μg of protein) was mixed with the reaction solution in the kit. The total activity and nonspecific activity were measured using a microplate reader. The data were evaluated according to the formula in the manual, and the specific activity value was calculated (specific activity = total activity - nonspecific activity).
Molecular modeling
Docking studies were performed to explore the potential binding mode between ATL and the IKKβ protein complex. ATL was optimized using the semi-empirical PM3 method with the Polak-Ribie’re conjugate gradient algorithm and an RMS gradient of 0.01 kcal mol − 1 Å − 1 as the convergence criterion. The optimized structure of ATL was docked to the active site of IKKβ with ligand K-252A (PDB Code: 4KIK). The crystallographic ligand was extracted from the active site, and the residues within a 6.5 A° radius around the IKKβ molecule were defined as the active pocket. The SurflexDock program was used for the docking calculations with the default parameters. MOLCAD surfaces were generated to visualize the binding mode of the docked protein–ligand complexes.
Animal studies
Male nude mice (BALB/c nu/nu, 4 weeks old, 18–19 g) were purchased from the SPF Laboratory Animal Center of Dalian Medical University (Dalian, China). Briefly, 1 × 10
7 U87 cells were injected subcutaneously near the axillary fossa of the nude mice. The tumor cell–inoculated mice were randomly divided into the following three treatment groups with five mice in each group: group A was treated with propylene glycol; group B was treated with 10 mg/kg ATL; and group C was treated with 20 mg/kg ATL; all treatments were delivered by daily intraperitoneal injections. The tumors were measured using a caliper every 2 days, and the tumor volume was calculated according to the formula V = 1/2 (width [
2]× length). The body weights were also recorded. After treatment with ATL for 15 days, all experimental mice were terminated with ether anesthesia, and the total weight of the tumors in each mouse was measured. To determine the expression of COX-2 and p65 NF-κB, the tumor tissues were fixed with 10% neutral formalin and embedded in paraffin. The sections (4 μm) were stained with the COX-2 antibody (1:50) and the p-p65 NF-κB (1:50) antibody and examined under a light microscope. The images were examined under a Leica DM 4000B microscope equipped with a digital camera.
All animals were given free access to sterilized food and water and were habituated for 7 days before the experiments. All procedures were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (National Institutes of Health, Bethesda, MD, USA). The protocol was approved by the Animal Care and Ethics Committee of Dalian Medical University.
Detection of ATL through the BBB
Six male adult SD rats (200-220 g) were intraperitoneally injected with ATL; after 1 h, the rats were anesthetized with 4% chloral hydrate. Cerebrospinal fluid (50-100 μl) was collected from the cerebellomedullary cistern by puncturing the foramen magnum. Then, the cerebrospinal fluid was extracted twice using an equal volume of acetonitrile. The supernatant was dried in a nitrogen blowing instrument and reconstituted in 50 μl mobile phase (acetonitrile: pure water = 45:55). Finally, the reconstituted sample and ATL standard solution were analyzed by LC-MS/MS.
Statistical analysis
The data are represented as the mean ± SD of at least three independent experiments. An analysis of variance and Student’s t-test were used to compare the values of the test and control samples in vitro and in vivo. P < 0.05 was considered statistically significant. SPSS 18.0 software was used for all statistical analyses.
Discussion
GBM is the most refractory and palindromic CNS neoplasm. The main reasons for the poor clinical treatment effect in GBM are as follows: A. rapid proliferation; B. infiltrative growth; C. and the BBB. Therefore, it is essential to discover novel targeted therapeutic agents. In this study, we found that the natural sesquiterpene lactone compound ATL inhibited glioblastoma cell growth, and we explored the mechanism underlying its anti-tumor effects.
ATL, which is isolated from the Chinese herb
Inula helenium, possesses multiple pharmacological activities, and its anti-tumor activity is highly attractive [
32,
46,
47]; however, the pivotal molecules targeted by ATL remain unclear. In this study, we uncovered one anti-tumor mechanism by which ATL inhibited glioblastoma cell growth and induced cell apoptosis by inhibiting the NF-κB/COX-2 signaling pathway and activating the cyt c/caspase-dependent apoptotic pathway. Furthermore, ATL acted as an inhibitor of IKKβ activity by targeting the ATP-binding site to suppress COX-2 expression in glioblastoma cells.
The expression of COX-2 is positively correlated with the degree of malignancy in the glioma and is negatively correlated with the prognosis. In this study, ATL significantly inhibited COX-2 expression at both the protein and mRNA levels. We selected celecoxib (CB) as a positive drug treatment because CB is a classical and potent commercial COX-2 inhibitor. The combination of CB and ATL did not further alter cell viability; thus, we think that ATL suppressed growth by partially inactivating COX-2 signaling. Moreover, the cell viability IC50 values after ATL treatment in U87 and U251 cells were 20.24 and 16.33 μM, which were significantly lower than those of CB (135.27 and 120.32 μM). Thus, ATL, which is a natural small molecule inhibitor, is comparable to CB but is more effective, safe and affordable.
The transcription factor NF-κB, which is a cis-acting element of the COX-2 transcriptional regulatory sequence, is involved in the regulation of a variety of inflammatory mediators. Activated NF-κB binds the COX-2 promoter region and initiates COX-2 transcription. During the activation of NF-κB, the transcription coactivator p300 can bind the NF-κB p65/p50 dimer by acetylation and thus enhance the transcriptional activity of COX-2. Our study demonstrated that ATL could inhibit the nuclear translocation of the NF-κB p65/p50 dimer, decrease the recruitment of p300, and thus suppress their binding to the COX-2 promoter region, thereby blocking COX-2 transcriptional activity and down-regulating the expression of COX-2.
The IKKs are key regulators in the NF-κB signaling pathway, and we demonstrated that ATL could specifically inhibit IKKβ enzyme activity via an in vitro kinase assay. Furthermore, computational docking analysis suggested that ATL occupied the entrance hydrophobic pocket in the ATP-binding site of IKKβ. In this modeling analysis, ATL was located well in the ATP binding site and interacted with residue Lys147 at the entrance of the ATP-binding pocket. Our results suggested that ATL might block the nucleotide recognition domain binding with ATP as a reversible inhibitor. These findings are consistent with our experimental results. Hydrophobic interactions should be emphasized because the ATP binding pocket is a narrow and hydrophobic region. ATL may attenuate the transcriptional activity of NF-κB at least in part by abrogating the activity of IKKβ.
Infiltrative growth is another major cause of refractory GBM. Migration and invasion are two important prerequisites for infiltrative growth, and degradation of the extracellular matrix is a key step. MMP-2 and MMP-9 are gelatinases that are important members of the MMP family, which plays a significant role in breaking through the extracellular matrix of cells [
48]. MMP-2 and MMP-9 are negatively correlated with the prognosis of glioma patients [
49]. Intriguingly, our study illustrated that ATL could inhibit the migration and invasion of GBM cells and significantly decrease MMP-2 and MMP-9. As MMP protein is expressed in tumor cells and blood vessels, and angiogenesis is an important link in the invasion and metastasis of malignant tumors, the inhibitory properties of ATL implies that metastasis and invasion may be another target for ATL to suppress tumor growth or angiogenesis, and the underlying mechanism requires further investigation.
Furthermore, the BBB is a major limitation that reduces the efficacy of anti-cancer drugs in the treatment of GBM patients [
50]. Studies have confirmed that the cerebrospinal fluid brain barrier is one of the most imperfect barriers in the BBB and can allow cerebrospinal fluid and the extracellular fluid of brain tissue to communicate with each other [
45]. Therefore, once a substance enters the cerebrospinal fluid from the blood, it can freely diffuse into the brain tissue; thus, we can detect the drug content in the cerebrospinal fluid, which is an important method for evaluating drug entry into the brain tissue [
51]. In our study, ATL was detected by LC-MS/MS analysis in cerebrospinal fluid collected from living rats. Thus, ATL could pass through the BBB, which fulfilled a prerequisite for ATL in the treatment of CNS diseases.
Acknowledgements
We thank the NSFC (81372714, 81672480, 81622047 and 81473334), Liaoning Provincial Natural Science Foundation of China (No. 201602244), Dalian Outstanding Youth Science and Technology Talent (2015J12JH201), Distinguished Professor Project of Liaoning Province, Special Grant for Translational Medicine, Dalian Medical University (No. 2015002), Distinguished professor of Liaoning Province, Project sponsored by Liaoning BaiQianWan Talents Program and Innovation Team of Dalian Medical University for financial support.