Background
Methods
Ethics statement
Clinical specimen collection
Construction of a smRNA library and next-generation sequencing (NGS)
Data analyses and novel miRNA exploration
Bioinformatic analyses for miRNAs with differential expression patterns
QRT-PCR verification for altered miRNA expression
Results
Histopathological characteristics of post-cryptorchidopexy testicular tissue and control tissue
Comprehensive overview of whole genome smRNAs in cryptorchid and normal tissues
Features of the most abundant miRNAs in cryptorchid and normal tissues
miRNA name | Cryptorchid | miRNA name | Control | ||
---|---|---|---|---|---|
Reads count | Normalized reads count | Reads count | Normalized reads count | ||
hsa-miR-514a-3p | 2,313,282 | 109,499 | hsa-miR-514a-3p | 1,008,914 | 98,435 |
hsa-miR-143-3p | 864,140 | 45,306 | hsa-miR-143-3p | 677,433 | 65,245 |
hsa-miR-26a-5p | 829,953 | 46,035 | hsa-miR-26a-5p | 407,763 | 39,613 |
hsa-miR-99a-5p | 705,575 | 38,041 | hsa-miR-509-3-5p | 392,074 | 37,711 |
hsa-miR-202-5p | 616,580 | 30,770 | hsa-miR-99a-5p | 346,310 | 33,871 |
hsa-miR-509-3-5p | 593,363 | 28,054 | hsa-miR-202-5p | 258,855 | 25,790 |
hsa-miR-10b-5p | 428,806 | 24,984 | hsa-miR-10b-5p | 248,352 | 24,218 |
hsa-miR-508-3p | 303,445 | 14,625 | hsa-let-7f-5p | 154,806 | 15,116 |
hsa-let-7 g-5p | 296,741 | 15,472 | hsa-miR-508-3p | 153,631 | 15,059 |
hsa-let-7f-5p | 266,118 | 14,707 | hsa-let-7 g-5p | 151,745 | 14,851 |
hsa-let-7a-5p | 265,013 | 14,644 | hsa-let-7a-5p | 137,886 | 13,412 |
hsa-miR-21-5p | 248,959 | 12,378 | hsa-miR-21-5p | 132,197 | 12,931 |
hsa-miR-509-5p | 194,212 | 9293 | hsa-miR-148a-3p | 119,576 | 11,671 |
hsa-miR-148a-3p | 188,828 | 10,645 | hsa-miR-100-5p | 103,191 | 10,071 |
hsa-miR-125b-5p | 172,432 | 9013 | hsa-miR-125b-5p | 93,627 | 9134 |
hsa-miR-100-5p | 169,375 | 9160 | hsa-miR-27b-3p | 92,637 | 8927 |
hsa-miR-199a-3p | 154,971 | 8592 | hsa-miR-509-5p | 81,898 | 8124 |
hsa-miR-27b-3p | 144,132 | 7610 | hsa-miR-126-3p | 79,980 | 7687 |
hsa-let-7i-5p | 140,689 | 7772 | hsa-miR-125a-5p | 72,130 | 7013 |
hsa-let-7b-5p | 112,327 | 6040 | hsa-miR-34c-5p | 69,568 | 6885 |
hsa-miR-125a-5p | 107,449 | 5594 | hsa-let-7i-5p | 66,915 | 6560 |
Cryptorchid tissues | |||
---|---|---|---|
miRNA ID | Mature Sequence | Reads count | Location of novel miRNA precusor |
chrX_47246 | AUUGACACUUCUGUGAGUAGA | 2,280,438 | chrX:146366172..146366230:- |
chr12_27425 | UUCAAGUAAUCCAGGAUAGGCU | 826,714 | chr12:58218403..58218462:- |
chr3_5958 | UUCAAGUAAUCCAGGAUAGGCU | 826,558 | chr3:38010903..38010964:+ |
chr21_44054 | AACCCGUAGAUCCGAUCUUGU | 693,017 | chr21:17911420..17911480:+ |
chrX_47235 | UACUGCAGACGUGGCAAUCAUG | 592,879 | chrX:146341178..146341235:- |
chr10_23103 | UUCCUAUGCAUAUACUUCUUU | 586,995 | chr10:135061041..135061097:- |
chr5_9937 | UGAGAUGAAGCACUGUAGCUC | 534,462 | chr5:148808506..148808561:+ |
chr2_3766 | UACCCUGUAGAACCGAAUUUGU | 428,617 | chr2:177015056..177015117:+ |
chrX_47228 | UGAUUGUAGCCUUUUGGAGUAGA | 298,225 | chrX:146318462..146318520:- |
chr3_7283 | UGAGGUAGUAGUUUGUACAGUU | 295,643 | chr3:52302295..52302373:- |
Normal tissues | |||
miRNA ID | Mature Sequence | Reads count | Location of novel miRNA precusor |
chrX_47246 | AUUGACACUUCUGUGAGUAGA | 996,346 | chrX:146366172..146366230:- |
chr5_9937 | UGAGAUGAAGCACUGUAGCUC | 419,103 | chr5:148808506..148808561:+ |
chr12_27425 | UUCAAGUAAUCCAGGAUAGGCU | 405,817 | chr12:58218403..58218462:- |
chr3_5958 | UUCAAGUAAUCCAGGAUAGGCU | 405,621 | chr3:38010903..38010964:+ |
chrX_47235 | UACUGCAGACGUGGCAAUCAUG | 391,755 | chrX:146341178..146341235:- |
chr21_44054 | AACCCGUAGAUCCGAUCUUGU | 340,009 | chr21:17911420..17911480:+ |
chr2_3766 | UACCCUGUAGAACCGAAUUUGU | 248,236 | chr2:177015056..177015117:+ |
chr10_23103 | UUCCUAUGCAUAUACUUCUUU | 246,558 | chr10:135061041..135061097:- |
chr9_18744 | UGAGGUAGUAGAUUGUAUAGUU | 154,925 | chr9:96938634..96938712:+ |
chr3_7283 | UGAGGUAGUAGUUUGUACAGUU | 151,154 | chr3:52302295..52302373:- |
Differential expression of miRNAs between cryptorchid and normal tissues
MiRNA name | baseMean | log2FoldChange | lfcSE | stat | p | Adjust p |
---|---|---|---|---|---|---|
hsa-miR-3663-5p | 41.936 | −4.426 | 0.624 | −7.089 | 1.35E-12 | 2.39E-10 |
hsa-miR-1233-3p | 25.216 | −4.227 | 0.679 | −6.225 | 4.79E-10 | 1.84E-08 |
hsa-miR-552-5p | 66.556 | −4.055 | 0.563 | −7.195 | 6.24E-13 | 1.21E-10 |
hsa-miR-449b-5p | 392.523 | −3.972 | 0.496 | −8.001 | 1.23E-15 | 5.26E-13 |
hsa-miR-7153-5p | 108.897 | − 3.812 | 0.634 | −6.010 | 1.84E-09 | 5.18E-08 |
hsa-miR-122-5p | 525.785 | −3.790 | 0.562 | −6.741 | 1.57E-11 | 1.60E-09 |
hsa-miR-552-3p | 65.189 | −3.760 | 0.562 | −6.680 | 2.38E-11 | 2.31E-09 |
hsa-miR-449a | 5575.001 | −3.740 | 0.511 | −7.317 | 2.52E-13 | 5.97E-11 |
hsa-miR-122-3p | 4.738 | −3.722 | 1.011 | −3.679 | 0.00023 | 0.0016 |
hsa-miR-34b-5p | 123.524 | −3.688 | 0.558 | −6.610 | 3.84E-11 | 3.56E-09 |
hsa-miR-449c-5p | 2234.173 | −3.637 | 0.465 | −7.816 | 5.42E-15 | 1.93E-12 |
hsa-miR-34c-5p | 39,328.272 | −3.553 | 0.440 | −8.060 | 7.58E-16 | 5.26E-13 |
hsa-miR-449c-3p | 7.961 | −3.441 | 0.902 | −3.812 | 0.00014 | 0.0011 |
hsa-miR-375 | 491.449 | −3.408 | 0.362 | −9.416 | 4.68E-21 | 9.99E-18 |
hsa-miR-3663-3p | 37.612 | −3.385 | 0.676 | −5.001 | 5.68E-07 | 9.63E-06 |
hsa-miR-7159-5p | 20.897 | −3.259 | 0.705 | −4.618 | 3.87E-06 | 5.29E-05 |
hsa-miR-449b-3p | 142.460 | −3.212 | 0.610 | −5.262 | 1.42E-07 | 2.75E-06 |
hsa-miR-4700-5p | 4.985 | −3.208 | 0.951 | −3.370 | 0.00075 | 0.0043 |
hsa-miR-522-3p | 121.036 | −3.153 | 0.465 | −6.768 | 1.30E-11 | 1.46E-09 |
hsa-miR-1273a | 38.566 | −3.118 | 0.508 | −6.135 | 8.47E-10 | 2.44E-08 |
hsa-miR-1295a | 11.735 | −3.075 | 0.760 | −4.041 | 5.31E-05 | 0.0005 |
hsa-miR-34b-3p | 1137.731 | −2.970 | 0.516 | −5.753 | 8.72E-09 | 2.16E-07 |
hsa-miR-1283 | 139.436 | −2.798 | 0.488 | −5.731 | 9.95E-09 | 2.41E-07 |
hsa-miR-3150b-3p | 3.547 | −2.768 | 0.991 | −2.791 | 0.0052 | 0.020 |
hsa-miR-4423-3p | 16.582 | −2.702 | 0.755 | −3.578 | 0.00035 | 0.0023 |
hsa-miR-6507-5p | 7.696 | −2.698 | 0.811 | −3.325 | 0.00088 | 0.0049 |
hsa-miR-7154-5p | 406.827 | −2.646 | 0.981 | −2.697 | 0.0070 | 0.025 |
hsa-miR-517c-3p | 95.074 | −2.639 | 0.386 | −6.832 | 8.37E-12 | 9.92E-10 |
hsa-miR-3925-3p | 10.324 | −2.613 | 0.735 | −3.553 | 0.00038 | 0.0025 |
hsa-miR-515-5p | 84.007 | −2.600 | 0.379 | −6.856 | 7.04E-12 | 8.84E-10 |
MiRNA name | baseMean | log2FoldChange | lfcSE | stat | p | Adjust p |
---|---|---|---|---|---|---|
hsa-miR-7151-3p | 6.026 | 2.634 | 0.892 | 2.953 | 0.0031 | 0.014 |
hsa-miR-376a-2-5p | 10.918 | 2.202 | 0.724 | 3.042 | 0.0023 | 0.011 |
hsa-miR-1224-5p | 17.708 | 2.193 | 0.615 | 3.565 | 0.00036 | 0.0024 |
hsa-miR-1299 | 187.854 | 1.958 | 0.426 | 4.600 | 4.22E-06 | 5.73E-05 |
hsa-miR-142-5p | 697.547 | 1.898 | 0.583 | 3.255 | 0.0011 | 0.0060 |
hsa-miR-543 | 1281.559 | 1.869 | 0.450 | 4.152 | 3.29E-05 | 0.00036 |
hsa-miR-487a-3p | 80.564 | 1.865 | 0.591 | 3.155 | 0.0016 | 0.0079 |
hsa-miR-584-3p | 19.666 | 1.829 | 0.562 | 3.254 | 0.0011 | 0.0060 |
hsa-miR-665 | 18.416 | 1.798 | 0.710 | 2.534 | 0.011 | 0.036 |
hsa-miR-134-3p | 29.541 | 1.778 | 0.598 | 2.975 | 0.0029 | 0.013 |
hsa-miR-369-3p | 500.851 | 1.692 | 0.432 | 3.916 | 8.99E-05 | 0.00082 |
hsa-miR-377-3p | 96.245 | 1.665 | 0.551 | 3.023 | 0.0025 | 0.011 |
hsa-miR-33a-5p | 28.103 | 1.664 | 0.550 | 3.025 | 0.0025 | 0.011 |
hsa-miR-376a-3p | 112.0733 | 1.602 | 0.436 | 3.704 | 0.00021 | 0.0015 |
hsa-miR-758-3p | 520.1303 | 1.589 | 0.439 | 3.620 | 0.00029 | 0.0020 |
hsa-miR-654-3p | 4175.568 | 1.587 | 0.388 | 4.095 | 4.22E-05 | 0.00044 |
hsa-miR-134-5p | 2747.859 | 1.558 | 0.424 | 3.675 | 0.00024 | 0.0017 |
hsa-miR-889-3p | 740.3619 | 1.552 | 0.468 | 3.312 | 0.00093 | 0.0052 |
hsa-miR-127-3p | 40,871.646 | 1.548 | 0.392 | 3.955 | 7.65E-05 | 0.00071 |
hsa-miR-1185-1-3p | 161.457 | 1.539 | 0.506 | 3.039 | 0.0024 | 0.011 |
hsa-miR-1185-2-3p | 38.541 | 1.534 | 0.587 | 2.614 | 0.0089 | 0.030 |
hsa-miR-154-5p | 267.267 | 1.516 | 0.346 | 4.385 | 1.16E-05 | 0.00014 |
hsa-miR-381-3p | 7512.422 | 1.511 | 0.382 | 3.957 | 7.57E-05 | 0.00070 |
hsa-miR-127-5p | 768.176 | 1.511 | 0.401 | 3.765 | 0.00017 | 0.0013 |
hsa-miR-337-5p | 44.570 | 1.510 | 0.439 | 3.437 | 0.00059 | 0.0036 |
hsa-miR-379-3p | 262.022 | 1.508 | 0.401 | 3.756 | 0.00017 | 0.0013 |
hsa-miR-136-3p | 937.135 | 1.506 | 0.389 | 3.868 | 0.00011 | 0.00096 |
hsa-miR-376c-3p | 327.216 | 1.492 | 0.402 | 3.713 | 0.00020 | 0.0015 |
hsa-miR-495-3p | 884.797 | 1.443 | 0.390 | 3.696 | 0.00022 | 0.0016 |
hsa-miR-376b-5p | 24.828 | 1.442 | 0.590 | 2.445 | 0.014 | 0.045 |
Validating the altered expression level of miRNAs by qRT-PCR
GO enrichment analysis of differentially-expressed genes in cryptorchid and normal tissues
GO number | Term* | GO process | Ratio in study | Ratio in pop | p |
---|---|---|---|---|---|
GO:0007165 | BP | signal transduction | 19.68% | 23.63% | 1.04E-05 |
GO:0002250 | BP | adaptive immune response | 0.70% | 1.83% | 1.56E-05 |
GO:0050789 | BP | regulation of biological process | 47.95% | 52.34% | 4.14E-05 |
GO:0050794 | BP | regulation of cellular process | 45.10% | 49.34% | 7.66E-05 |
GO:0008150 | BP | biological_process | 78.42% | 81.73% | 8.25E-05 |
GO:0065007 | BP | biological regulation | 51.05% | 55.25% | 8.51E-05 |
GO:0006956 | BP | complement activation | 0.25% | 0.98% | 0.000114 |
GO:0006958 | BP | complement activation, classical pathway | 0.20% | 0.88% | 0.000134 |
GO:0048518 | BP | positive regulation of biological process | 21.53% | 25.03% | 0.00014 |
GO:0050776 | BP | regulation of immune response | 3.95% | 5.72% | 0.000229 |
GO:0044425 | CC | membrane part | 28.37% | 34.86% | 1.03E-10 |
GO:0005886 | CC | plasma membrane | 17.68% | 23.38% | 1.11E-10 |
GO:0031224 | CC | intrinsic component of membrane | 23.23% | 29.30% | 2.06E-10 |
GO:0016021 | CC | integral component of membrane | 22.68% | 28.69% | 2.24E-10 |
GO:0005575 | CC | cellular_component | 84.22% | 88.01% | 1.38E-07 |
GO:0005794 | CC | Golgi apparatus | 3.35% | 5.84% | 1.42E-07 |
GO:0005840 | CC | ribosome | 2.20% | 1.09% | 7.38E-06 |
GO:0000139 | CC | Golgi membrane | 1.85% | 3.41% | 1.92E-05 |
GO:0044459 | CC | plasma membrane part | 9.84% | 12.81% | 1.93E-05 |
GO:0004872 | MF | receptor activity | 5.39% | 8.48% | 5.53E-08 |
GO:0060089 | MF | molecular transducer activity | 5.39% | 8.48% | 5.53E-08 |
GO:0005179 | MF | hormone activity | 1.55% | 0.54% | 6.49E-08 |
GO:0004871 | MF | signal transducer activity | 5.79% | 8.78% | 2.25E-07 |
GO:0038023 | MF | signaling receptor activity | 4.45% | 7.13% | 3.21E-07 |
GO:0099600 | MF | transmembrane receptor activity | 4.25% | 6.85% | 4.09E-07 |
GO:0003823 | MF | antigen binding | 0.50% | 1.75% | 4.18E-07 |
GO:0004888 | MF | transmembrane signaling receptor activity | 4.15% | 6.63% | 9.33E-07 |
GO:0032553 | MF | ribonucleotide binding | 6.34% | 8.94% | 1.10E-05 |
GO:0003674 | MF | molecular_function | 77.82% | 81.17% | 7.79E-05 |
KEGG pathway analysis of differentially-expressed genes in cryptorchid and normal tissues
Pathway ID | Description | GeneRatio | BgRatio | p | Adjust p | GeneName |
---|---|---|---|---|---|---|
hsa00190 | Oxidative phosphorylation | 28/664 | 133/7297 | 1.80E-05 | 0.0053 | ATP5G2;COX6C;SDHD;COX7A2L; COX8C;ATP6V1D |
hsa05012 | Parkinson’s disease | 28/664 | 142/7297 | 6.29E-05 | 0.0093 | ATP5G2;COX6C;SDHD;UBB;UBE2L6;COX7A2L;GNAL;COX8C |
hsa03010 | Ribosome | 29/664 | 154/7297 | 0.0001112 | 0.0110 | MRPL16;RPL38;RPS4X;MRPL35; RPS6;MRPS18C;RPL26;RPS27L |
hsa05016 | Huntington’s disease | 33/664 | 193/7297 | 0.0002633 | 0.0187 | ATP5G2;COX6C;UCP1;SDHD; POLR2J3;COX7A2L;COX8C;POLR2K |
hsa05010 | Alzheimer’s disease | 30/664 | 171/7297 | 0.0003147 | 0.0187 | ATP5G2;COX6C;CASP12;SDHD; PPP3CC;COX7A2L;LPL;COX8C |