Background
The liver is crucial in metabolizing xenobiotics through various mechanisms that involve numerous detoxification enzymes and antioxidant activity. Accordingly, the liver is continuously exposed to harmful oxidative stresses that impair cell function, which trigger several liver diseases [
1,
2]. Liver diseases remained a major global health burdens and medical issue [
3]. Oxidative stress is defined as an imbalance between the systemic manifestation of reactive oxygen species (ROS) and the antioxidant defenses [
4]. Oxidative stress is crucial in the pathogenesis of liver diseases including fibrosis and liver cirrhosis [
5‐
9]. ROS are chemically reactive molecules containing oxygen that normally function in cellular responses in signal transduction to sustain life and as part of host defenses against various infections [
10]. However, excessive production of free radicals including superoxide, hydroxyl radical, lipid free radical, and nitric oxide leads to damage in certain diseases of the liver [
11]. Inhibition of free radicals has been linked to the alleviation of liver disorders [
12].
Carbon tetrachloride (CCl
4) can induce free radical toxicity and has been used as a hepatotoxin in diverse liver disease models [
13,
14]. CCl
4 is converted into reactants through the formation of reactive intermediates including trichloromethyl radicals (CCl
3·, CCl
3OO·) and free radicals by cytochrome P450 (CYP 450) [
15]. These free radicals and related oxidative stresses induce the deformation of cellular macromolecules, and increases lipid peroxidation, protein degeneration, and genomic mutations in human liver tissue [
16]. A member of the CYP family, CYP2E1, is involved in these reactions and in the metabolism of xenobiotics like ethanol. CYP2E1 is regulated by endogenous factors and foreign compounds [
17,
18]. Suppression of CYP2E1 has reduced liver damage in various experimental models including in vitro and in vivo systems [
19‐
21].
The side effects of modern synthetic drugs used to treat liver diseases remains unclear. Traditional medicines and plant-derived drugs might be an attractive alternative in the prevention and treatment of hepatic disorders [
12,
22].
Amomum cardamomum L., a member of Zingiberaceae family, can be distinguished from large cardamom native to southern India and is nowadays cultivated widely in tropical regions. The plant seeds are widely used as a spice in many countries and traditionally as a therapeutic for relief of dyspepsia, hiccupping, vomiting, and alcohol detoxification [
23]. The previous studies have reported that seed of
A. cardamomum and its active components had antioxidant and anti-inflammatory activities [
24,
25]. Important essential oils constituents including terpenes have been reported in this plant [
26]. Another reports suggest that essential oils treatment containing α, β-pinene, d-camphor, and 1,8-cineole inhibited liver injury in animal models [
27‐
29]. 1,8-Cineole, the bicyclic monoterpene rich in
A. cardamomum has been reported to have protective bioactivity on liver against steatosis, and 2,3,7,8-tetrachlorodibenzo-
p-dioxin (TCDD) in vivo [
30,
31]. Another study revealed relation between antioxidant activity and hepatoprotection [
32,
33] which suggests potential effect of
A. cardamomum on the liver disease related to free radical and other ROS production. The effects of
A. cardamomum and its fractions on attenuating CCl
4-induced hepatotoxicity are unknown, with no study of the involvement of antioxidant activity in vitro and in vivo.
Therefore, in this study we evaluated the possible antioxidant properties and hepatoprotective effects of the ethyl acetate fraction obtained from A. cardamomum (EAAC) against CCl4-induced hepatic injury in vitro and in vivo. Furthermore, CYP2E1 gene expression level was investigated to demonstrate the downregulating activity of the EAAC; results were compared to the effects of silymarin, a drug commonly used as a liver therapeutic agent.
Methods
Chemicals
2.2-Diphenyl-1-picryl hydrazyl (DPPH), butylated hydroxytoluene (BHT), d(+)-catechin, gallic acid, tannic acid, sodium carbonate, nitrobluetetrazolium (NBT), xanthine, xanthine oxidase, and Folin-Ciocalteu reagent, iron(III) chloride (FeCl3), hydrogen peroxide (H2O2), ascorbic acid were all purchased from Sigma-Aldrich (St. Louis, MO, USA) or Merck & Co (Darmstadt, Germany). For in vitro studies, bovine serum albumin, Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS), Dulbecco’s phosphate buffered saline (DPBS), penicillin, and streptomycin were purchased from Hyclone (Logan, UT, USA). Oligo primers were purchased from Macrogen (Seoul, Korea). For in vivo studies, silymarin, olive oil, CCl4, Oil Red O, hematoxylin and eosin (H&E) stain, triethanolamide, 5,5’-dithiobis(2-nitrobenzoic acid) (DTNB), glutathione (GSH), superoxide dismutase (SOD), 2-thiobarbituric acid (TBA), and sodium azide were purchased from Sigma-Aldrich.
A. cardamomum and extraction
Dried A. cardamomum seeds were purchased from Dongwoodang (Yeongcheon-si, Korea). The seeds were ground finely using a mixer grinder and the resulting powder was extracted by a 3-day immersion in 70 % ethanol. The extract was evaporated using a rotary evaporator (Büchi, Flawil, Switzerland) prior to sequential fractionation using hexane, dichloromethane, and ethyl acetate applied with an extraction funnel. Each fraction was concentrated and dried using the aforementioned rotary evaporator. The extract was harvested and used as samples.
Cell culture and viability assay
HepG2 human liver carcinoma cells were cultured in DMEM supplemented with 10 % FBS, 100 U/ml penicillin and streptomycin. Cells were incubated at 37 °C in a humidified environment containing 5 % CO2. Cells were subcultured at 70-80 % confluence and seeded at a density of 1 × 105 cells/well in 96-well plates. After 24 h, the medium changed to FBS-free DMEM. After 24 h pretreatment of EAAC samples (dissolved in DMSO), the medium was changed to DMEM containing 8 mM CCl4. The cells were incubated in 37 °C in the humidified CO2 incubator for 2 h followed by cell viability determined using the EZ-Cytox cell viability assay kit (Daeil Lab Service, Seoul, Korea) as described by the manufacturer. Briefly, 10 μl of the EZ-Cytox reagent was added to each culture well of a 96-well microplate and incubated at 37 °C in the humidified CO2 incubator for 2 h. After incubation, optical density (OD) of the supernatant was measured at a wavelength of 450 nm using a microplate reader.
Determination of total phenolic, flavonoids and tannins
Tannin content
Tannin content was measured using the Folin-Denis method [
34]. Fifty microliters of extract was made up to 7.5 ml by the addition of distilled water. Then, 0.5 ml of Folin Denis reagent and 1 ml of Na
2CO
3 were added and mixed. The volume was made up to 10 ml using distilled water. The absorption was recorded at 700 nm. Tannic acid and distilled water was used as standard and blank, respectively.
Phenol content
Phenol content was measured by the Folin-Ciocalteu method [
35]. A sample aliquot 40 μl was added to 200 μl of Folin-Ciocalteu reagent along with 1160 μl of distilled water and mixed. The mixture was incubated for 3 min at room temperature prior to the addition of 600 μl of 2 % sodium carbonate. After 2 h incubation in the dark, the mixture was aliquoted into wells of a 96 well plate and the OD was measured at 765 nm. Gallic acid and distilled water was used as standard and blank, respectively.
Flavonoid content
Total flavonoid content for samples was determined by the aluminium chloride colorimetric method [
36] with slight modification. 1 ml of water was added to 250 μl samples in a tube. At zero time, 75 μl of 5 % NaNO
2 was added to the tube. After 5 min, 0.3 ml of 10 % AlCl
3 was added and incubated for 6 min. After, 0.5 ml of 1 M NaOH was added to the mixture. Absorbance was read at 510 nm with water as the blank. Various concentrations of (+) catechin hydrate solution was used as standard.
In vitro antioxidant properties
To determine free radical scavenging activities of sample, 40 μl of various concentrations of sample was added to 760 μl solution of 0.3 mM DPPH dissolved in ethanol. An equal amount of ethanol and DPPH served as control. After 30 min incubation in the dark, the absorbance was recorded at 517 nm. The experiment was performed in triplicate and the activity was presented as percentage of scavenged radical. To determine superoxide anion scavenging activities of sample a slight modification of a prior protocol was used [
37]. In brief, each sample was mixed with 30 mM EDTA (pH 7.4), 3 mM hypoxanthine in 50 mM sodium peroxide, and 1.42 mM NBT. The mixture was incubated for 3 min at room temperature following the addition of xanthine oxidase and increased volume to to 3 ml with phosphate buffer (pH 7.4). The mixture was incubated for 20 min at room temperature and absorbance at 560 nm was measured using a spectrophotometer. To determine hydroxyl radical scavenging activity, cloned pBR322 plasmid DNA from transformed bacteria was used in assay. Supercoiled (SC) pBR322 plasmid DNA (2.0 μg) was mixed with various concentrations of EAAC. The fenton’s reagent (80 μM FeCl
3, 0.3 mM H
2O
2, 50 μM ascorbic acid) was added to samples and volume brought up to 20 μl. The mixture was incubated at 37 °C for 30 min. Samples were loaded into agarose gel and photographed under UV illuminator.
Animals and experimental design
Six-week-old specific pathogen-free male Sprague–Dawley rats (n = 30) purchased from Koatech (Gyeonggi-do, Korea) received standard normal diet and water ad libitum. The animals were acclimatized to 12 h light/dark cycles for 7 days prior to the experiments. They were divided randomly into five groups of six rats: negative control (olive oil; 1 ml/kg), CCl4 (1 ml/kg, dissolved 1:1 in olive oil), CCl4 + Silymarin (50 mg/kg, dissolved in olive oil), CCl4 + low dose EAAC (100 mg/kg, dissolved in olive oil), and CCl4 + high dose EAAC (200 mg/kg, dissolved in olive oil). All treatments were administrated every 72 h for 5 weeks. Bodyweight was recorded weekly. The day after the final treatment, all animals were starved overnight and sacrificed. Whole blood was collected from the abdominal aorta and the liver was harvested under zoletil anesthesia. All protocols for animal experiments were approved by the ethics committee of Dongguk University (No. 2014–09110).
Serum biochemistry
After sacrifice, the collected blood was immediately centrifuged at 3000 rpm for 20 min. The supernatant was stored at 4 °C until analyses for alanine transaminase (ALT), aspartate transaminase (AST), and alkaline phosphatase (ALP) using commercial kits (Company, Asan, Korea) according to the manufacture’s protocols. As well, OD was determined using a spectrophotometer.
Determination of lipid peroxidation
Lipid peroxidation level of rat liver was assessed by a previously described malondialdehyde (MDA) assay protocol [
38] with slight modification
. In brief, rats were sacrificed and the liver was isolated after blood perfusion. Liver tissue was homogenized with 1.15 % KCl (9:1, w/w). Aliquots (400 μl) of homogenate were mixed with TBA to a final concentration of 8.1 %. The reactant was heated to 95 °C for 1 h prior to the addition of 1 ml of distilled water and a 5 ml solution of n-butanol and pyridine (15:1). The reactant was centrifuged at 3000 rpm for 30 min. The supernatant was transferred to wells of a 96-well plate and the OD was measured at 532 nm. Various concentrations of 1,1,3,3-tetraethoxy propane were used as standard.
Intracellular antioxidant enzymes detection
Total Sulfhydryl (SH) level of liver tissue was measured using a prior protocol [
39]. In brief, 20 μl of liver sample or standard was mixed with 75 μl of Tris–HCl (pH 8.2) and 25 μl of DTNB (3 mM) in methanol prior to the addition of 400 μl of methanol. Then mixture was spin down at 3000 g for 5 min at room temperature. The sample was transferred to well of a microplate and absorbance was read at 412 nm. Different concentrations of GSH were used as standard. The experiments were conducted in triplicate. SOD activity of liver tissue was investigated using NBT [
40]. Briefly, 0.1 mM xanthine, 0.1 mM EDTA, and 25 uM NBT were dissolved in 60 uM sodium bicarbonate buffer. Sample and reaction buffer was mixed in a 1:9 (w/w) ratio. SOD was used as standard. One unit of SOD was equivalent to the amount of enzyme that inhibited the rate of the CYP-catalyzed reaction by 50 %.
Histology
Liver tissues were frozen using a frozen section compound (Leica, Jena, Germany) and sectioned using a model CM 1860 cryotome (Leica). Slide sections were fixed with 10 % formaldehyde and deparaffinized and stained with H&E or Oil Red O stain. Microscopic images were taken under 200 × concentrations using a DFC 480 microscope system (Leica).
Quantitative real-time polymerase chain reaction (RT-PCR) and conventional PCR
A portion of each liver tissue was stored in RNA Later solution (Life Technologies, Carlsbad, CA, USA) at −80 °C for investigation of mRNA expression. Liver mRNA was isolated from liver tissues using Trisure (Bioline, Taunton, MA, USA) following the manufacturer’s protocol. Isolated mRNA was checked for RNA integrity and cDNA was synthesized. PCR amplification comprised 10 min at 95 °C, 45 denaturation cycles at 95 °C for 10 s, annealing at 52 °C for 30 s, and extension at 72 °C for 15 s. This was followed by melting curve analysis. Every Ct value and Second Derivative Max quantification was checked. Results were analyzed using Light Cycler software (Roche Applied Science, Basel, Switzerland). Primer sequences used for RT-PCR were as follows: GST sense 5’- GCCTTCTACCCGAAGACACCTT - 3’ and antisense 5’ - GTCAGCCTGTTCCCTACA - 3’, SOD sense 5’ - AGGCCGTGTGCGTGCTGAG - 3’ and antisense 5’ - CACCTTTGCCCAAGTCATCTGC - 3’, CYP2E1 sense 5’ - ATGTCATCCCCAAGGGTACA - 3’ and antisense 5’ - AGGCCTTCTCCAACACACAC - 3’, GAPDH sense 5’ - GGCACAGTCAAGGCTGAGAATG - 3’ and GAPDH antisense 5’ – ATGGTGGTGAAGACGCCAGTA - 3’.
Conventional PCR for CYP2E1 gene was conducted with 30 amplification cycles of PCR consisting of denaturation at 95 °C for 1 min, annealing at 52 °C for 1.5 min, elongation at 72 °C for 2 min. Equal amount of PCR product was then loaded and performed electrophoresis on 1 % agarose gel for 30 min. The relevant expression level was then visualized by UV illuminator (UVP, Cambridge, UK).
Statistical analyses
The results are expressed as mean ± standard deviation (SD). Experimental data were analyzed using Graph Pad prism version 5.0 software (Graph Pad, La Jolla, CA, USA). Standard curves were constructed using Excel and Powerpoint software (Microsoft, Redmond, WA, USA). All samples were compared with a standard graph using analysis of variance and Student’s t-test. A p-value < 0.05 was considered statistically significant.
Discussion
The data presented in this study demonstrate that
A. cardamomum protects against CCl
4-induced acute liver injury. CCl
4 is an extensively studied hepatotoxin that is converted CCl
3 including trichloromethyl (CCl
3·, CCl
3OO·) free radicals [
15]. Free radical and oxidative stresses have been associated with numerous liver diseases, such as cirrhosis, genotoxicity of hepatic tissue, and hepatic carcinoma [
1,
41]. Several endogenous enzymatic and non-enzymatic systems are needed to protect the liver from free radicals [
42]. Natural plant-derived antioxidants protect cellular detoxification systems from the harmful responses of excessive oxidation converted free radicals from CCl
4 [
20,
43].
The antioxidant properties of the
A. cardamomum ethanol extract and organic fractions were tested using various
in vitro systems. Especially, the ethyl acetate fraction from
A. cardamomum (EAAC) strongly inhibited formation of DPPH free radicals, superoxide anions, and hydroxyl radicals. The relatively high antioxidant capacity was attributable to the abundance of polyphenol and flavonoid compounds in ethyl acetate fraction from crude extract of natural plants. Similarly, a recent study [
44] found that the ethyl acetate fraction of
Crescentia cuhete leaves and stem bark possess a stronger antioxidant capacity than other fractions in a rapid
in vitro assay. It is clear that ethyl acetate fractions from natural plants that contain phenolic compounds and flavonoids have superior antioxidant properties. In addition, the treatment of HepG2 hepatocarcinoma cells with CCl
4 presently resulted in decreased cell viability. This observation agrees with previous reports using various cancer cell lines [
9,
45]. On the other hand, pretreatment with EAAC significant recovered cell viability, perhaps due to the reduction of cytotoxicity.
Various recent studies have demonstrated that natural plant-derived phytochemicals protect the liver against CCl
4-induced damage, such as cirrhosis, steatosis, and hepatic fibrosis [
7,
20,
46]. This was presently implied by the significant decreases in serum levels of ALT, AST, and ALP in liver tissue that displayed protection against CCl
4-induced degeneration. The decrease levels of these serum enzymes correlates with fewer necrotic lesions or histopathological injury, and lipid peroxidation in liver tissue [
12,
47]. Moreover, induction of phase II enzymes including GSH, GST, and SOD are important in the balance between oxidative stress and antioxidation in a CCl
4-induced acute liver injury model [
48]. The present results show that exposure to CCl
4 caused significant increases in serum ALT, AST, and ALP due to hepatic damage in rat liver. However, administration of 100 mg/kg and 200 mg/kg body weight EAAC markedly restored liver physiology, which might be due to the phenolic compounds and total flavonoids. Furthermore, treatment with EAAC increased several phase II enzymes including total SH, GST, and SOD, which were reduced by CCl
4, likely due to the antioxidant properties of EAAC.
CYP2E1, the most important hepatic cytochrome P450 isoform, is a CCl
4 converting enzyme that catalyzes production of trichloromethyl free radicals in the liver [
15,
49]. The liver is organ that is clearly influenced by CYP2E1, therefore, downregulation of CYP2E1 was expected by decrease of trichloromethyl free radical formation and reduced liver damage, inducing hepatocyte necrosis and hepatocellular injury [
50]. In this study, the treatment of rats with CCl
4 led to a significant overexpression of the CYP2E1 gene compared to control rats. However, treatment with 100 mg/kg and 200 mg/kg body weight EAAC significantly reduced CYP2E1 production. Therefore, it is suggested that
A. cardamomum has valuable therapeutic potential for liver disease caused by CYP2E1 expression by decreasing CYP2E1 expression in liver.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
LDW, KH, PJY, KJE, MJY, PSD, and PWH conceived and designed the experiments. LDW performed the animal surgery, antioxidant properties, quantitative assay, and generated the figures. KH also performed the animal surgery and analyzed the data. PJY was determined reverse transcriptase-polymerase chain reaction in animal tissue. KJE, MJY and PSD analyzed the data and wrote the manuscript. PWH supervised the project and contributed to the final draft of the paper. All authors read and approved the final manuscript.