Background
Rheumatoid arthritis (RA) is a chronic systemic autoimmune disease, characterized by synovitis with synovial lining cell hyperplasia and marked inflammatory cell infiltration in multiple joints in the initial stage; followed by marked pannus formation and progressive destruction of cartilage and bone mediated by augmented proliferation of activated osteoclasts. Osteoclasts are multinucleated giant cells positive for tartrate-resistant acid phosphatase (TRAP) and cathepsin K, and they resorb bone matrix [
1,
2]. These cells differentiate from the osteoclast precursors of monocyte/macrophage lineage cells in the bone marrow [
3] and in peripheral blood [
4]. The process of osteoclastogenesis is controlled by the interaction of receptor activator of NF-κB (RANK) expressed on osteoclast precursors with its ligand RANKL expressed on synovial fibroblasts, osteoblasts, and T helper 17 (Th17) cells [
5‐
7]. The RANKL-mediated osteoclastogenesis is counterbalanced by the physiologically expressed decoy receptor, osteoprotegerin (OPG) [
8]. Accumulating evidence has indicated that high expression levels of proinflammatory cytokines, such as tumor necrosis factor α (TNFα), interleukin (IL)-1, IL-6, and IL-17, in inflamed synovial tissues may play pivotal roles in the processes of both synovitis and osteoclastogenesis [
9].
We previously found that an inhibitory IgG Fc receptor IIB (FcγRIIB)-deficient mouse strain, originally established on 129 × C57BL/6 (B6) genetic background and backcrossed to B6 mice, designated KO1, spontaneously develops human RA-like disease features with marked synovitis and severe cartilage/bone destruction in multiple joints [
10]. Signal blockade of IL-6 or TNFα markedly ameliorates arthritis in KO1 mice [
11,
12]. Also, intriguingly, the severity of arthritis was positively associated with the increased frequency of peripheral monocytes in KO1 mice [
11]. Since peripheral monocytes are composed of several subsets, including inflammatory cells and osteoclast precursors [
4], the high frequency of peripheral monocytes may contribute to the up-regulation of both inflammatory cell infiltration and osteoclastogenesis in the arthritic joints of KO1 mice.
The rat anti-mouse CD11b mAb, 5C6, has been shown to inhibit recruitment of peripheral CD11b
+ myelomonocytic cells into the inflamed lesion [
13]. These CD11b
+ myelomonocytic cells include neutrophils and monocytes, both of which play important roles in the initiation and progression of arthritis [
11,
14]. We treated KO1 mice with 5C6 to evaluate the arthritis-preventive potential of 5C6 mAb in KO1 mice. The 5C6 treatment ameliorated arthritis in KO1 mice with decrease in inflammatory cell infiltrations, osteoclast formation, and RA-related cytokine production in the joint tissues. The 5C6 treatment also suppressed B cell activation/differentiation and autoantibody production. The possible mechanism in which 5C6 treatment ameliorates disease severity is discussed.
Methods
Mice
Arthritis-prone KO1 is a FcγRIIB-deficient B6 congenic line [
10], obtained by backcrossing the originally constructed FcγRIIB-deficient mice on a hybrid (129 × B6) background into a B6 background for over 12 generations. C57BL/6 (B6) mice were purchased from Japan SLC, Inc., and used as the arthritis-free normal control. Only female mice were analyzed in the present study. All mice were housed under identical specific-pathogen-free conditions. All animal experiments were performed in accordance with the animal experiment guidelines of our university.
Incidence and scoring of arthritis
Ankle joint swelling was examined by eye inspection twice a month after 5 months of age and arbitrarily scored as follows: 0, no swelling; 1, mild swelling; 2, moderate swelling; and 3, severe swelling. Scores for both ankle joints were summed for each mouse, and mice with a score of 2 or over were considered positive for arthritis. In addition to eye inspection, the degree of swelling in the region of the tarsal bones was measured at 10 months of age under anesthesia using a Vernier micrometer.
In vivo administration of anti-CD11b mAb (5C6)
To examine the preventive effect of mAb 5C6 on the development of arthritis, 4-month-old preclinical KO1 mice were randomly divided into three groups. Each group of 15 mice was left untreated, treated with normal rat IgG (Sigma Chemical Co.), or treated with rat anti-mouse CD11b mAb (5C6, rat IgG2b [
13]). Two hundred micrograms of rat IgG or 5C6 was administrated intraperitoneal (i.p.) twice a week for 6 months.
Histopathology
Joint tissues were decalcified in 10% EDTA in 0.1 M Tris buffer (pH 7.4), fixed in 4% paraformaldehyde, and embedded in paraffin. Tissue sections were stained with hematoxylin/eosin, and also stained for TRAP using the TRAP/ALP stain kit (Wako Pure Chemical Industries Ltd.).
Serum levels of antibodies
Serum levels of IgG anti-cyclic citrullinated peptide (CCP) antibodies were measured employing commercially available kits (Cosmic Corporation) using anti-mouse IgG second antibodies and were expressed as relative units according to the manufacturer’s instructions. Serum levels of rheumatoid factor (RF) were measured using an ELISA, as previously described [
15]. Briefly, an ELISA plate pre-coated with mouse IgG Fc fragment (OEM Concepts) was incubated with appropriately diluted mouse serum samples, washed, and then incubated with peroxidase-conjugated rat anti-mouse κ chain antibodies (BD Biosciences Pharmingen). RF activity was expressed in units referring to a standard curve obtained by serial dilution of a standard serum pool from 4–6-month-old MRL/
lpr mice containing 1000 unit activities/ml. Serum IgG anti-double-stranded (ds) DNA was measured using an ELISA plate pre-coated with 5 μg/ml calf thymus dsDNA (Sigma-Aldrich). DNA-binding activity was expressed in units as previously described [
10].
Flow cytometric analysis
Spleen cells were stained with phycoerythrin (PE)-labeled anti-B220 (RA3-6B2) mAb, allophycocyanin (APC)-labeled anti-CD69 (H1.2 F3), anti-CD138 (281-2), and anti-CD11c (HL3) mAbs, fluorescein isothiocyanate (FITC)-labeled anti-CD4 (RM4-5) and anti-CD11b (M1/70) mAbs, and FITC-labeled peanut agglutinin (PNA). For peripheral monocyte staining, peripheral leukocytes were stained with FITC-labeled anti-CD11b, PE-labeled anti-Gr-1 (RB6-8C5), and APC-labeled CD115 (AFS98) mAbs. Fluorescent-labeled reagents were purchased from Bay Bioscience (B220, CD4, CD11b, Gr-1, CD115), Bio Legend (CD69, CD138), BD Bioscience (CD11c), and Sigma-Aldrich (PNA). Stained cells were analyzed using a FACSAria cytometer and FlowJo software (Tree Star Inc.). Auto-fluorescence was considered as negative control. Compensation of spillover was performed according to the manufacturer’s instructiongei.
Quantitative real-time PCR (qRT-PCR) analysis
Total RNA was isolated from ankle joint tissue of the tarsal bones containing soft tissue and bone/cartilage/marrow, from the spleen, and from peripheral leukocytes using QIAGEN RNeasy Lipid Tissue Minikit (Cat. number 74804). Briefly, ~ 25 mg of ankle joint tissue, spleen, or leukocyte pellet was added in 500 μl of QIAzol lysis reagent in a 2-ml tube containing 5-mm-diameter zirconia beads (Hirasawa YTZ-5) and homogenized on TissueLyser (Qiagen) for 1 min at 30 Hz. Total RNA was extracted from homogenized materials using Minikit according to the manufacturer’s instructions, and 0.5 μg of total RNA was used to synthesize the single-stranded cDNA using an oligo (dT)-primer with Superscript III First-Strand Synthesis kit (Invitrogen). The cDNA product was used for qRT-PCR. The data were normalized to β-actin as a reference. The primer pairs used and the length of PCR products are shown in Table
1. The quantity was normalized using 2
-∆∆CT methods.
Table 1
Primer pairs used in qRT-PCR and size of PCR products
RANK | GCTGGCTACCACTGGAACTC | GTGCAGTTGGTCCAAGGTTT | 182 |
RANKL | TGTACTTTCGAGCGCAGATG | AGGCTTGTTTCATCCTCCTG | 160 |
OPG | TGAGTGTGAGGAAGGGCGTTA | CCATCTGGACATTTTTTGCAAA | 130 |
MCP-1 | AGGTCCCTGTCATGCTTCTG | TCTGGACCCATTCCTTCTTG | 249 |
CX3CL1 | CGCGTTCTTCCATTTGTGTA | CTGTGTCGTCTCCAGGACAA | 169 |
RANTES | TCGTGCCCACGTCAAGGAGTATTT | TCTTCTCTGGGTTGGCACACACTT | 107 |
TNFα | TATGGCCCAGACCCTCAC | GGTTGTCTTTGAGATCCATGC | 110 |
IL-6 | GAGGATACCACTCCCAACAGACC | AAGTGCATCATCGTTGTTCATACA | 141 |
IL-17 | TCTCTGATGCTGTTGCTGCT | GACCAGGATCTCTTGCTGGA | 346 |
IL-10 | CAGCCGGGAAGACAATAACT | GTTGTCCAGCTGGTCCTTTG | 121 |
BAFF | TTGTCCAGCAGTTTCACAGC | CCGGTGTCAGGAGTTTGACT | 160 |
IL-1β | GCCCATCCTCTGTGACTCAT | AGGCCACAGGTATTTTGTCG | 230 |
BSF-3 | CGAGCCTGACTTCAATCCTC | TACGTCGGAGTTCAGCTGTG | 185 |
IFNγ | AAGACAATCAGGCCATCAGC | ATCAGCAGCGACTCCTTTTC | 225 |
β-actin | TGGGTATGGAATCCTGTGG | GTACTTGCGCTCAGGAGGAG | 200 |
Statistics
The Kaplan-Meier method was used to evaluate differences in the incidence of arthritis. Analysis of variance (ANOVA) was used to make comparisons among three or four groups of mice, and Student’s t test was used to compare two groups of mice. A value of P < 0.05 was considered as statistically significant.
Discussion
In arthritis-prone KO1 mice, the 5C6 treatment initiated at the preclinical stage markedly suppressed the incidence and severity of arthritis from the early stage of the disease. This mAb has been shown to inhibit recruitment of peripheral CD11b
+ myelomonocytic cells into the inflammatory site with no cytotoxic effect [
13]; however, in our experiment, the repetitive 5C6 treatment had a somewhat cytotoxic effect and induced decreased frequencies of myelomonocytic cells in the periphery. The 5C6-mediated disease suppression in the initiation stage of arthritis seems to be due to the decreased CD11b
+ inflammatory cell migration into the joint tissues, since 5C6-treated mice had mild synovial lining cell proliferation but not inflammatory cell infiltration. In the later stage, KO1 mice developed the marked cartilage and bone destruction associated with severe synovitis, pannus formation, and up-regulated TRAP-positive osteoclast generation at the bone resorption lacuna. These destructive features were seldom observed in 5C6-treated KO1 mice due to the lack of osteoclast precursor monocyte recruitment into the joint tissues. The disease suppression was associated with down-regulation of serum RF and of IgG autoantibodies against CCP and dsDNA. These findings clearly demonstrate that, in addition to the effect on the decreased migrations and frequencies of peripheral CD11b
+ myelomonocytic cells including inflammatory cells and osteoclast precursors, 5C6 mAb also exerts an inhibitory effect on B cell activation/differentiation.
RANK and RANKL expression was suppressed in the joint tissue in 5C6-treated KO1 mice, while OPG was up-regulated. The decrease in RANK expression is likely due to the decreased number of RANK-expressing osteoclast precursors. The decreased RANKL expression in 5C6-treated KO1 mice is thought to be due to decreased IL-6 expression, as IL-6 signals have been shown to directly induce RANKL expression in fibroblast-like synoviocytes from patients with RA [
18]. As OPG is a decoy receptor for RANKL and suppresses RANKL-mediated osteoclastogenesis [
8], the increased OPG expression and the lower RANKL/OPG ratio are consistent with the suppression of osteoclastogenesis in the joint tissues of 5C6-treated KO1 mice. OPG is produced by a variety of cells including osteoblasts, B cells, dendritic cells, and vascular endothelial cells [
19,
20], and the marked decrease in OPG expression in arthritic joints has been suggested as a result of the exhaustion of OPG production due to chronic stimulation by TNFα over the extended period [
20]. Consistently, synovial OPG expression has been shown to be increased in patients with RA treated with anti-TNFα [
21] and in TNFα-deficient KO1 mice [
11]. Thus, the increased level of OPG in 5C6-treated mice may be due to lower expression of TNFα.
RA is an autoantibody-mediated autoimmune disease, in which IgG immune complexes (ICs) trigger inflammatory myelomonocytic cell activation via IC-binding to the FcR γ chains of stimulating IgG Fc receptors [
22,
23]. These activated inflammatory cells produce several inflammatory cytokines including chemokines, which induce additional inflammatory cell infiltration in the joint tissues. Our arthritis-prone KO1 mice lack the expression of inhibitory FcγRIIB molecules [
10], which are usually expressed on B cells and myelomonocytic cells. The FcγRIIB molecules inhibit the activation signals mediated by the B cell antigen receptors on B cells and by the FcR γ chains on myelomonocytic cells [
22,
23]. The lack of FcγRIIB expression on B cells induces the breakdown of self-tolerance and the production of IgG autoantibodies [
24]. The resultant IgG ICs formed in the joint tissues stimulate myelomonocytic cells via the FcR γ chains, and this process is augmented in KO1 mice. In 5C6-treated KO1 mice, the expression levels of chemokines such as MCP-1 and RANTES were significantly down-regulated, indicating that these cytokines play important roles in the pathogenesis of arthritis in KO1 mice. Intriguingly, it has been shown that once RANK
+ osteoclast precursor monocytes are activated via membrane-bound RANKL, it leads to increased expression of MCP-1 and RANTES, and these chemokines act as chemical signals, attracting other monocytes to the site of RANKL expression. These chemokines promote fusion of monocytes with RANKL-stimulated osteoclast precursors, resulting in the generation of multinucleated mature osteoclasts [
25].
Peripheral monocytes are composed of heterogeneous populations and could mainly be subdivided into two phenotypically and functionally distinct subsets [
4,
26]. In mice, monocytes are clearly divided into two populations, namely Gr-1
+ and Gr-1
- subsets. The former is CX3CR1
lowCCR2
+ and is called an “inflammatory” subset that is actively recruited to inflamed tissues via MCP-1, the ligand for CCR2, whereas the latter is CXCR3
highCCR2
- and called a “resident” subset that is recruited to non-inflamed tissues. Intriguingly, in lupus-prone mice the Gr-1
-, but not the Gr-1
+ subset is selectively expanded and expresses the stimulatory FcγRIV, suggesting that the Gr-1
- subset may be in a more active stage than the Gr-1
+ subset, and may contribute to kidney damage [
27]. Compared with normal B6 mice with monocyte frequencies below 10% [
17], our arthritis-prone KO1 mice develop marked monocytosis with frequencies above 50%, mainly composed of the Gr-1
- subset. The 5C6 treatment especially suppressed the frequency of Gr-1
- monocytes, suggesting the important role of the Gr-1
- subset in osteoclastogenesis. Thus, the originally classified Gr-1
- “resident” subset may contain functionally different cell types, one responsible for lupus nephritis and another for osteoclastogenesis in the joints. However, there are conflicting results reported on the cell types that can give rise to osteoclasts. Yao et al. [
28] report that the Gr-1
- subset is the major precursor of osteoclasts. In contrast, Seeling et al. [
29] showed that the Gr-1
+ inflammatory monocyte subset represents the major precursor of osteoclasts, and that these Gr-1
+ monocytes differentiated into mature osteoclasts paralleled by up-regulation of FcγRIV expression upon
in vitro activation via RANKL. They also showed that the cross-linking of activating FcγRIV by ICs was critical for osteoclast development. Given the important role of FcγRIV in IC-mediated stimulation, Gr-1
-FcγRIV
+ monocytes may contribute to the initial step of inflammatory responses, including MCP-1 expression, in the arthritic lesion, and then Gr-1
+CCR2
+ monocytes are attracted by MCP-1, resulting in the fusion with activated Gr-1
-FcγRIV
+ monocytes to generate multinucleated mature osteoclasts, as suggested [
25].
Genetic studies using lupus-prone mice showed that the frequency of peripheral monocytes correlates well with the serum level of autoantibodies [
17]. In the present study, 5C6 treatment down-regulated the frequency of the Gr-1
- monocyte subset, along with decreased expression of BAFF, IL-1β, BSF-3, and IL-6 in the periphery, suggesting that Gr-1
- monocytes are the major producer of these cytokines in KO1 mice. BAFF enhances B cell survival and immune responses [
30]. Although the important roles of IL-1β in innate immune responses and T cell differentiation are known [
31], IL-1β is also well-recognized as an essential cytokine for antibody production and B cell proliferation [
32,
33]. BSF-3, also reported as cardiotrophin-like cytokine, belongs to the IL-6 family and strongly stimulates antibody production by B cells [
34,
35]. These B cell activation/differentiation-related cytokines may play a pivotal role in B cell activation and consequently in the pathogenic autoantibody production in KO1 mice. Taken together, the blocking of monocyte function may be an additional possible therapeutic strategy for rheumatoid arthritis.