Background
Hepatitis B virus (HBV) infection is the leading cause of liver cirrhosis and hepatocellular carcinoma (HCC); however the outcome of the infection varies widely among infected individuals [
1]. Although various therapies including alpha interferon and nucleoside/-tide analogues are in use for treating HBV infection, a constant effort is being made to develop more potential and cost effective drugs.
Innate immunity, the first line of defense, plays a vital role in limiting the spread of pathogen after the initial infection and triggers an effective adaptive immune response. It has been seen that viral particles and its components are sensed by pattern recognition receptors (PRR), which include the RIG-I-like receptors (RLRs), nucleotide oligomerization domain (NOD)-like receptors (NLRs) and the toll-like receptors (TLRs). They subsequently activate an effective signaling pathway, which is responsible for the production of antiviral cytokines. Though a clear role of adaptive immune response has been seen in HBV clearance; the role of innate immunity in HBV infection still remains enigmatic [
2]. Earlier, it was assumed that HBV was unable to induce an innate immune response by acting as a ‘stealth virus’, which skillfully evades the first line of defense and strategically block important candidates in its signaling pathway [
3]. Therefore, HBV remains undetected by the host immune surveillance and infects the hepatocytes until the adaptive immunity is triggered weeks later. However, on the contrary, HepaRG cells as well as SCID mice harboring humanized liver, shows an up-regulation of IFN (Interferon) response upon HBV infection [
4,
5]. Different TLR agonists have been clinically assessed for treatment of chronic viral infections like HBV, Hepatitis C virus (HCV) and Human Immunodeficiency Virus (HIV) [
6]. Previous studies have shown that TLR3, TLR4, TLR5, TLR7, and TLR9 ligands/agonists when administered intravenously in HBV transgenic mice, inhibits HBV replication [
7]. In addition, a recent study showed that activation of TLR2 is instrumental in suppression of HBV replication in hepatoma cell lines and woodchuck models [
8].
Single stranded viral RNAs and synthetic compounds like imidazoquinoline, loxoribine serve as agonists for TLR7, which mainly operates through the Myeloid Differentiation primary-response protein88 (MyD88) dependent pathway. The subsequent messengers in the signaling pathway activate different transcription factors including Nuclear Factor kappa-light-chain-enhancer of activated B cells (NF-КB), Jun N-terminal Kinase (JNK) etc. that turns on the expression of downstream targets and inflammatory cytokine secreting genes. In the present study we have tried to look into the antiviral role of TLR7 in hepatocyte microenvironment during HBV infection. TLR7 exhibits viral clearance by modulating several key host factors. Cell cycle analysis was carried out to check the fate of HBV induced G1/S arrest on TLR7 activation. We also investigated the epigenetic alteration as a sequel to HBV infection and monitored a partial reversal upon TLR7 agonist treatment implicating an alteration of gene expression.
Method
Study subjects
A total of 19 liver biopsy samples were collected from patients at Kalinga Gastroenterology Foundation (Cuttack, Orissa, India) of which, 12 individuals had chronic HBV infection. 7 biopsy samples were taken from patients with steatosis but had no history of HBV, HCV or HIV infections and they were taken as disease controls. Signed informed consent was obtained from patients and the study was approved by the institutional ethical committee. The diagnosis of patients with CHB was conformed according to the AASLD guidelines 2009.
Cell culture
The maintenance and plating of hepatoblastoma cell lines HepG2 and HepG2.2.15 was done as described previously [
9].
Lamivudine treatment
Lamivir (Lamivudine tablets-150 mg) were provided by Cipla. The tablets were suspended in sterile water and then filtered using 0.2-μm filters. Cells were treated with 10, 20, 50 and 100 μM (final concentration) of Lamivudine every day for 72 h as shown previously [
10], after which cells were harvested for further analysis.
Analysis of HBV viral properties
The synthetic ligand used for TLR7 was Imiquimod-R837 provided by Invivogen. Cell culture supernatant was collected from HepG2.2.15 cells after treatment with 4, 6 and 8 μg/ml of R837 for 72 h. Total DNA was extracted using Qiagen Blood mini-kit (Hilden, Germany). HBV viral load in culture supernatant was quantified by real-time TaqMan PCR assay using NIBSC standards as described earlier [
11]. HBeAg and HBsAg levels were analyzed by using commercial ELISA kits (Diasorin, S.P.A., Saluggia, Italy).
Chemical inhibitors
For pathway screening, HepG2.2.15 cells were stimulated with 8 μg/ml of R837 (Invivogen, San Diego, CA, USA) singly or in conjunction with various inhibitors. 10 μM NF-КB pathway inhibitor PDTC, 25 μg/mL of SP600125 (MAPK/JNK pathway inhibitor), 2μMof LY294002 (inhibitor of PI3K) and 10 μM SB203580 (MAPK/p38 pathway inhibitor) were used. They were purchased from Sigma–Aldrich (St. Louis, MO, USA). These inhibitors have specific targets and block the exact pathways that they are chosen for [
12].
RT-PCR analysis
For the RNA expression from HepG2 and HepG2.2.15 cells, 1x10
6 cells were plated in 6-well plate for the different experiments. For the mRNA expression of TLR7, different cell cycle regulators and the different TLR7 signaling molecules from HepG2/HepG2.2.15 cells, total RNA was treated with DNase and was reverse transcribed with random hexamers using Revert Aid first-strand cDNA synthesis kit (MBI Fermentas). Real time PCR was performed in ABI 7200 SDS (Applied Biosystems, Foster City, CA, USA) using Power SYBR Green (Applied Biosystems). The target mRNA was relatively quantified and was normalized to the internal control (GAPDH). The PCR cycle number (C
T) at which the exponential growth in the fluorescence from the dye (SYBR Green) passes a certain threshold was used to calculate the relative gene expression. 2
-ΔΔCT was calculated to represent the relative quantification of the gene, where Δ
C
T (
C
T-target gene –
C
T-GAPDH). ΔΔCT = Δ
C
T (Experiment) - Δ
C
T(Control). List of primers used are listed in Table
1.
Western blot analysis
For western blotting, cells were harvested and lysed with Laemelli buffer containing 120 mMTris-HCl (pH-6.8), 20% Glycerol and 4% SDS. Almost equal amounts of protein were then run in a SDS PAGE and transferred on Nitrocellulose membrane (Millipore). Following incubation with primary antibody (overnight at 4 °C) and HRP conjugated secondary antibody (3 h at room temperature), the blots were developed using chemiluminescent substrate (Millipore). Densitometry measurements of bands were used for quantification of each marker by integrating each peak in Image J software. List of primary antibodies are listed in Table
2.
Table 1
List of primer sequences used for RT-PCR analysis
IRAK 1 | 5'-ACCGCAGATTATCATCAACC-3' | 5'-AGACTTACAGCCATACTTCACT-3' |
IRAK 4 | 5'-GCTGTATGTAGGGTGGAAAC-3’ | 5'-TGCTGACAACTGGAAGGTAG-3' |
TRAF6 | 5'-GCCCAGGCTGTTCATAGTTT-3' | 5'-CAAGGGAGGTGGCTGTCATA-3' |
p53 | 5’-CCCAAGCAATGGATGATTTGA-3’ | 5’-GGCATTCTGGGAGCTTCATCT-3’ |
CYCLIN D1 | 5’-AGCTCCTGTGCTGCGAAGTGGAAAC-3’ | 5’-AGTGTTCAATGAAATCGTGCGGGGT-3’ |
CYCLIN E | 5’-CAGCACTTTCT TG AGCAACACCCTC-3’ | 5’-TCTCTAT GTCGCACCACTGATACCC-3’ |
CYCLIN B1 | 5’-AAGAGCTTTAAACTTTGGTCTGGG-3’ | 5’-CTTTGTAAGTCCTTGATTTACCATG-3’ |
CYCLIN A | 5’GCATGTCACCGTTCCTCCTT-3’ | 5’CAGGGCATCTTCACGCTCTAT-3’ |
JNK | 5'- GTACTTGTATGAAACCACCTTTCT -3' | 5'- AGCATCTCTTTCTGAATCTATGAAG -3' |
PI3KCA | 5'- AAGGGTGCTAAAGAGGAACAC -3’ | 5'-CATGAGGTACTGGCCAAAGAT -3' |
PI3KCB | 5'- CTCCAAATGTTGCGCTTGATG -3' | 5'- ACAACTTCAATGAGGCCAGAG -3' |
PI3KCG | 5’- CACCGAGACAGGAAACCTATTT -3’ | 5’- TAGCACAAATGGCACTCTCTC -3’ |
NF-КB | 5’-CGCATCCAGACCAACAACA-3’ | 5’- TGCCAGAGTTTCGGTTCAC-3’ |
p38 | 5’- TCTGCTTACCCTTCACCTTTG -3’ | 5’- CACATCCTCACTCTGCTAGAAAT -3’ |
c-jun | 5’-CAAAGTTTGGATTGCATCAATG-3’ | 5’- TAACATTATAAATGGTCACAGCACATG-3’ |
c-myc | 5’-CTTCTCTCCGTCCTCGGATTCT-3’ | 5’-GAAGGTGATCCAGACTCTGACCTT-3’ |
Sap-1 | 5’-GCTTTTGCCACCACACCACCCATTTCG-3’ | 5’-GCCCAGACAGAGTGAATGGCCCATGAC-3’ |
Elk-1 | 5’-ACCTGAAATCGGAAGAGCTTAAT-3’ | 5’-AACTTCCAACTCTTCCTTGGG-3’ |
TNF-α | 5’-ATGGGCTACAGGCTTGTCACT-3’ | 5’-CTCTTGGCAGCCTTCCTGATT-3’ |
IFN-β | 5’-GTCTCCTCCAAATTGCTCTC-3’ | 5’-ACAGGAGCTTCTGACACTGA-3’ |
IFN-α | 5’-TGGCTGTGAAGAAATACTTCCG-3’ | 5’-TGTTTTCATGTTGGACCAGATG-3’ |
IL-6 | 5’-ATGTAGCCGCCCCACACAGA-3’ | 5’-CATCCATCTTTTTCAGCCAT-3’ |
IL-1β | 5’-ACAGATGAAGTGCTCCTTCCA-3’ | 5’-GTCGGAGATTCGTAGCTGGAT-3’ |
GAPDH | 5'-AAGGCTGTGGGCAAGG-3' | 5'-TGGAGGAGTGGGTGTCG-3' |
Table 2
List of Antibodies used
Anti-GAPDH | ab9485 | ABCAM |
Anti-H3 | ab10799 | ABCAM |
Anti-H3K36Me3 | ab9050 | ABCAM |
Anti-H3K4Me3 | 39159 | ACTIVE MOTIF |
Anti-H3K9Me3 | 39161 | ACTIVE MOTIF |
Anti-H3K27Me3 | 39155 | ACTIVE MOTIF |
Anti-H3K18Ac | 39587 | ACTIVE MOTIF |
Anti-H3K9Ac | | MILLIPORE,07-352 |
Anti-NFКBp65 | 14-6731-81 | e-BIOSCIENCE |
Anti-p53 | SC-126 | SANTA CRUZ BIOTECHNOLOGY |
Anti-Mouse IgG-HRP | W402B | PROMEGA |
Anti-Rabbit IgG-HRP | A1949 | SIGMA |
Anti-Rabbit Alexa Fluor | A11034 | INVITROGEN |
Confocal imaging to detect NF-КB nuclear translocation
HepG2.2.15 cells were grown on coverslips and treated with R837 as stated earlier. The cells were washed thrice with Phosphate buffered saline (PBS) and then fixed with 4% Paraformaldehyde (Sigma) in PBS for 10 min at room temperature (RT). Cells were washed thrice with PBS and permeabilized with 1% Triton X-100 in PBS for 10 min at RT, washed with PBS thrice followed by blocking with 3% BSA in PBS for 1 h at RT. Cells were incubated with Anti-NFКB (eBioscience) for 1 h at RT, washed thrice with PBST (PBS + 0.05% Tween20) and then incubated with secondary antibody (Alexa-Fluor anti-rabbit 488, Invitrogen) for 1 h in dark at RT, followed by three washes with PBST. Coverslips were mounted with mounting media containing DAPI (Sigma Aldrich). Fluorescence for Alexa and DAPI was visualized with Nikon Ti-E confocal microscope with A1RMP scanner head equipped with Nikon imaging software (NIS).
Cell cycle analysis
For cell cycle analysis, the cells were harvested and thoroughly re-suspended in Phosphate Buffered Saline (PBS). The cells were then fixed by adding double volume of chilled 70% ethanol (Merck) drop wise, with continuous vortexing. After incubating the mixture overnight at −20 °C, it was spinned and the cells were resuspended in 500 μl of PBS. The cells were then incubated with RNaseA (0.2 mg/ml) for 30 min followed by Propidium Iodide (50 μg/ml) (Sigma) at 37 °C for 1 h. Flow cytometric data acquisition was performed on BD FACS Calibur platform.
MTT assay
Cell proliferation was measured by MTT assay (Cell Titer 96® AQueous One Solution Cell Proliferation Assay, Promega, USA) as described previously [
9]. The cells were uniformly seeded in each well of 96-well plates and grown in RPMI 1640 supplemented with 10% FBS. After 24 h, the media was removed and replaced with fresh media and treated with R837. The plates were incubated at 37 °C in a humidified atmosphere of 5% CO
2 for 72 h. At indicated time-points, relative cell numbers were determined by incubating cells with MTT3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide. The absorbance at 490 nm is directly proportional to the number of viable cells. All experiments were performed in triplicates.
Discussion
TLRs have a pivotal role in the regulation of innate immune responses and are intricately associated with the host defense mechanism. TLR activation leads to the production of endogenous interferons and antiviral cytokines, which establishes a crosstalk between innate and adaptive immune responses. This triggers the immune effector cells, which plays a vital role in the antiviral immunity. Studies show that modulation of TLR signaling pathways can be effective in controlling infectious diseases, immune-related disorders and cancers [
17]. It has been seen previously that the innate immune response remains suppressed on HBV infection [
18]. In the current study, we have shown that TLR7 expression is reduced in liver biopsy samples of Chronic Hepatitis B patients compared to steatosis individuals serving as disease controls. Patients with steatosis have been earlier used as disease control for HBV-related innate immune studies [
19]. We have also showed that the compromised TLR7 expression in HepG2.2.15 cells was significantly re-established when HBV replication was suppressed by use of a common nucleoside analogue (Lamivudine), thus further proving that HBV suppresses TLR7. Lamivudine is a currently approved licensed anti-HBV drug which results in decrease in the circulating HBV DNA levels [
20]. Previous studies have showed that Lamivudine significantly inhibited levels of HBV DNA in HepG2.2.15 cell line [
21]. This observation was further confirmed, since there was no significant change in TLR7 expression in HepG2 cells taken as control.
Our previous studies have shown that both TLR7 and miR-155 are down-regulated and positively correlate with each other in HBV infection and ectopic expression of miR-155 can reduce HBV viral load through targeted suppression of C/EBP-β [
9]. Thus, possibly, stimulation of TLR7 might as well exhibit an anti-viral effect. Therefore, we aimed to explore the effect of TLR7 stimulation on HBV replication in hepatocyte micro-environment. Our findings show that TLR7 activation leads to suppression of HBV replication and viral protein (HBsAg and HBeAg) production, which is in concordance to a previous study that was conducted in Chimpanzees [
22]. This study takes a step forward in identifying the different host factors and the alterations in gene expression on TLR7 activation in virus infected hepatocytes. An earlier report showed that MAPK/ERK and PI3K/AKT pathways were responsible for the suppression of HBV replication through TLR2 stimulation [
8], however no such studies were conducted with TLR7. In the current study, we found that the antiviral action of TLR7 takes place through the JNK pathway. JNKs are subgroups of MAP kinases and are activated in response to cytokines, TLRs and antigen receptors like T and B cells [
23]. Activated JNKs phosphorylate c-Jun, JunD, ATF and other transcription factors, which is involved in the formation and activation of AP-1 complex. C-jun is a downstream molecule phosphorylated by the JNKs and is a well-characterized oncogene, found in the liver [
24]. Results showed that there was an increased expression of c-jun on TLR7 stimulation, indicating the activation of JNK pathway and its possible role in the anti-viral response. Further, it was seen that blocking JNK pathway with SP600125, curbed the expression of different cytokines including IFN-β, TNF-α, IL-1β, IL-6 and IL-10. Chief anti-inflammatory cytokine IL-10 and pro-inflammatory cytokines IL-6 and TNF-α probably play a balanced role in viral elimination. The blockers that have been used for pathway screening have specific roles and act specifically on different substrates. Previously, several cytokines have been shown to have a HBV suppressive effect in infected transgenic mice and cell line models. Several cytokines viz. IL-12, IL-18 and IFNs have been shown to have a suppressive effect in HBV-infected transgenic mice [
25‐
27]. Another study had shown that IFN-γ synergistically acts with TNF-α and inhibits expression of HBV RNA levels in immortalized hepatocyte cell line (HBV-MET) [
28]. IL-4 has also been shown to be an effective cytokine in viral protein suppression in Hep3B cell line [
29]. Although the above-mentioned cytokines may play vital roles in HBV suppression, there may be multiple modes by which HBV is eliminated on TLR7 activation. Further studies are required to elucidate the exact pathway responsible in HBV clearance on triggering TLR7.
Eukaryotic genome is packaged into chromatin, which is subjected to dynamic structural alteration [
30]. Post-translational modification (PTM) of core histone tails regulates gene expression spatiotemporally [
31]. Site specific histone modifications can be read by effector proteins which delineate a specific cellular fate as highlighted through histone code hypothesis [
30]. H3K4Me3 and H3K9Me3 are the transcription activation and repression signatures respectively. H3K9Ac also positively regulates transcription. Thus the global alterations of these epigenetic signatures reflect a major variation in cellular gene expression profile. Dynamic chromatin architecture is perturbed due to viral infection and an alteration of host posttranslational modification; fewer studies have embarked onto changes in host genome. Remarkably, Telbivudine, an anti HBV drug dramatically restores histone H3K4Me3 and H3K27Me3 of HepG2.2.15 cells akin to HepG2 cells [
32]. Detailed investigation of host epigenetic changes as a sequel to TLR7 activation showed global repression of H3K9Me3 levels (Fig.
5a). This indicates a transcription de-repression scenario. Indeed we have seen upregulation of JNK responsive transcripts upon R837 treatment (Fig.
6a). This effect is however gene specific in broad perspective. Treatment of R837 to HepG2.2.15 cells reversed the epigenetic markers as well as transcription factor levels similar to HepG2 cells implicating that TLR7 activation possibly leads to viral reduction through suppression of HBV replication. These results further raise a possibility that antiviral response can be manifested by targeting the histone PTMs gene specifically and hence can be used as an epigenetic therapy.
Previous studies show Hepatitis B undergoes slow cell proliferation and induces a G1/S cell cycle arrest in HepG2.2.15 cells [
16]. It is worth mentioning that HBx performs a dual activity of anti-proliferation and transactivation in HCC tissues. The study further showed that the effect of HBx on cell viability probably depends on the balance between pro-apoptotic and anti-apoptotic effects of NF-КB on different cell types [
33]. Thus, the wild type HBx is responsible for the late G1 arrest, and upon TLR7 activation this arrest is partially released. The viral infection also triggers an upregulated expression of p53, which successfully retards the transition from G1 to S phase and prevents cell growth. The elevated p53 expression in liver biopsy samples of CHB patients re-affirmed the G1/S arrest induced by the virus. Previous studies have shown that serum p53 levels are higher in HBV- related cirrhotic patients compared to chronic HBV ones [
34]. Interestingly, apart from alteration of p53 levels, Cyclin D1 and Cyclin E levels were dramatically modulated upon TLR7 activation implicating a role of p53 independent pathway regulating cell cycle. Thus, R837 treatment partially restores the cell cycle stages by removing the G1/S arrest and thus the antiviral response could be reestablished. No significant cell death was observed in the MTT assay. There was a clear indication of cell proliferation and there was increase in cell number at different time points on R837 treatment. The study on role of TLR7 in HBV infection has been shown in HepG2.2.15 cell line, harboring multiple copies of HBV genome, since the supernatant from the cell culture can infect chimpanzees intravenously, showing typical symptoms of human hepatitis, highlighting the efficiency of the model. Further, HepG2.2.15 cells have been used to study the pathogenesis of HBV and in elucidating the role of anti-viral drugs in HBV-related disorders [
35‐
39]. Nevertheless, TLR7 levels and its role in HBV pathogenesis should be looked into other relevant systems like PHH cultures or NTCP-driven in vitro infection of different cell lines.
Acknowledgements
DD is recipient of Inspire Fellowship. We thank Mr. SrijanHalder and ChinmayMondal for their exceptional technical assistance. We would also like to thank Dr. Prabal Kumar Chakraborty, working with Towa Optics (I) Pvt. Ltd. for his technical assistance in confocal microscopy.