Skip to main content
Erschienen in: BMC Medical Genetics 1/2018

Open Access 01.12.2018 | Research article

Association between H19 SNP rs217727 and lung cancer risk in a Chinese population: a case control study

verfasst von: Lingling Li, Genyan Guo, Haibo Zhang, Baosen Zhou, Lu Bai, He Chen, Yuxia Zhao, Ying Yan

Erschienen in: BMC Medical Genetics | Ausgabe 1/2018

Abstract

Background

H19 was the first long non-coding RNA (lncRNA) to be confirmed. Recently, studies have suggested that H19 may participate in lung cancer (LC) development and progression. This study assessed whether single nucleotide polymorphisms (SNPs) in H19 are associated with the risk of LC in a Chinese population.

Methods

A case-control study was performed, and H19 SNP rs217727 was analyzed in 555 lung cancer patients from two hospitals and 618 healthy controls to test the association between this SNP and the susceptibility to LC.

Results

The A/A homozygous genotype of rs217727 was significantly associated with an increased LC risk (odds ratio (OR) = 1.661, 95% confidence interval (CI) = 1.155 to 2.388, P = 0.006). Significant associations remained after stratification by smoking status (P < 0.001). Furthermore, the A/A genotype had a higher risk of LC than those of G/G in the squamous cell carcinoma (OR = 2.022, P = 0.004) and adenocarcinoma (OR = 1.606, P = 0.045) subgroups.

Conclusions

The rs217727 SNP in lncRNA H19 was significantly associated with susceptibility to LC, particularly in squamous cell carcinoma and adenocarcinoma, and identified the homozygous A/A genotype as a risk factor for LC.
Hinweise
Lingling Li and Genyan Guo contributed equally to this work.
Abkürzungen
AD
Adenocarcinoma
CI
Confidence interval
DMR
Differentially methylated regions
HWE
Hardy–Weinberg equilibrium
LC
Lung cancer
LD
Linkage disequilibrium
lncRNA
Long non-coding RNA
MAF
Minor allele frequency
OR
Odds ratio
SCC
Squamous cell carcinoma
SCLC
Small cell lung cancer
SD
Standard derivation
SNPs
Single nucleotide polymorphisms

Background

Lung cancer (LC) has a high incidence and will continue to be the most common cause of cancer-related death around the world [1]. In China, this malignancy has the highest mortality and accounts for an estimated 25% of cancer-related deaths [2]. LC is a complex pathological process. The major risk factors by far are cigarette smoking and air pollution. Because a proportion of individuals exposed to carcinogens may have genetic factors associated with the development of cancer, predisposing genic elements should be weighed as risk factors for LC.
Long non-coding RNAs (lncRNAs) are longer than 200 nucleotides and are defined as non-protein-coding transcripts that are universally transcribed in the genome [3]. LncRNAs are transcribed as sense, antisense, bidirectional, intronic, or intergenic [4]. They can work by binding to chromatin-modifying complexes to specifically silence genomic loci both in cis and trans [5]. Increasingly, more studies have revealed that lncRNAs play a major role in many aspects of tumorigenesis at the epigenetic, transcriptional, and posttranscriptional levels, including cell growth, apoptosis, invasion, and metastasis. Based on the latest studies, there is evidence that lncRNAs can control gene expression through multiple mechanisms, such as transcription, translation, imprinting, genome rearrangement, and chromatin modification [6]. H19 is a maternally expressed imprinted gene on chromosome 11p15.5 that encodes for a capped and spliced RNA and has been implicated in cancer [7]. It was the first lncRNA discovered in the human genome and plays a crucial role in mammalian development [8, 9].
Single nucleotide polymorphisms (SNPs) have been widely used in plant, livestock, and animal genetic analyses. SNPs may affect gene expression and function. In addition, SNPs can be associated with the susceptibility to cancer. To date, there have been rare reports of genetic mutations in lncRNAs and their possible correlations to LC susceptibility. Thus far, the association between H19_rs217727 polymorphisms and LC has not been studied in the Chinese population.
In this hospital-based case-control study, we hypothesized a possible association between variant genotypes of the human H19 gene (rs217727) and LC. To test our hypothesis, SNPs within the H19 gene were genotyped from blood DNA samples of 555 LC patients and 618 age- and gender-matched general population controls.

Methods

Study population

The study population consisted of 555 LC patients and 618 healthy controls. The LC patients were consecutively recruited between September 2010 and November 2015 from the First Affiliated Hospital of China Medical University and the Fourth Affiliated Hospital of China Medical University. Each patient was histopathologically diagnosed including squamous cell carcinoma (SCC), adenocarcinoma (AD) and small cell lung cancer (SCLC). These control subjects were picked out throughout the same period in the Fourth Affiliated Hospital of China Medical University from the health examination center. Allowing for a better condition, the following exclusion criteria were used: history of LC; history of significant concomitant tumors; any cancer-related metastasis; chemotherapy or radiotherapy; non autologous transfusion. All subjects (LC patients and healthy controls) participated had no family history of LC in this study. Then, we randomly took sample of 618 healthy controls, which were frequency matched to the LC cases on age and gender. All participants who were unrelated ethnic Chinese resided in or near Liaoning province. All individual participants voluntarily joined this study with informed consents. Information was collected by a structured questionnaire. Smoking was defined as ≥10 cigarettes per day for at least 2 years.

SNPs selection and genotyping

The location of the 2.7 kb human H19 gene (Gene ID: 283120) including the DMR (differentially methylated regions) and the promoter region was pinpointed to chromosome 11, position (1972982–1981641). The HapMap project has established a common pattern in the human genome for most of the population on the basis of DNA sequence variation. Based on the HapMap data and the criteria of minor allele frequency (MAF) > 0.05 in CB population, we found two SNPs rs217727 and rs2107425 in H19, and they are in high linkage disequilibrium (LD). Some researchers had found that H19_rs2107425 and H19_rs217727 play roles in carcinoma susceptibility. The role of rs2107425 polymorphism had been identified in lung cancer. So, we chose the other one SNP, rs217727.
Genomic DNA was extracted from venous blood. Usually, about 5 ml venous blood samples were collected from each participant. The blood samples are registered and stored at − 80 °C. Genomic DNA was extracted from leukocytes, and separated from the whole blood using a standard phenol-chloroform protocol. Genotyping was performed by pre-designed TaqMan probes (Applied Biosystems, Foster City, CA, USA). The assay ID is C___2603707_10 (part number: 4351379), and the specific amplicon context sequence is TGTGGTGGCTGGTGGTCAACCGTCC[A/G]CCGCAGGGGGTGGCCATGAAGATGG (Table 1) The H19_rs217727 polymorphism was amplified and genotyped through the TaqMan SNP Genotyping Assay by using the ABI 7500 Real-time PCR system (Applied Biosystems, Foster City, CA, USA) in 96-well plates. The reaction mixture (5 μl) contained 2.5 μl TaqMan® Genotyping Master Mix (Applied Biosystems, Foster City, CA, USA), 0.125 μl hydrolysis probe, 1.375 μl ddH2O and 30 ng genomic DNA for each SNP, according to the following PCR protocol: 95 °C for 10 min for 1 cycle; 95 °C for 15 s and 60 °C for 1 min for 40 cycles; followed by a cycle of 60 °C for 1 min which is a stage of analysis for genotypes. Controls (known genotype and water) were included in each reaction plate to ensure that the genotyping were accuracy. The deionized water was used as a negative control and the rs3219073/GG SNP of PARP-1 was used as a positive control, which was previously detected in many lung cancer samples [10]. Two researchers analyses the genotype individually in a blind method. Approximately 10% samples were randomly selected to repeat detection, the results for random sampling were 100% concordant as quality control samples.
Table 1
Genotyped SNP ordered according to the position in the H19 gene
dbSNP
NCBI assembly location (Build 37)
TaqMan assay ID
Base change
Tag SNP (CHB population; HapMap)
Cinfirmed functional effect of SNP
rs217727
Chr.11:2016908
C___2603707_10
A/G
Yes
No
Context Sequence: TGTGGTGGCTGGTGGTCAACCGTCC[A/G]CCGCAGGGGGTGGCCATGAAGATGG

Statistical analysis

The data obtained were computed and analyzed via SPSS, version 16.0 (SPSS Inc., Chicago, IL, USA). Continuous variables without skewness were estimated via means ± standard derivation (SD) and compared with the Student’s t tests. Categorical variables were used through frequency counts and compared by the Chi-square (χ2) test [11]. The Hardy–Weinberg equilibrium (HWE) was estimated by the goodness-of-χ2 test. When the HWE was respected, the allele comparison and the additive model were asymptotically equivalent [12]. Correlations between the genotype and the susceptibility of LC were assessed via odds ratio (OR) with 95% confidence interval (CI) by logistic regression analyses with adjustment for age and smoking status [13]. OR was also evaluated subgroup, viz. tumors of different pathological types. A value of P < 0.05 was considered statistically significant.

Results

Characteristics of the study population

The demographics of the 555 LC patients and 618 healthy controls are summarized in Table 2. The majority of the LC patients were diagnosed with adenocarcinoma (44.6%) followed by squamous cell carcinoma (38.7%) and small cell carcinoma (16.7%). The mean ages of the LC patients and healthy controls were 60.15 ± 9.896 and 60.05 ± 10.170 years, respectively. There was no significant difference in the frequency distributions of age or gender (P = 0.517 and 0.798) between the LC patients and the controls. However, the data was significantly higher (61.8%) in cases with the smoking status than that in controls (P < 0.001), which is consistent with the epidemiological distribution of LC.
Table 2
Baseline characteristics of study subjects
Characteristics
Case (n = 555)
Controls (n = 618)
P value
Age (year)
60.15 ± 9.896
60.05 ± 10.170
0.517
Sex
  
0.798
 Male (%)
394 (70.1)
434 (70.2)
 
 Female (%)
161 (29.9)
184 (29.8)
 
Smoking status
  
< 0.001
 Ever (%)
343 (61.8)
143 (23.1)
 
 Never (%)
212 (38.2)
475 (76.9)
 
Pathological types
  
 Squamous Cells Carcinoma (%)
215 (38.7)
 
 Adenocarcinoma (%)
248 (44.6)
 
 Small Cell Carcinoma (%)
92 (16.7)
 

H19 polymorphisms and the susceptibility of LC

The genotype of H19_rs217727 and its association with the risk of LC are presented in Table 3. The genotype distribution of the rs217727 in the controls did not deviate from those expected under HWE (P = 0.167). A statistically significant increase in the risk of LC was found for carriers of the A/A genotype compared to the homozygous carriers of the wild-type G/G genotype (OR = 1.661, 95%CI = 1.155–2.388, P = 0.006). After adjustment for the smoking status, the A/A genotype was also significant (P = 0.002). However, when the combined A/G + A/A genotypes were compared to the wild-type G/G genotype, there was no significant difference.
Table 3
H19 polymorphisms (rs217727) among the cases and controls and the associations with risk of LC
Genotype
Case, n (%)
Control, n (%)
Crude OR, (95%CI)
P value
Adjusted OR, (95%CI)a
Pa value
G/G
210 (37.9)
246 (39.8)
1.0(ref.)
 
1.0(ref.)
 
A/G
250 (45.0)
305 (49.4)
0.960 (0.749~ 1.231)
0.749
0.957 (0.730~ 1.255)
0.751
A/A
95 (17.1)
67 (10.8)
1.661 (1.155~ 2.388)
0.006
1.849 (1.248~ 2.740)
0.002
A/G + A/A
345 (62.1)
372 (60.2)
1.086 (0.859~ 1.375)
0.490
1.111 (0.860~ 1.435)
0.420
The bold values mean statistically significance with P < 0.05
LC lung cancer, OR odds ratio, CI confidence interval
aAdjusted for smoking status

Stratified analysis of H19 polymorphisms and the risk of LC

We carried out stratified analysis to assess the relationship between the H19 lncRNA SNPs and the risk of LC according to the pathological subtypes (Table 4). We found that the rs217727 A/A genotype was associated with an increased cancer risk for squamous cell carcinoma (P = 0.004, adjusted OR = 1.996, 95% CI = 1.142 to 3.489, P = 0.015) and adenocarcinoma (P = 0.045, adjusted OR = 1.767, 95% CI = 1.096 to 2.850, P = 0.019), but not for small cell carcinoma (P = 0.123, adjusted OR = 1.799, 95% CI = 0.846 to 3.827, P = 0.127). There was no significant association between this polymorphism and the susceptibility of LC with other genotypes.
Table 4
Stratification analyses of H19 polymorphisms (rs217727) and risk of LC
Pathological types
Case, n (%)
Control, n (%)
Crude OR, (95%CI)
P value
Adjusted OR, (95%CI)a
Pa value
Squamous Cells Carcinoma
 G/G
81 (37.7)
217 (41.6)
1.0 (ref.)
 
1.0 (ref.)
 
 A/G
94 (43.7)
252 (48.3)
0.999 (0.705~ 1.416)
0.997
0.790 (0.532~ 1.174)
0.244
A/A
40 (18.6)
53 (10.1)
2.022 (1.247~ 3.279)
0.004
1.996 (1.142~ 3.489)
0.015
 A/G + A/A
134 (62.3)
305 (58.4)
1.177 (0.849~ 1.631)
0.327
0.977 (0.675~ 1.414)
0.903
Adenocarcinoma
 G/G
97 (39.1)
228 (40.1)
1.0 (ref.)
 
1.0 (ref.)
 
 A/G
110 (44.4)
281 (49.4)
0.920 (0.665~ 1.272)
0.615
0.904 (0.647~ 1.262)
0.552
A/A
41 (16.5)
60 (10.5)
1.606 (1.011~ 2.551)
0.045
1.767 (1.096~ 2.850)
0.019
 A/G + A/A
151 (60.9)
341 (59.9)
1.041 (0.767~ 1.412)
0.797
1.047 (0.765~ 1.433)
0.776
Small Cell Carcinoma
 G/G
32 (34.8)
187 (41.6)
1.0 (ref.)
 
1.0 (ref.)
 
 A/G
46 (50.0)
216 (48)
1.245 (0.761~ 2.035)
0.383
1.114 (0.680~ 1.926)
0.612
 A/A
14 (15.2)
47 (10.4)
1.741 (0.860~ 3.522)
0.123
1.799 (0.846~ 3.827)
0.127
 A/G + A/A
60 (65.2)
263 (58.4)
1.333 (0.835~ 2.129)
0.229
1.253 (0.764~ 2.056)
0.372
The bold values indicate statistical significance (P < 0.05)
LC lung cancer, OR odds ratio, CI confidence interval
a Adjusted for smoking status

Discussion

LncRNAs, which characterize a functionally varied class of transcripts, have been found in many different species, such as humans, animals, plants, yeast, and viruses [1417]. Many researchers suggest that lncRNAs play a key role in tumorigenesis and during cellular development, differentiation, and many other biological processes. Furthermore, several studies have reported that lncRNAs are misregulated in various types of cancers [1820]. Significant overexpression of lncRNAs-CCAT2 was found in lung adenocarcinoma [21]. Nie et al. [22] reported that the lncRNA ANRIL was overexpressed in NSCLC patient tissues and associated with advanced “tumor node metastasis (TNM)” subsets, tumor size, and prognosis. Therefore, abnormalities of the expression of lncRNAs may be involved in the tumorigenesis of LC. Genetic variants in lncRNAs could be a biomarker for the prediction of cancer susceptibility in humans. Liu et al. [23] found that lncRNAs-MALAT1_rs619586 was associated with decreased hepatocellular carcinoma risk. LncRNAs-HOTAIR_rs12826786 in strong linkage disequilibrium with rs1899663 (r2 = 1) was associated with the risk of gastric cardia adenocarcinoma [24]. However, their definitive roles in cancer development and progression remain largely unclear.
The H19 lncRNA gene does not encode a protein, but an oncofetal RNA [25, 26]. Deregulation of oncofetal RNA plays a critical role in tumorigenesis [26]. Accumulating evidence suggests that loss of imprinting and deregulation of the H19 gene are associated with human cancer, and its overexpression is a frequent event in lung cancer development [27, 28]. H19 is abnormally expressed in many types of cancers, including gastric [29], liver [30], colorectal [31], bladder [32], and pancreatic cancer [33], and increases the tumorigenic properties of tumor cells [3437]. In addition, studies have shown that H19 enhances invasion and migration of pancreatic ductal adenocarcinoma cells by decreasing let-7 and subsequently increasing the HMGA2-mediated epithelial-mesenchymal transition (EMT) [33]. Barsyte-Lovejoy et al. [34] found that the knockdown of H19 inhibited colony formation and anchorage-independent growth in lung cancer cells. Other studies have reported that H19 could be induced under hypoxic stress through the p53/HIF1-α pathway. Moreover, the knockdown of H19 could significantly suppress hypoxia-induced cancer cell proliferation in vivo [36]. Furthermore, high expression of H19 was positively associated with advanced TNM stage and was a predictor of overall survival (OS) in gastric cancer patients [38, 39]. Studies have shown that the H19_rs2107425 SNP was related to the susceptibility of bladder cancer, and showed a significant correlation with LC susceptibility (P = 0.02, age under 50 years) [40, 41]. However, Riaz et al. [42] found that H19_rs2107425 did not alter H19 mRNA expression in breast cancer. Yang et al. [43] reported that the variant H19 genotypes (CT + TT rs217727, CT + TT rs2839698) were correlated with an increased risk of gastric cancer (P = 0.040, P = 0.033), and the CT and TT genotypes in rs2839698 were also related to higher H19 mRNA levels in serum. In contrast, the rs217727 polymorphism did not affect the H19 mRNA level. To the best of our knowledge, the role of the H19_rs217727 polymorphism in LC susceptibility is still unknown in the Chinese population. Accordingly, we investigated whether this polymorphism was associated with the risk of LC in the Chinese population.
In this study, the A/A genotype of H19_rs217727 was significantly higher in the LC patients than in the controls (P = 0.006). In particular, there was a significantly increased risk of squamous cells carcinoma (P = 0.004) and adenocarcinoma (P = 0.045). However, when the combined A/G + A/A genotypes were compared with the wild-type G/G genotype, there was no significant difference. Therefore, the G allele may be a protective factor and people who carry this allele may be less likely to develop lung cancer. However, the present research was limited with respect to geographical variation, nation, and sample size. These factors may greatly affect the accuracy of this experiment. Additional studies that encompass more geographical regions, additional ethnic groups, and larger sample size should be performed. Although all subjects were enrolled from only two hospitals and selection bias could not be avoided, the genotype distribution of the controls in our study did accord with the HWE. Additional studies are also necessary to understand the mechanism by which the rs217727 SNP affects H19 mRNA expression, alters the translational efficiency, or leads to alterations in the H19 structure in LC.

Conclusions

In the current study, we found that the H19_rs217727 polymorphism plays a crucial role in the risk of LC in a Chinese population. Larger population-based studies are required to confirm the relationship between H19 expression levels and the susceptibility to LC. H19_rs217727 SNPs may be potential clinical markers for predicting the risk of LC.

Acknowledgments

The authors thank all patients and control subjects for their participation and all personnel participating in our study for help in preparing blood samples, interviewing subjects, analyzing data and supporting experiments.

Funding

This work was supported by the Clinical Capability Construction Project for Liaoning Provincial Hospitals (grant number LNCCC-B08–2014).

Availability of data and materials

All data generated or analyzed during this study are included in this manuscript.
All individual participants voluntarily joined this study and provided written informed consents. Ethical approval for this investigation was obtained from the Ethics Committee of the China Medical University. Issue date: March 8, 2010.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
3.
Zurück zum Zitat Ponting CP, Oliver PL, Reik W. Evolution and functions of long noncoding RNAs. Cell. 2009;136:629–41.CrossRefPubMed Ponting CP, Oliver PL, Reik W. Evolution and functions of long noncoding RNAs. Cell. 2009;136:629–41.CrossRefPubMed
4.
Zurück zum Zitat Nakaqawa S, Kageyama Y. Nuclear lncRNAs as epigenetic regulators-beyond skepticism. Biochim Biophys Acta. 2014;1839(3):215–22.CrossRef Nakaqawa S, Kageyama Y. Nuclear lncRNAs as epigenetic regulators-beyond skepticism. Biochim Biophys Acta. 2014;1839(3):215–22.CrossRef
6.
Zurück zum Zitat Fatica A, Bozzoni I. Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet. 2014;15:7–21.CrossRefPubMed Fatica A, Bozzoni I. Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet. 2014;15:7–21.CrossRefPubMed
7.
Zurück zum Zitat Kallen AN, Zhou XB, Xu J, et al. The imprinted H19 lncRNA antagonizes let-7 microRNAs. Mol Cell. 2013;52:101–12.CrossRefPubMed Kallen AN, Zhou XB, Xu J, et al. The imprinted H19 lncRNA antagonizes let-7 microRNAs. Mol Cell. 2013;52:101–12.CrossRefPubMed
9.
Zurück zum Zitat Keniry A, Oxley D, Monnier P, et al. The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. Nat Cell Biol. 2012;14:659–65.CrossRefPubMedPubMedCentral Keniry A, Oxley D, Monnier P, et al. The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. Nat Cell Biol. 2012;14:659–65.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Wang HT, Gao Y, Zhao YX, et al. PARP-1 rs3219073 polymorphism may contribute to susceptibility to lung cancer. Genet Test Mol Biomarkers. 2014;18(11):736–40.CrossRefPubMed Wang HT, Gao Y, Zhao YX, et al. PARP-1 rs3219073 polymorphism may contribute to susceptibility to lung cancer. Genet Test Mol Biomarkers. 2014;18(11):736–40.CrossRefPubMed
11.
Zurück zum Zitat Adamec C. Example of the use of the nonparametric test. Test χ2 for comparison of 2 independent examples. Cesk Zdrav. 1964;12:613–9.PubMed Adamec C. Example of the use of the nonparametric test. Test χ2 for comparison of 2 independent examples. Cesk Zdrav. 1964;12:613–9.PubMed
12.
Zurück zum Zitat Guedj M, Nuel G, Prum B. A note on allelic tests in case-control association studies. Ann Hum Genet. 2008;72:407–9.CrossRefPubMed Guedj M, Nuel G, Prum B. A note on allelic tests in case-control association studies. Ann Hum Genet. 2008;72:407–9.CrossRefPubMed
13.
Zurück zum Zitat Woolf B. On estimating the relation between blood group and disease. Ann Hum Genet. 1955;19:251–3.CrossRefPubMed Woolf B. On estimating the relation between blood group and disease. Ann Hum Genet. 1955;19:251–3.CrossRefPubMed
14.
Zurück zum Zitat Pauli A, Valen E, Lin MF, et al. Systematic identification of long noncoding RNAs expressed during zebrafish embryogenesis. Genome Res. 2012;22(3):577–91.CrossRefPubMedPubMedCentral Pauli A, Valen E, Lin MF, et al. Systematic identification of long noncoding RNAs expressed during zebrafish embryogenesis. Genome Res. 2012;22(3):577–91.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Swiezewski S, Liu F, Magusin A, et al. Cold-induced silencing by long antisense transcripts of an Arabidopsis Polycomb target. Nature. 2009;462(7274):799–802.CrossRefPubMed Swiezewski S, Liu F, Magusin A, et al. Cold-induced silencing by long antisense transcripts of an Arabidopsis Polycomb target. Nature. 2009;462(7274):799–802.CrossRefPubMed
16.
Zurück zum Zitat Houseley J, Rubbi L, Grunstein M, et al. A ncRNA modulates histone modification and mRNA induction in the yeast GAL gene cluster. Mol Cell. 2008;32(5):685–95.CrossRefPubMed Houseley J, Rubbi L, Grunstein M, et al. A ncRNA modulates histone modification and mRNA induction in the yeast GAL gene cluster. Mol Cell. 2008;32(5):685–95.CrossRefPubMed
17.
Zurück zum Zitat Reeves MB, Davies AA, McSharry BP, et al. Complex I binding by a virally encoded RNA regulates mitochondria-induced cell death. Science. 2007;316(5829):1345–8.CrossRefPubMed Reeves MB, Davies AA, McSharry BP, et al. Complex I binding by a virally encoded RNA regulates mitochondria-induced cell death. Science. 2007;316(5829):1345–8.CrossRefPubMed
18.
Zurück zum Zitat Cesana M, Cacchiarelli D, Legnini I, et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 2011;147:358–69.CrossRefPubMedPubMedCentral Cesana M, Cacchiarelli D, Legnini I, et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 2011;147:358–69.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Guffanti A, Iacono M, Pelucchi P, et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC. Genomics. 2009;10:163.PubMed Guffanti A, Iacono M, Pelucchi P, et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC. Genomics. 2009;10:163.PubMed
20.
Zurück zum Zitat Khaitan D, Dinger ME, Mazar J, et al. Themelanoma-upregulated long noncoding RNASPRY4-IT1 modulates apoptosis and invasion. Cancer Res. 2011;71:3852–62.CrossRefPubMed Khaitan D, Dinger ME, Mazar J, et al. Themelanoma-upregulated long noncoding RNASPRY4-IT1 modulates apoptosis and invasion. Cancer Res. 2011;71:3852–62.CrossRefPubMed
21.
Zurück zum Zitat Qiu M, Xu Y, Yang X, et al. Ccat2 is a lung adenocarcinoma-specific long non-coding RNA and promotes invasion of non-small cell lung cancer. Tumor Biol. 2014;35:5375–80.CrossRef Qiu M, Xu Y, Yang X, et al. Ccat2 is a lung adenocarcinoma-specific long non-coding RNA and promotes invasion of non-small cell lung cancer. Tumor Biol. 2014;35:5375–80.CrossRef
22.
Zurück zum Zitat Nie FQ, Sun M, Yang JS, et al. Long noncoding RNA ANRIL promotes non–small cell lung cancer cell proliferation and inhibits apoptosis by silencing KLF2 and P21 expression. Mol Cancer Ther. 2015;14:268–77.CrossRefPubMed Nie FQ, Sun M, Yang JS, et al. Long noncoding RNA ANRIL promotes non–small cell lung cancer cell proliferation and inhibits apoptosis by silencing KLF2 and P21 expression. Mol Cancer Ther. 2015;14:268–77.CrossRefPubMed
23.
Zurück zum Zitat Liu Y, Pan S, Liu L, et al. A genetic variant in long non-coding RNA HULC contributes to risk of HBV-related hepatocellular carcinoma in a Chinese population. PLoS One. 2012;7:e35145.CrossRefPubMedPubMedCentral Liu Y, Pan S, Liu L, et al. A genetic variant in long non-coding RNA HULC contributes to risk of HBV-related hepatocellular carcinoma in a Chinese population. PLoS One. 2012;7:e35145.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Guo W, Dong Z, Bai Y, et al. Associations between polymorphisms of hotair and risk of gastric cardia adenocarcinoma in a population of North China. Tumor Biol. 2015;36:2845–54.CrossRef Guo W, Dong Z, Bai Y, et al. Associations between polymorphisms of hotair and risk of gastric cardia adenocarcinoma in a population of North China. Tumor Biol. 2015;36:2845–54.CrossRef
25.
Zurück zum Zitat Poirier F, Chan C, Timmons P, et al. The murine H19 gene is activated during embryonic stem cell differentiation in vitro and at the time of implantation in the developing embryo. Development. 1991;113:1105–14.PubMed Poirier F, Chan C, Timmons P, et al. The murine H19 gene is activated during embryonic stem cell differentiation in vitro and at the time of implantation in the developing embryo. Development. 1991;113:1105–14.PubMed
26.
Zurück zum Zitat Ariel L, Ayesh S, Periman EJ, et al. The product of the imprinted H19 gene is an oncofetal RNA. Mol Pathol. 1997;50(1):33–4.CrossRef Ariel L, Ayesh S, Periman EJ, et al. The product of the imprinted H19 gene is an oncofetal RNA. Mol Pathol. 1997;50(1):33–4.CrossRef
27.
Zurück zum Zitat Hibi K, Nakamura H, Hirai A, et al. Loss of H19 imprinting in esophageal cancer. Cancer Res. 1996;56:480–2.PubMed Hibi K, Nakamura H, Hirai A, et al. Loss of H19 imprinting in esophageal cancer. Cancer Res. 1996;56:480–2.PubMed
28.
Zurück zum Zitat Kondo M, Suzuki H, Ueda R, et al. Frequent loss of imprinting of the h19 gene is often associated with its overexpression in human lung cancers. Oncogene. 1995;10:1193–8.PubMed Kondo M, Suzuki H, Ueda R, et al. Frequent loss of imprinting of the h19 gene is often associated with its overexpression in human lung cancers. Oncogene. 1995;10:1193–8.PubMed
29.
30.
Zurück zum Zitat Zhang L, Yang F, Yuan JH, et al. Epigenetic activation of the MiR-200 family contributes to H19-mediated metastasis suppression in hepatocellular carcinoma. Carcinogenesis. 2013;34:577–86.CrossRefPubMed Zhang L, Yang F, Yuan JH, et al. Epigenetic activation of the MiR-200 family contributes to H19-mediated metastasis suppression in hepatocellular carcinoma. Carcinogenesis. 2013;34:577–86.CrossRefPubMed
31.
Zurück zum Zitat Tsang WP, Ng EK, Ng SS, et al. Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer. Carcinogenesis. 2010;31:350–8.CrossRefPubMed Tsang WP, Ng EK, Ng SS, et al. Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer. Carcinogenesis. 2010;31:350–8.CrossRefPubMed
32.
Zurück zum Zitat Luo M, Li Z, Wang W, Zeng Y, et al. Upregulated H19 contributes to bladder cancer cell proliferation by regulating ID2 expression. FEBS J. 2013;280:1709–16.CrossRefPubMed Luo M, Li Z, Wang W, Zeng Y, et al. Upregulated H19 contributes to bladder cancer cell proliferation by regulating ID2 expression. FEBS J. 2013;280:1709–16.CrossRefPubMed
33.
Zurück zum Zitat Ma C, Nong K, Zhu H, et al. H19 promotes pancreatic cancer metastasis by derepressing let-7’s suppression on its target HMGA2-mediated EMT. Tumor Biol. 2014;35:9163–9.CrossRef Ma C, Nong K, Zhu H, et al. H19 promotes pancreatic cancer metastasis by derepressing let-7’s suppression on its target HMGA2-mediated EMT. Tumor Biol. 2014;35:9163–9.CrossRef
34.
Zurück zum Zitat Barsyte-Lovejoy D, Lau SK, Boutros PC, et al. The c-Myc oncogene directly induces the H19 noncoding RNA by allele-specific binding to potentiate tumorigenesis. Cancer Res. 2006;66:5330–7.CrossRefPubMed Barsyte-Lovejoy D, Lau SK, Boutros PC, et al. The c-Myc oncogene directly induces the H19 noncoding RNA by allele-specific binding to potentiate tumorigenesis. Cancer Res. 2006;66:5330–7.CrossRefPubMed
35.
Zurück zum Zitat Lottin S, Adriaenssens E, Dupressoir T, et al. Overexpression of an ectopic H19 gene enhances the tumorigenic properties of breast cancer cells. Carcinogenesis. 2002;23:1885–95.CrossRefPubMed Lottin S, Adriaenssens E, Dupressoir T, et al. Overexpression of an ectopic H19 gene enhances the tumorigenic properties of breast cancer cells. Carcinogenesis. 2002;23:1885–95.CrossRefPubMed
36.
Zurück zum Zitat Ayesh S, Matouk I, Schneider T, et al. Possible physiological role of H19 RNA. Mol Carcinog. 2002;35:63–74.CrossRefPubMed Ayesh S, Matouk I, Schneider T, et al. Possible physiological role of H19 RNA. Mol Carcinog. 2002;35:63–74.CrossRefPubMed
37.
Zurück zum Zitat Matouk IJ, Mezan S, Mizrahi A, et al. The oncofetal H19 RNA connection: hypoxia, p53 and cancer. Biochim biophys Acta. 2010;1803:443–51.CrossRefPubMed Matouk IJ, Mezan S, Mizrahi A, et al. The oncofetal H19 RNA connection: hypoxia, p53 and cancer. Biochim biophys Acta. 2010;1803:443–51.CrossRefPubMed
38.
Zurück zum Zitat Yang F, Bi J, Xue X, et al. Up-regulated long non-coding RNA H19 contributes to proliferation of gastric cancer cells. FEBS J. 2012;279:3159–65.CrossRefPubMed Yang F, Bi J, Xue X, et al. Up-regulated long non-coding RNA H19 contributes to proliferation of gastric cancer cells. FEBS J. 2012;279:3159–65.CrossRefPubMed
39.
Zurück zum Zitat Zhang EB, Han L, Yin DD, et al. C-Myc-induced, long, non-coding H19 affects cell proliferation and predicts a poor prognosis in patients with gastric cancer. Med Oncol. 2014;31:914.CrossRefPubMed Zhang EB, Han L, Yin DD, et al. C-Myc-induced, long, non-coding H19 affects cell proliferation and predicts a poor prognosis in patients with gastric cancer. Med Oncol. 2014;31:914.CrossRefPubMed
40.
Zurück zum Zitat Verhaegh GW, Verkleij L, Vermeulen SH, et al. Polymorphisms in the h19 gene and the risk of bladder cancer. Eur Urol. 2008;54:1118–26.CrossRefPubMed Verhaegh GW, Verkleij L, Vermeulen SH, et al. Polymorphisms in the h19 gene and the risk of bladder cancer. Eur Urol. 2008;54:1118–26.CrossRefPubMed
41.
Zurück zum Zitat Gong W-J, Yin J-Y, Li X-P, et al. Association of well-characterized lung cancer lncRNA polymorphisms with lung cancer susceptibility and platinum-based chemotherapy response. Tumor Biol. 2016;37:8349–58.CrossRef Gong W-J, Yin J-Y, Li X-P, et al. Association of well-characterized lung cancer lncRNA polymorphisms with lung cancer susceptibility and platinum-based chemotherapy response. Tumor Biol. 2016;37:8349–58.CrossRef
42.
Zurück zum Zitat Riaz M, Berns EM, Sieuwerts AM, et al. Correlation of breast cancer susceptibility loci with patient characteristics, metastasis-free survival, and mRNA expression of the nearest genes. Breast Cancer Res Treat. 2012;133(3):843–51.CrossRefPubMed Riaz M, Berns EM, Sieuwerts AM, et al. Correlation of breast cancer susceptibility loci with patient characteristics, metastasis-free survival, and mRNA expression of the nearest genes. Breast Cancer Res Treat. 2012;133(3):843–51.CrossRefPubMed
43.
Zurück zum Zitat Yang C, Tang R, Ma X, et al. Tag SNPs in long non-coding RNA H19 contribute to susceptibility to gastric cancer in the Chinese Han population. Oncotarget. 2015;6(17):15311–20.PubMedPubMedCentral Yang C, Tang R, Ma X, et al. Tag SNPs in long non-coding RNA H19 contribute to susceptibility to gastric cancer in the Chinese Han population. Oncotarget. 2015;6(17):15311–20.PubMedPubMedCentral
Metadaten
Titel
Association between H19 SNP rs217727 and lung cancer risk in a Chinese population: a case control study
verfasst von
Lingling Li
Genyan Guo
Haibo Zhang
Baosen Zhou
Lu Bai
He Chen
Yuxia Zhao
Ying Yan
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
BMC Medical Genetics / Ausgabe 1/2018
Elektronische ISSN: 1471-2350
DOI
https://doi.org/10.1186/s12881-018-0573-1

Weitere Artikel der Ausgabe 1/2018

BMC Medical Genetics 1/2018 Zur Ausgabe