Background
Helicobacter pylori (
H. pylori) infection is now accepted as the major cause of chronic gastritis. In addition, several epidemiological studies have shown that
H. pylori infection is linked to severe gastritis-associated diseases, including peptic ulcer and gastric cancer (GC) [
1]. In 1994, the International Agency for Research on Cancer categorized
H. pylori infection as a group I carcinogen [
2]. Although GC is one of the most common cancers, only a minority of individuals with
H. pylori infection ever develop it. The prevalence of GC is approximately 3% in
H. pylori-positive patients [
3].
In addition to environmental factors (eg, diet) and host factors, virulence factors of
H. pylori, such as
cagA, vacA, oipA, babA, hopQ, and
homA/B, have been demonstrated to be predictors of gastric atrophy, intestinal metaplasia, and severe clinical outcomes [
4‐
10]. The most studied virulence factor of
H. pylori is
cagA, which is located at the end of an approximately 40-kb cluster of genes called
cag pathogenicity island (PAI).
cag PAI encodes a type-IV secretion system and transfers CagA protein into host cells [
11]. CagA protein is believed to have oncogenic potential [
12,
13], and
cagA-positive strains are reported to be associated with severe clinical outcomes [
14].
However, these factors are not enough to distinguish markers for severe outcomes (eg, GC) in Japan because most
H. pylori strains isolated in Japan possess these virulence factors. Likewise, our previous report showed that these genes were not virulence markers for GC in Colombia [
10]. Importantly, the presence of these genotypes correlate with each other; the
cagA-positive strain usually possesses the
vacA s1/m1 genotype, and it is further closely linked to the presence of
babA and
oipA "on" status [
14]. Therefore, we hypothesized that novel virulence genes correlate with the presence of
cagA. Although
cagA is not a distinguishing marker for severe outcomes in Japan and Colombia, the importance of
cagA has been shown in both in vitro and in vivo experiments [
14]. For example, our study showed that histological scores were significantly higher in
cagA-positive subjects than
cagA-negative ones, even in Japan [
15]. Therefore, subjects infected with
cagA-positive
H. pylori can be considered as a higher risk population than those with
cagA-negative strains, even in Japan and Colombia. However, only a minority of individuals with
cagA-positive
H. pylori infection develop severe outcomes in both countries. This suggests that other virulence factors in
cagA-positive strains are necessary to develop severe outcomes.
Previous whole
H. pylori genome microarray data revealed that several genes were associated with the presence of
cagA and/or clinical outcomes. For example, Romo-González
et al. examined 42
H. pylori strains and found that several genes were associated with gastroduodenal diseases [
16]. In addition, Salama
et al. used the microarray of 15
H. pylori strains and identified several genes that correlated with the presence of
cag PAI [
17], although they did not examine the association between these genes and clinical outcomes. However, these microarray data are not sufficient as conclusive evidence of the association due to the small sample size. Previously, we also performed whole
H. pylori genome microarray and examined 1,531 genes, including
cagA, in 56
H. pylori strains isolated from several countries [
18].
In this study, we aimed to find novel candidate virulence genes that correlate with the presence of cagA, and we examined the association of these genes with clinical outcomes in Colombian and Japanese populations.
Methods
Microarray experiments
Initially, candidate genes were selected from previous studies by Salama
et al. [
17] and Romo-González
et al. [
16]. Microarray data from 56 strains in our previous report was then used for the examination of the association of candidate virulence genes with the presence of
cagA [
18].
Patients
H. pylori strains were obtained from the gastric mucosa of H. pylori-infected patients who underwent endoscopy at Oita University Faculty of Medicine, Oita, Japan, and Universidad Nacional de Colombia, Bogota, Colombia. Presentations included gastritis, duodenal ulcer (DU), gastric ulcer (GU), and GC. DU, GU, and GC were identified by endoscopy, and GC was further confirmed by histopathology. Gastritis was defined as H. pylori gastritis in the absence of peptic ulcers or gastric malignancy. Patients with a history of partial gastric resection were excluded. Patients who received H. pylori eradication therapy or treatment with antibiotics, bismuth-containing compounds, H2-receptor blockers, or proton pump inhibitors within 4 weeks prior to the study were also excluded. Informed consent was obtained from all participants, and the protocol was approved by the ethics committees of Oita University and Universidad Nacional de Colombia.
H. pylori genotyping
Antral biopsy specimens were obtained for the isolation of
H. pylori using standard culture methods, as previously described [
19]. Chromosomal DNA was extracted from confluent plate cultures expanded from a single colony using a commercially available kit (QIAGEN Inc., Valencia, CA, USA). Two
H. pylori strains with full-sequenced genomes, 26695 (ATCC 700392) and J99 (ATCC 700824) deposited in the GenBank, were used as control strains. The
cagA status was determined by polymerase chain reaction (PCR) using primer pair 5'-ACC CTA GTC GGT AAT GGG-3' and 5'-GCT TTA GCT TCT GAY ACY GC-3' (Y = C+T), as described previously [
20]. The
vacA genotyping (s1, s2, m1, and m2) was performed by PCR, as described previously [
21,
22]. Primers for the signal region yielded a fragment of 259 bp for s1 variants and one of 286 bp for s2 variants. Primers for the middle region yielded a fragment of 570 bp for m1 variants and one of 645 bp for m2 variants.
Two primer sets for each candidate gene were designed with software Primer 3 (version. 0.4.0) based on the published sequences of
H. pylori (Table
1). Amplification of
H. pylori genomic DNA sequences was carried out in a total volume of 25 μL containing 2.5 μL of PCR buffer, 0.2 mM of each deoxynucleotide, 0.625 U of Blend Taq DNA polymerase (Blend Taq, Toyobo Co., Ltd., Osaka, Japan), 0.2 μM of each primer, and more than 10 ng of
H. pylori DNA. Each reaction mixture was amplified as follows: initial denaturation at 94°C for 5 min, which was followed by 30 cycles of denaturation at 94°C for 30 s, annealing at the indicated temperature in Table
1 for 30 s, extension at 72°C for 1 min, and then final extension at 72°C for 5 min. The amplified fragment was detected by 2.0% agarose gel electrophoresis using an ultraviolet transilluminator.
hp0967-1 | CATGGCTTTAAATGGCAACA | CCGGCATTAAATCGTTGTTT | 58 | 169 |
hp0967-2 | TAGCGTGTATTTTGGCGATG | GATAGCCGGCATTAAATCGT | 59 | 151 |
jhp0045-1 | TGGCAAAAGAGTCCAAGACA | CGTTGCAATAAAAACGCAGA | 59 | 180 |
jhp0045-2 | AAAACAACGCCTGGTATTGC | GATTGCACTTTATGCGTGTGA | 60 | 158 |
jhp0046-1 | AAGCAAGCGATAATGTCATGG | AATTGAGCGTTTTGGTGTCC | 59 | 154 |
jhp0046-2 | AGCAAGCGATAATGTCATGG | AATTGAGCGTTTTGGTGTCC | 58 | 153 |
jhp0951-1 | CAAAGCGTGAATGATTTGGA | AGATTGCGCAAGGATTTGAG | 56 | 194 |
jhp0951-2 | ATGCGTGGCTAAGCGATACT | GACCCAACGCTCTTGAAGTT | 57 | 243 |
Dot blot
For each sample, 500 ng of total DNA was added to 100 μL of TE buffer and mixed with 100 μL of a denaturing buffer (0.5 M NaOH; 1.5 M NaCl). The denatured DNA was transferred to a Hybond-N+ membrane (GE HealthCare, Piscataway, NJ, USA) by means of a Bio-Dot Microfiltration Apparatus (Bio-Rad Laboratories, Inc., Hercules, CA, USA). DNA of J99 and human DNA were also transferred to the membrane and used as positive and negative controls, respectively. The membranes were hybridized at 42°C overnight in plastic bags containing ECL Gold hybridization buffer supplemented with 5% (wt/vol) blocking agent and 0.5 M NaCl. The membranes were washed 3 times in primary washing buffer (0.5× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate] [pH 7.0], 0.4% sodium dodecyl sulfate) at room temperature for 15 min and 3 times in secondary washing buffer (2× SSC) at room temperature for 15 min. Finally, the membranes were exposed to Hyperfilm ECL film (GE HealthCare). Gene status was considered positive when at least one of the PCR reactions was positive. When gene status was considered negative by PCR, we further confirmed the results using dot-blot analyses. If PCR results yielded negative results but the dot blot showed a positive blot, we considered the samples positive.
DNA sequencing
DNA sequencing for the full length of jhp0045 (1,032 bp) was performed with several primer pairs located at jhp0044 and jhp0046. Likewise, DNA sequencing for the full length of jhp0046 (783 bp) was performed with several primer pairs located at jhp0045 and jhp0047. PCR products were purified with Centri-sep Columns (Applied Biosystems by Life Technologies, Tokyo, Japan), and the amplified fragments were sequenced with Hi-Di Formamide (Applied Biosystems by Life Technologies) using an ABI Prism 310 Genetic Analyzer (Applied Biosystems by Life Technologies, Carlsbad, CA, USA) in accordance with the manufacturer's instructions.
Statistical analysis
Variables such as gender, mean age, and the presence of each candidate gene and cagA were evaluated. The univariate association between each genotype and the clinical outcomes were quantified by the chi-square test. A multivariate logistic regression model was used to calculate the odds ratios (OR) of the clinical outcomes by including age, sex, and H. pylori genotypes. All determinants with P values of < 0.10 were entered together in the full model of logistic regression, and the model was reduced by excluding variables with P values of > 0.10. ORs and 95% confidence intervals (CIs) were used to estimate the risk. Spearman rank coefficients (r) were also determined to evaluate the association between the different genotypes of the strains. A P value of less than 0.05 was accepted as statistically significant. The SPSS statistical software package version 18.0 (IBM Corporation, Armonk, NY, USA) was used for all statistical analyses.
Discussion
Our study revealed that jhp0045 and jhp0046 were independent discriminating factors for GC from gastritis in cagA-positive cases in Colombia. This suggests that jhp0045 and jhp0046 play a role in high-risk subjects, such as cagA-positive H. pylori-infected cases.
Several genes of
H. pylori were reported as virulence factors, and these include
cagA, vacA, oipA, babA, hopQ, and
homA/B [
4‐
10]. Importantly, most virulence factors correlated with each other;
cagA-positive strains also possess the
vacA s1/m1 genotype, and this is closely linked to the presence of the
babA and
oipA "on" status [
14]. Therefore, we hypothesized that undefined novel virulence genes could exist in genes correlated with
cagA status. Although previous microarray data showed that several genes correlated with
cagA status, the sample number in these microarray reports was not enough to be conclusive (eg, [
15] strains in the report by Salama
et al. [
17]). Among the 37 genes we selected, 9 genes were significantly correlated with the presence of
cagA. In the present study, we focused on 4 genes whose functions have been revealed.
hp0967 is considered a virulence-associated protein D, and
jhp0951, which encodes an integrase of the XerCD family, has been reported to be related to modifications in the response to low pH and iron limitations [
16,
24]. The putative functions of
jhp0045 and
jhp0046 have been described as type-II DNA methyltransferase and type-II restriction enzymes, respectively [
17,
25].
Among these 4 genes,
jhp0045 and
jhp0046 were significantly associated with severe clinical outcomes in
cagA-positive cases in Colombia. Although
hp0967 has been reported to be negatively associated with DU [
16], there was no association in this study. The
jhp0951 has been positively associated with DU [
16]; however, an association was not found in this study. These findings suggest that these microarray data are not conclusive. A larger group of subjects is necessary to clarify the association.
The mechanisms of the development of GC in those patients infected with
jhp0045 or
jhp0046 are unclear, although the putative functions of
jhp0045 and
jhp0046 have been described as a type-II DNA methyltransferase and a type-II restriction enzyme, respectively [
17,
25]. In this study, most strains possessing
jhp0045 had
jhp0046. This suggests that these 2 genes may work together. This combination of a restriction enzyme and a methyltransferase is known as a restriction-modification (R-M) system [
26]. It has been reported that
H. pylori possess an extraordinary number of genes with homology to R-M genes in other bacterial species [
25,
27,
28]. However, not all R-M systems have that function. Kong
et al. reported that, among the 16 completely tested Type II R-M systems in J99, only 4 were fully functional in that they contained both active endonucleases and methylases [
29]. The
jhp0045 and
jhp0046 were included in these functional ones. Because several R-M systems are correlated with pathogenicity [
26], strains possessing
jhp0045 and
jhp0046 may be considered as truly virulent strains. Interestingly, recent reports showed that
H. pylori strains possessing
cagA from Colombia can be divide into 2 groups by 7 housekeeping genes [
30]. This grouping was related with severe histological scores and the prevalence of GC. The
jhp0045 and
jhp0046 may be a discriminating factor for this grouping. Further study is necessary in order to examine the relationship between
jhp0045 and
jhp0046 and the grouping by 7 housekeeping genes.
Only 1 change of an amino acid resulted from a point mutation of
jhp0045 in Japanese strains compared with Colombian strains and J99. It is not clear whether this difference contributed to the different results between the 2 countries. Variants of virulence factors in different areas may result in different clinical outcomes. For example,
cagA can be divided into 2 types (East-Asian-type
cagA and Western-type
cagA) according to differences in the 3' region [
6,
20,
21]. Some reports have shown that individuals infected with East-Asian-type
cagA strains have an increased risk of peptic ulcer or GC compared to those infected with Western-type
cagA strains [
31,
32]. Further studies to clarify the mechanisms or functions according to the different amino acid sequences are necessary to explain this.
Our study had several limitations. First, not only the
H. pylori virulence factors, but also environmental factors (eg, diet) and host factors have been demonstrated to be predictors of severe clinical outcomes [
33]. Especially, inflammatory cytokine gene polymorphisms (
IL-1 gene cluster,
TNF-α, IL-10, and
IL-8) have been reported to be correlated with gastric cancer [
34‐
39]. Further study will be necessary in order to elucidate the role of our candidate genes of
H. pylori. Second, we did not examine known virulence factors other than
cagA and
vacA of
H. pylori. It is possible that our candidate genes might correlate with other known virulence factors, even in
cagA-positive cases. It is better to examine host factors and other known virulence factors in order to clarify the role of our candidate genes in future studies. Finally, we examined the status of the genes by only positivity or negativity. The levels of gene expression can be affected by clinical outcomes. In addition, gene expression is not always correlated with protein expression patterns. For example, the expression of the blood group antigen-binding adhesin (BabA) protein is not always correlated with
babA gene expression [
40]. Further analysis using real-time PCR or immunoblotting techniques is necessary to clarify the significance of our candidate genes.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
Conceived and designed the experiments: MW SS YY. Performed experiments: MW OM. Analyzed the data: MW SS RS YY. Contributed reagents/materials/analysis tools: MW OM SS YY KM TF. Wrote the paper: MW SS YY. All authors read and approved the final manuscript.