Key messages
Introduction
Methods
Patients selected from the OFELY cohort
Assessment of knee OA
The miRNA analysis by next-generation sequencing
Selection of patients
NGS analysis
The miRNA analysis by real-time quantitative polymerase chain reaction
Selection of patients
Quantitative real-time PCR | |||||||
---|---|---|---|---|---|---|---|
Prevalent OA | Incident OA | ||||||
Control | Knee OA | p value | Control | Knee OA | p value | ||
Number of subjects | 42 | 43 | 25 | 23 | |||
Age (years, mean ± SD) | 68.3 ± 6.6 | 68.3 ± 6.6 | 0.77 | 67.7 ± 7.2 | 68.4 ± 8.0 | 0.72 | |
BMI (kg/m2) | 25.9 ± 4.4 | 26.6 ± 4.4 | 0.38 | 26.2 ± 5.2 | 25.2 ± 4.0 | 0.73 | |
Knee OA | KL score at baseline | 0 | 2/3 | 0 | 0/1 | ||
KL score at the end of the follow-up | 0/1 | 2/3/4 | 0 | 2/3 | |||
OA at other sites | Hip (Lane score) | 2 | 5 | 0.25 | 5 | 5 | 0.88 |
Hand (ACR criteria) | 23 | 25 | 0.75 | 11 | 7 | 0.33 | |
Spine (self-reported) | 34 | 37 | 0.67 | 20 | 21 | 0.19 |
Preselection of miRNAs
Murata K, 2010 [13] | Plasma and synovial fluid | Plasma: 30 knee OA, 30 RA, 30 CTL Synovial fluid: 30 OA, 30 RA | Plasma: OA: 75,1 yrs, 77 % ; RA: 60.1 yrs, 73%; CTL: 46,5 yrs, 57 % Synovial fluid: RA: 63,1, 80%; OA: 75,3, 80% | RA and knee OA were diagnosed according to the ACR criteria no indication of OA at other sites | |
Zhang L, 2012 [14] | Serum | Screening: 5 OA, 5 RA and 6 CTL Validation: 102 ACL and 60 CTL | 41 yrs or youngers | one year after anterior cruciate ligament injury no indication of OA at other sites | |
Okuhara A, 2012 [15] | Peripheral blood mononuclear cells | 36 OA 36 CTL | OA: 68 yrs, 81 % CTL: 32 yrs, 47 % | Knee OA ACR criteria no indication of OA at other sites | |
Borgonio-Cuadra VM, 2014 [16] | Plasma | Screening: 14 OA and 5 CTL Validation: 27 OA and 27 CTL | Screening: OA: 55.7 yrs, 71.4 % CTL: 47.5 yrs, 100% Validation: OA: 55.6 yrs, 88.9% CTL: 52.9 yrs, 81.5% | Knee OA, KL 2/3 and BMI < 27 no indication of OA at other sites | |
Beyer C, 2015 [17] | Serum | Screening: pooled serum from 13 individuals with knee/hip arthroplasty Pooled serum from 13 individuals without knee/hip arthroplasty Validation: 749 OA and 67 CTL | OA: 65 yrs, 58.2%CTL: 62.7 yrs, 49.3% | Knee/hip arthroplasty (KL 3,4) no indication of OA at other sites | |
Li YH, 2016 [18] | Synovial fluid | Screening: 4 early OA and 4 late OA Validation: 22 early OA and 26 late OA | Screening: Early OA: 51 yrs, 100 % Late OA: 64 yrs, 100% Validation: Early OA: 56 yrs, 36.4% Late OA: 60 yrs, 61.5% | Early stage OA: degenerative meniscal tears undergoing arthroscopic surgery (KL grade 1,2) Late stage OA: total knee replacement surgery (KL grade 3,4) no indication of OA at other sites | |
Soyocak A, 2017 [19] | Peripheral blood mononuclear cell | 100 patients with knee OA and 50 CTL | OA: from 47 to 70yrs, 84% CTL: from 35 to 38 yrs, 84% | Knee OA, ACR criteria no indication of OA at other sites | |
Kong R, 2017 [20] | Plasma | Screening: 8 knee OA and 8 CTL Validation: 100 OA and 100 CTL | Screening: OA: 51.13 yrs, 62.5% CTL: 50.75 yrs, 62.5% Validation: OA: 51.69 yrs, 69% CTL: 51.09 yrs, 61% | Knee OA, ACR criteria no indication of OA at other sites | |
Ntoumou E, 2017 [21] | serum | Screening: 12 primary OA and 12 CTL Validation: 12 OA and 12 CTL | Screening: OA: 69,8 yrs, 75% CTL: 64,2 yrs, 50% Validation: not indicated | Knee OA, KL ≥3 no indication of OA at other sites | |
Murata, 2010 | High pure miRNA Isolation kit (Roche) | Ncode VILO miRNA cDNA Synthesis kit (Invitrogen) | Express SYBR GreeER qPCR Supermix (Invitrogen) control: cel-miR-39 | Applied Biosystems 7300 SDS Relative Quantification 1.3 (Applied Biosystems) | Plasma miRNAs had distinct pattern from SF miRNAs miR-132: potential diagnostic marker for patients with OA or RA |
Zhang, 2012 | miRNeasy kit (Quiagen) | Validation: TaqMan miRNA reverse transcription kit (Invitrogen) + a pulsed RT reaction with a Eppendorf mastercycler (Eppendorf) | Screening: Megaplex RT human pool A and B (Applied) Validation: Preamp, TaqMan PreAmp master mix; qPCR, TaqMan qPCR assays control: U6 (Applied) | Screening: 7900HT (Applied) Validation: 7500 (Applied) SDS Relative Quantification 2.2.3 (Applied) | U38 and U48 upregulated in patients developing cartilage damage at one year after ACL injury |
Okuhara, 2012 | Trizol reagent (Invitrogen) | Thermocycler (BioRad) | TaqMan miRNA assay kit (Applied) control: U18 | Mini Opticon Real-time PCR System (BioRad) | 146, 155, 181a, 223 upregulated in OA vs CTL ealy stage: 146a and 223 higher than in late stage |
Borgonio-Cuadra, 2014 | Mini miRNeasy kit (Quiagen) | Screening: RT Megaplex Pool A on a GeneAmp PCR 9700 System (Applied) Validation: specific miRNA primer and TaqMan probes (Applied) | Screening: preamp with Megaplex PreAmp MasterMix, TLDA ver.2.0 plate A (Applied) Validation: : preamp with Megaplex PreAmp MasterMix, qPCR control: U6 | Screening and Validation: : 7900HT (Applied) | 12 miRNAs overexpressed in OA vs CTL: 16, 20b, 29c, 30b, 93, 126, 146a, 184, 186, 195, 345, 885-5p |
Beyer, 2015 | Mini miRNeasy kit (Quiagen) | Megaplex Primer Pools (Human Pools A V.2.1) (Applied) | Screening: Human TaqMan miRNA Array Card A V.2.1 (Applied) Validation: TaqMan miRNA assays (Applied) control: U6 or Ct average of all miRNA measurements for each sample | Screening and validation: 7900HT (Applied) SDS 2.2 software (Applied) and LinRegPCR software | let-7e, 454, 885-5p potential predictors for severe knee or hip OA |
Li YH, 2016 | miRCURY RNA isolation kit-biofluids (EXIQON) | Universal cDNA synthesis kit II (EXIQON) | miRNA ready-to-use PCR array (Human panel I + II, EXIQON) using ExiLENT SYBR Green master mix (EXIQON) | not indicated | 23a-3p, 24-3p, 27b-3p, 29c-3p, 34a-5p, 186-5p upregulated and 27a-5p, 329, 655, 708-3p, 934 downregulated in late stage OA ve early OA 27a-3p, 101-5p, 378-5p only expressed in late stage |
Soyocak A, 2017 | miRVana miRNA Isolation kit (Applied) | TaqMan MicroRNA Reverse transcription Kit (Applied) | TaqMan Small RNA Assays, TaqMan Gene Expression Master Mix control: U44 and 18S | qPCR system (Mx3000p, Stratagene) | miR-155: increased in OA miR-146a and miR-155 increased in the progressive stages |
Kong R, 2017 | LeukoLOCK kit (Ambion) | Screening: microarray hybridation with the GeneChip miRNA 4.0 Array (Affymetrix) Validation: TaqMan microRNA Reverse Transcription kit (Life Technologies) | Validation: TaqMan miRNA assays (Applied) control: U6 | 7900HT (Applied) | 19b-3p, 92a-3p, 122-5p, 486-5p, 320b increased in OA 19b-3p, 122-5p, 486-5p, great diagnostic value 19b-3p and 486-5p positively corretated with disease severity |
Ntoumou E, 2017 | RiboEXTMLS kit (Geneall) | Screening: miRNA complete labeling and hybridization kit (Agilent) using SurePrint G3 Human miRNA 8X60K platform (Agilent) Validation: miScript II Reverse Transcription Kit (QIAGEN) | Validation: quantification with miScript SYBR Green PCR kit and miScript Primer Assays (QIAGEN) Control: Hsa-miR-25-1 | Screening: Agilent Feature Extraction Software version 4.0.1.21 Validation: ABI 7300 Real-time PCR system (Applied) | 3 miRNAs significantly downregulated in OA patients: hsa-miR-140-3p, hsa-miR-33b-3p, hsa-miR-671-3p |
RNA isolation and miRNA RT-qPCR analysis
miR base ID | NCBI accession number | TaqMan™ Advanced miRNA Assay (ID) | Sequence of the mature miRNA (5′-3′) |
---|---|---|---|
hsa-miR-139-5p | MIMAT0000250 | 478312_mir | UCUACAGUGCACGUGUCUCCAGU |
hsa-miR-200a-3p | MIMAT0000682 | 478490_mir | UAACACUGUCUGGUAACGAUGU |
hsa-miR-1299 | MIMAT0005887 | 478696_mir | UUCUGGAAUUCUGUGUGAGGGA |
hsa-let-7e-5p | MIMAT0000066 | 478579_mir | UGAGGUAGGAGGUUGUAUAGUU |
hsa-miR-16-5p | MIMAT0000069 | 477860_mir | UAGCAGCACGUAAAUAUUGGCG |
hsa-miR-29a-3p | MIMAT0000086 | 478587_mir | UAGCACCAUCUGAAAUCGGUUA |
hsa-miR-29b-3p | MIMAT0000100 | 478369_mir | UAGCACCAUUUGAAAUCAGUGUU |
hsa-miR-29c-3p | MIMAT0000681 | 479229_mir | UAGCACCAUUUGAAAUCGGUUA |
hsa-miR-93-5p | MIMAT0000093 | 478210_mir | CAAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-126-3p | MIMAT0000445 | 477887_mir | UCGUACCGUGAGUAAUAAUGCG |
hsa-miR-132-3p | MIMAT0000426 | 477900_mir | UAACAGUCUACAGCCAUGGUCG |
hsa-miR-146a-5p | MIMAT0000449 | 478399_mir | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-184 | MIMAT0000454 | 477938_mir | UGGACGGAGAACUGAUAAGGGU |
hsa-miR-186-5p | MIMAT0000456 | 477940_mir | CAAAGAAUUCUCCUUUUGGGCU |
hsa-miR-195-5p | MIMAT0000461 | 477957_mir | UAGCAGCACAGAAAUAUUGGC |
hsa-miR-199a-5p | MIMAT0000231 | 478231_mir | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-345-5p | MIMAT0000772 | 478366_mir | GCUGACUCCUAGUCCAGGGCUC |
hsa-miR-375 | MIMAT0000728 | 478074_mir | UUUGUUCGUUCGGCUCGCGUGA |
hsa-miR-885-5p | MIMAT0004947 | 478207_mir | UCCAUUACACUACCCUGCCUCU |
hsa-miR-191-5p | MIMAT0000440 | 477952_mir | CAACGGAAUCCCAAAAGCAGCUG |
hsa-miR-222-3p | MIMAT0000279 | 477982_mir | AGCUACAUCUGGCUACUGGGU |
hsa-miR-361-5p | MI0000760 | 481127_mir | UUAUCAGAAUCUCCAGGGGUAC |
cel-miR-39-3p | MI0000010 | 478293_mir | UCACCGGGUGUAAAUCAGCUUG |
Statistical analysis
Results
Screening: serum miRNA profiling of patients with knee OA and controls
Names | Log2 fold change | p value | FDR adjusted p value | Healthy average TPM | OA average TPM |
---|---|---|---|---|---|
hsa-miR-139-5p | 0.73 | 0.0001 | 0.0434 | 90.1 | 143.3 |
hsa-miR-1299 | − 3.38 | 0.0002 | 0.0434 | 12 | 0.8 |
hsa-miR-200a-3p | − 1.88 | 0.0003 | 0.0473 | 77.2 | 29.4 |
hsa-miR-129-5p | 0.81 | 0.0022 | 0.1640 | 3.6 | 6.5 |
hsa-miR-429 | − 1.43 | 0.0023 | 0.1640 | 5.5 | 2.5 |
hsa-miR-9-5p | 0.83 | 0.0045 | 0.2410 | 3.2 | 6.1 |
hsa-miR-375 | − 0.93 | 0.0065 | 0.2795 | 737 | 411.3 |
hsa-miR-139-3p | 0.61 | 0.0072 | 0.2820 | 48.8 | 69.7 |
hsa-miR-200b-3p | − 1.18 | 0.0089 | 0.3193 | 28 | 15.7 |
hsa-miR-150-5p | 0.72 | 0.0164 | 0.4619 | 173.6 | 252.6 |
hsa-miR-192-5p | − 1.03 | 0.0171 | 0.4619 | 1837.8 | 1161.9 |
hsa-miR-155-5p | 0.52 | 0.0193 | 0.4907 | 64.9 | 87.5 |
hsa-miR-15b-3p | − 0.73 | 0.0247 | 0.5867 | 43.8 | 24.3 |
hsa-miR-1228-5p | 0.78 | 0.0295 | 0.5918 | 4.9 | 8.7 |
hsa-miR-126-3p | 0.38 | 0.0304 | 0.5918 | 3243.9 | 3976.7 |
hsa-miR-206 | 1.10 | 0.0338 | 0.6011 | 51.3 | 95.9 |
hsa-miR-199b-5p | − 0.57 | 0.0373 | 0.6011 | 29.9 | 18.6 |
hsa-miR-1246 | 0.67 | 0.0375 | 0.6011 | 29.9 | 46.9 |
hsa-miR-10b-5p | 0.46 | 0.0428 | 0.6390 | 3848.4 | 5039.8 |
hsa-miR-642a-3p | 0.69 | 0.0444 | 0.6405 | 4.5 | 7.2 |
hsa-miR-186-5p | − 0.45 | 0.0473 | 0.6405 | 777.7 | 534 |
hsa-miR-10a-5p | 0.45 | 0.0493 | 0.6469 | 2613.1 | 3361.1 |
Validation: differential expression of candidate miRNAs in serum of patients with knee OA and controls
Prevalent knee OA and miRNA-146a-5p
miR | Prevalent OA (−), median (IQR 25–75%) | Prevalent OA (+), median (IQR 25–75%) | p value | Incident OA (−), median (IQR 25–75%) | Incident OA (+), median (IQR 25–75%) | p value |
---|---|---|---|---|---|---|
126-3p | 1.08 (0.85–1.36) | 1.06 (0.89–1.30) | 0.75 | 0.89 (0.80–1.04) | 0.91 (0.73–1.23) | 0.66 |
1299 | 0.28 (0.16–1.73) | 0.33 (0.16–2.35) | 0.80 | 0.27 (0.14–11.36) | 0.34 (0.12–0.90) | 0.82 |
132-3p | 1.37 (0.71–2.12) | 0.86 (0.43–1.85) | 0.12 | 0.91 (0.63–1.19) | 1.04 (0.59–1.97) | 0.70 |
139-5p | 1.50 (0.34–3.63) | 2.09 (0.23–8.24) | 0.27 | 0.28 (0.05–1.98) | 0.81 (0.14–6.59) | 0.16 |
146a-5p | 0.85 (0.62–1.03) | 1.12 (0.73–1.46) | 0.015 | 0.83 (0.70–0.97) | 0.88 (0.62–1.29) | 0.94 |
16-5p | 0.92 (0.72–1.82) | 0.85 (0.61–1.50) | 0.35 | 0.98 (0.59–1.24) | 1.01 (0.73–1.44) | 0.33 |
184 | 0.95 (0.64–2.18) | 1.05 (0.58–2.38) | 0.86 | 0.69 (0.41–1.76) | 0.80 (0.31–1.24) | 0.89 |
186-5p | 1.09 (0.81–1.39) | 1.03 (0.79–1.31) | 0.47 | 0.82 (0.72–1.09) | 1.05 (0.82–1.46) | 0.09 |
195-5p | 0.91 (0.75–1.42) | 0.90 (0.52–1.60) | 0.50 | 0.93 (0.65–1.24) | 1.03 (0.69–1.47) | 0.42 |
199a-3p | 0.96 (0.77–1.12) | 0.93 (0.82–1.47) | 0.46 | 0.89 (0.76–0.98) | 1.00 (0.71–1.39) | 0.13 |
200a-3p | 0.84 (0.56–1.93) | 1.00 (0.58–1.57) | 0.62 | 0.72 (0.49–1.06) | 0.73 (0.48–1.43) | 0.93 |
29a-3p | 1.12 (0.76–1.44) | 1.00 (0.68–1.38) | 0.40 | 1.12 (0.63–1.35) | 0.84 (0.61–1.50) | 0.66 |
29b-3p | 1.14 (0.81–1.74) | 1.06 (0.81–1.51) | 0.38 | 1.02 (0.71–1.42) | 0.99 (0.67–1.53) | 0.93 |
29c-3p | 1.04 (0.66–1.59) | 0.91 (0.64–1.59) | 0.63 | 0.73 (0.44–1.16) | 0.86 (0.45–1.56) | 0.35 |
345-5p | 3.10 (0.10–10.01) | 2.81 (0.22–7.12) | 0.99 | 0.53 (0.05–2.11) | 1.14 (0.09–5.97) | 0.24 |
375 | 1.57 (0.20–4.05) | 1.40 (0.48–4.77) | 0.56 | 0.98 (0.26–2.99) | 0.86 (0.24–3.07) | 0.91 |
885-5p | 1.40 (0.60–2.16) | 1.16 (0.28–2.40) | 0.48 | 0.97 (0.49–2.85) | 1.54 (0.70–2.38) | 0.54 |
93-5p | 1.11 (0.79–1.51) | 0.91 (0.68–1.38) | 0.21 | 1.07 (0.79–1.17) | 1.19 (0.79–1.53) | 0.25 |
let-7e-5p | 1.15 (0.41–4.52) | 2.28 (0.64–5.83) | 0.25 | 1.36(0.78–2.72) | 1.37 (0.36–2.36) | 0.89 |