Atorvastatin inhibits the expression of RAGE induced by advanced glycation end products on aortas in healthy Sprague–Dawley rats

Bovine serum albumin (BSA) and D-glucose were dissolved in PBS (pH 7.2–7.4): the final concentrations of BSA and D-glucose were 5 g/L and 50 mmol/L, respectively. EDTA was added to a final concentration of 0.5 mmol/L to reduce oxidation. Penicillin (100 U/L) and streptomycin (100 μg/ml) were added to the reaction mixture to prevent bacterial contamination. The reaction mixture was filtered through 0.22 μm filter and then incubated at 37°C for 12 weeks.

At the end of the incubation period, the reaction mixture was dialyzed against sterilized PBS (pH 7.2–7.4) to remove the unconjugated glucose. The glucose level in the dialyzate was <0.03 mmol/L. The reaction mixture was measured in a fluorospectrophotometer with an excitation wave of 370 nm, and the maximum absorption peak was measured at 440 nm to verify that the mixture was glycated-BSA. Finally, the glycated-BSA was freeze-dried and stored at 4°C.

Male SD rats (SLRC Laboratory Animal centre, Shanghai, China) weighing 200–250 g (starting age 8 weeks) were divided into five groups. Group A ate standard chow (n = 10). Group B had a high-fat diet containing 69.13% standard chow to which we added 1.37% cholesterol, 0.5% bile salts, 9% sugar, and 20% lard. (n = 10). Group C ate the high-fat diet plus AGEs with glycated-BSA 20 mg/kg body weight per day through intraperitoneal injection (n = 10). Group D ate the high-fat diet plus AGEs with glycated-BSA 40 mg/kg body weight per day through intraperitoneal injection (n = 10). Group E consumed the high-fat diet plus AGEs with glycated-BSA 40 mg/kg body weight per day through intraperitoneal injection and atorvastatin (Lipitor, Pfizer Ireland Pharmaceuticals) 20 mg/kg/day, through intragastric administration (n = 10).

We chose SD rats as the animal models because of their normal glucose levels without obvious insulin resistance compared with the Goto Kakisaki (GK) rats used in our previous study. We chose the dose of atorvastatin mainly on the basis of our previous study [16]. As one of a series of experiments, we chose the same dose of atorvastatin for comparisons. It is higher than the human dose (1.1 mg/kg per day) recommended for treatment of hypercholesterolemia [17], but consistent with the pharmacokinetic data indicating a higher metabolic rate of the drug in rodents [18].

Body weight was measured weekly. At the end of the 12th and the 24th week, five rats per group were anaesthetised by an intraperitoneal injection of pentobarbitone sodium (100 mg/kg body weight) (Euthatal; Sigma-Aldrich, Castle Hill, NSW, Australia). Blood was collected from the left ventricle and centrifuged (6,000 × g), and plasma samples were stored at −20°C for subsequent analysis. Animals were sacrificed and the aortas were rapidly dissected and snap frozen in liquid nitrogen and stored at −80°C or stored in buffered formalin (10%, vol./vol.) for subsequent measurement. All animal experiments were conducted according to the protocol approved by the Animal Committee of the Animal Center of East Hospital, Tongji University.

Serum glucose levels were measured by the glucose oxidase method (Sigma, MO). Total cholesterol, triglycerides, LDL-C and high-density lipoprotein-cholesterol (HDL-C) levels were measured using a kit from Sigma Diagnostics. The serum levels of AGEs were determined using commercially available enzyme linked immunosorbent assay (ELISA) kits (Xitang Bio Technology Co, Shanghai, China) according to the manufacturer’s instructions.

Total RNA was isolated with the trizol method and depurated with an RNAeasy kit (Invitrogen, CA). RNA was stored at −80°C until reverse transcription was performed. An aliquot (1 μg) of extracted RNA was reverse-transcribed into the first strand of complementary DNA (cDNA) at 42°C for 40 min, using 100 U/ml reverse -transcriptase (Takara Biochemicals, Shiga, Japan) and 0.1 μM of oligo (dt)- adapter primer (Takara) in a 50 ul reaction mixture.

Real-time polymerase chain reaction (PCR) was carried out with an ABI Prism 7000 Real-Time PCR system, using the DNA-binding dye SYBER Green I for the detection of PCR products. The reaction mixture (RT-PCR kit, Takara) contained 12.5 μl Premix Ex Tag, 2.5 μl SYBER Green I, custom-synthesized primers, ROX reference dye, cDNA (equivalent to 20 ng total RNA) to give a final reaction volume of 25 μl. Primers were as follows:

GAPDH: sense 5’AGAGGAGAGGAAGGCCCCAGA 3’, antisense 5’GGCAAGGTGGGGTTATACAGG 3’;

RAGE: sense 5’GACAACTTTGGCATCGTGGA 3’, antisense 5’ATGCAGGGATGATGTTCTGG 3’.

The PCR settings were as follows: initial denaturation of 30 s at 95°C, followed by 40 cycles of amplification for 5 s at 95°C and 34 s at 60°C, with subsequent melting curve analysis increasing the temperature from 60°C to 95°C. To quantify RAGE gene expression, the RAGE mRNA level was normalized by internal GADPH mRNA.

Thoracic aorta sections were rehydrated and placed in Gill’s c2 hematoxylin (Medical reagent company, Shanghai, China) and then transferred to an eosin Y solution (Medical reagent company, Shanghai, China). After staining, the sections were dehydrated through the alcohol series back to xylene and a coverslip was mounted to each slide with Permount.

Immunostaining of AGEs and RAGE was performed using the Vectastain Elite ABC Mouse/Rabbit IgG kit based on an avidin/biotin/peroxidase system (Boster Biotechnology Co. Ltd, Wuhan, China) according to the manufacturer’s instructions. Briefly, the sections were incubated with 5% bovine serum albumin in PBS at room temperature for 30 min to block nonspecific binding of the second antibody and then reacted with the primary antibodies against AGEs (1:50, Santa Cruz Biotechnology) or RAGE (1:50, Santa Cruz Biotechnology) at 4°C overnight. Then they were exposed to the biotinylated secondary antibody at room temperature for 30 min. After washing in PBS, the specimens were incubated with an avidin-biotin-peroxidase complex at room temperature for 30 min. Deposition was visualized by treating the sections with DAB. The sections were viewed and photographed with an Olympus XI 70 microscope and digital imaging system (Olympus Optical, Tokyo, Japan). Image Pro Plus 6.0 was used to analyse the average of optical density (AOD) in the positive staining area.

Aortas were dissected and used to analyse protein levels by western blot. The lysates (30 μg protein) were separated by 10% SDS-PAGE, transferred to a PVDF membrane (Millipore), blocked with 5% non-fat dry milk for 60 min, and probed overnight with antibodies at 4°C. The blots were incubated with HRP-conjugated anti-IgG for 1 h at 37°C. We detected protein bands using chemiluminescence reagent Amersham ECL plus (GE Healthcare, Buckinghamshire, UK). Relative intensities of protein bands were analysed by Gel-Pro Analyzer software. Antibodies against RAGE (1:1000 dilution) and β-actin (1:1000 dilution) were purchased from Cell Signaling, USA.

All data were expressed as mean ± SD. Kruskal-Wallis one-way analysis of variance was used to assess the differences between groups using SPSS 13.0 software. We considered values of P < 0.05 statistically significant.

At the end of the 12th week, the body weights of rats in Groups C and D were higher as compared to other groups, but that changes were statistically insignificant. But at the end of the 24th week, a significant increase in body weight in Group D was observed (P < 0.05). Serum glucose levels and LDL-C levels were not different among all five groups at both the 12th week and the 24th week (Table 1).

Compared with Group A, there was significant increase (about double) in the serum AGEs levels in Group B at the 12th and the 24th weeks (52.85 ± 3.08 vs 25.78 ± 4.09 at the 12th week,49.91 ± 4.70 vs 21.69 ± 3.88 at the 24th week,P < 0.05). AGEs-BSA treatment induced a further increase compared with Group B, and at the 24th week, the high-dose AGEs-BSA treated group (Group D) had the highest level of all groups with statistical significance, compared to Group A (about 3.3 times as much) (72.02 ± 4.37 vs 21.69 ± 3.88,P = 0.002) and Group B (about 1.4 times) (72.02 ± 4.37 vs 49.91 ± 4.70,P = 0.009). Atorvastatin treatment reduced the serum AGEs level (Group E) compared with group D by a 26% change with statistical significance at the 24th week (53.43 ± 3.05 vs 72.02 ± 4.37,P = 0.013). AGEs levels in Group E were not significantly different compared with Group B, but still higher than Group A about double (53.43 ± 3.05 vs 21.69 ± 3.88, P = 0.006) (Figure 1).

The presence of AGEs in aortic walls was immunohistochemically examined in the tissue specimens of the aortas from the five experimental groups. There was no obvious positive immunostaining of AGEs in each group at the 12th week (Figure 2 A1-E1). At the 24th week, immunostaining of AGEs was obvious in Groups C and D (Figure 2 C2-D2), especially in Group D (Figure 2 D2). Atorvastatin attenuated AGEs accumulation significantly compared with Group D (Figure 2 E2).

Then the AOD in the positive staining area was analysed by software. At the 24th week, the accumulation of AGEs had a further increase in Group C and Group D (about double) with statistical significance, compared with Group A (2.88 ± 0.21 vs 1.53 ± 0.22,2.99 ± 0.28 vs 1.53 ± 0.22,respectively; P < 0.001) and about 1.6 times that of Group B (2.88 ± 0.21 vs 1.76 ± 0.19; 2.99 ± 0.28 vs 1.76 ± 0.19,respectively; P = 0.001). Atorvastatin reduced the presence of AGEs without statistical significance compared with Group D at the 24th week (Figure 3).

Compared with Group A, the expression of RAGE mRNA was significantly increased in Groups B, C, and D at the 12th week (P < 0.01). At the 24th week, RAGE mRNA level in Group D increased around 14 times compared with that in Group A and B (187.16 ± 16.33 vs 13.08 ± 2.34; 187.16 ± 16.33vs 13.87 ± 4.68,respectively; P < 0.01) and about 3 times with that in Group C (187.16 ± 16.33 vs 65.90 ± 8.87; P = 0.002). In the atorvastatin-treated group, however, RAGE mRNA levels were significantly downregulated to a level comparable to those observed in the normal Group A and high-fat diet Group B at the 24th week (Figure 4).

Immunohistochemistry was used to observe expression of RAGE in aortas. Both at the 12th week and the 24th week, the expression of RAGE was higher in Group B than Group A. The AGEs-BSA treated groups (C and D) had higher expressions of RAGE than Group B. At the 24th week, deeper staining and more enlarged positive areas were observed in these five groups than at the 12th week. Atorvastatin reduced the expression of RAGE, compared with Group D (Figure 5).

The quantitative determination of RAGE in aorta was detected by western blot. There were no significant differences among five groups at the 12th week. At the 24th week, the expression of RAGE was significantly higher in Groups C and D than Group A (13.04 ± 2.17 vs 1.07 ± 0.02; P = 0.023 and 16.04 ± 1.36 vs 1.07 ± 0.02; P = 0.003, respectively) and Group B (13.04 ± 2.17 vs 4.92 ± 1.98; P = 0.032 and 16.04 ± 1.36 vs 4.92 ± 1.98; P = 0.008, respectively). Atorvastatin significantly suppressed the expression of RAGE at the 24th week with about 66% decrease compared with Group D (5.45 ± 1.84 vs 16.04 ± 1.36,P = 0.008) (Figure 6).

The general morphology of aortas in all 5 groups at the 12th week and the 24th week remained relatively constant throughout the study.