Background
Breast cancer is a heterogeneous disease and TNBC is one of the most biologically aggressive subtypes [
1,
2]. TNBC represents 10–20% of breast cancer and the mainstay of therapy remains chemotherapy and no targeted therapy is currently available for it. Although TNBC patients are sensitive to adjuvant chemotherapy, the prognosis is very poor and prone to cause chemotherapy-resistant and recurrence within 3-years [
3,
4]. Therefore, to identify potential therapeutic targets, a better understanding of the biology of TNBC is needed. There is increasing evidence showed that adding targeted therapies to adjuvant chemotherapy may increase the sensitivity of residual disease, which will reduce the dose of chemotherapy necessary to kill the remaining tumor cells, thereby minimizing the toxicity of the prolonged treatment [
5,
6].
Upregulation of immune inhibitory molecules such as co-regulatory ligands/receptors and tolerogenic enzymes by cancer cells allow tumors escape from immune attack [
7,
8]. Immune checkpoint inhibitors such as PD-1 and CTLA-4 have shown prominent and durable responses in diverse malignancies [
9,
10]. B7-H4 is one of the most recently identified members of the B7 homologue family of immune co-regulatory molecules and shown to exert an immunosuppressive effect in regulation of T cell immunity through the inhibition of T-cell function, such as activation, proliferation, cytokine production and cytotoxic activity [
11‐
13]. Recently, many studies have reported that B7-H4 is implicated in various types of human tumors, including renal cell carcinoma, ovarian cancer, gastric cancer, and breast cancer, where it plays an important part in tumor progression and is associated with a poor prognosis [
14‐
17]. However, whether and how the engagement of B7-H4 by counter molecules affects the fate of B7-H4-expressing cells is poorly understood.
In this study, we investigate the prevalence and prognostic value of B7-H4 on TNBC with the clinicopathological characteristics and patients’ outcome. In addition, we also demonstrate the potential role of B7-H4 played in TNBC cells after received chemotherapy treatment. The aim of our study was to further clarify whether B7-H4 could be identified as a reliable marker for the appropriate selection of high-risk patients eligible for personal-designed targeted therapeutic agents. And whether blocking B7-H4 could be an alternative approach to avoid residual cancer cells become drug-resistant.
Materials and methods
Microarray data sources
Microarray datasets of invasive breast carcinoma (IDC) were downloaded from the Cancer Genome Atlas: Invasive Breast Carcinoma Gene Expression Data, 2011, (
http://tcga-data.nci.nih.gov/tcga/). These data were accessed via the ONCOMINE Cancer Profiling Database and used to investigate B7-H4 expression in IDC and non-IDC of breast cancer.
Patients and diagnostic criteria
Tissue samples (frozen and FFPE) were separately obtained from 65 untreated Chinese women diagnosed with TNBC at the Fourth Hospital of Hebei Medical University from January 2005 to December 2010. All cases were reviewed by two experienced pathologists, and assessed in accordance with the criterion of the world health organization (WHO) breast cancer pathology [
18]. In our study, TNBC diagnosis was determined and based on negative test results in ER, PR, and HER-2 from biopsy samples. The baseline clinicopathological data including age, tumor size, lymph node metastasis, distant metastasis, tumor grade, TNM stage, histological type, and survival information were retrieved. The TNM stage was determined based on the American Joint Committee on Cancer (AJCC) criteria and the histological grade was assessed according to the modified Bloom-Richardson classification. For these recurrence patients, the initial symptoms for patients are different, including neurological symptoms, abdominal symptoms, lung symptoms and bone symptoms, etc. Some patients discover the recurrence by themselves, while others were detected by physician examination. Breast cancer recurrence was diagnosed by radiography or discovered by tumor CA 15-3 elevation or/and CAE elevation in patients. This study was reviewed and approved by the Review Board of Fourth Hospital of Hebei Medical University. All patients gave their written and informed consent.
Cell lines and cell culture
TNBC cell lines MDA-MB-231, MDA-MB-435, MDA-MB-468 and non-TNBC cells MCF-7 and MCF-10F were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured according to the instructions from American Type Culture Collection (ATCC). Cell lines were all maintained in suitable medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. For MDA-MB-435/DOX (doxorubicin) cell culture, DOX was added in the RPMI 1640 medium to achieve the final DOX concentration of 2 μg/mL [
19]. All cell lines were maintained in antibiotic-free medium at 37 °C in a 5% CO
2 atmosphere and routinely screened for mycoplasma contamination.
Immunohistochemical (IHC) staining
For all IHC analyses, FFPE tumor samples were prepared for 5 μm slices and antigen retrieval was performed by citrate buffer solution (pH = 6) for 5 min. Endogenous peroxidase was blocked with 0.3% H2O2 in methanol for 15 min, and all slides were heated to 100 °C for 20 min and then cooled at room temperature. Non-specific binding sites were blocked by 10% bovine serum albumin (BSA) for 30 min. The slides were then washed in phosphate-buffered saline, and primary antibody against B7-H4 (diluted in 1:500) was applied for overnight incubation. On the next day, anti-mouse/rabbit IgG were added for 1 h incubation at 37 °C. Color development with DAB substrate was performed and counterstaining with hematoxylin was conducted.
Evaluation of immunohistochemical staining
Evaluation of B7-H4 staining in tumor cells was evaluated by authorized pathologists who had no knowledge of the patients’ clinical status and outcome. B7-H4 expression scores were given separately for the stained area and for the intensity of staining. Quantification was made as follows; ≤ 25% of the cancer cells: 1, > 26% to ≤ 50% of the cancer cells: 2, > 51% to ≤7 5% cancer ce cancer cells: 3, > 76% of the cancer cells: 4; intensity of staining: absent/weak: 1, moderate: 2, strong: 3. Each section had a final grade that derived from the multiplication of the area and intensity scores. The final B7-H4 staining score was calculated using the percent of positive cell score × staining intensity score ranging 0–12. The final scores ≤ 4 was classified as tumors with low B7-H4 expression, whereas sections with a final score of > 4 were classified as tumors with high B7-H4 expression.
In vitro growth inhibition
Cells (1 × 104 cells) were initially plated in triplicate in 96-well culture plates. Twenty-four hours later, the medium was replaced with fresh medium with or without different drugs and incubated for indicated time. Cell viability was determined by CCK-8. In order to detect the effects of B7-H4 in cell proliferation, B7-H4 mAb (MIH43, ab110221) and its isotype control mAb IgG1 (RM106, ab190481) were purchased from abcam company and perform the cell growth assay. The absorbance value at 450 nm was read using a microplatereader (Bio-Rad, CA, USA).
Transient transfection of B7-H4 overexpressing or silencing plasmid
To further analyze the role of B7-H4 in TNBC, we transfected TNBC cells with the B7-H4 cDNA (Origene, Inc) or B7-H4 siRNA (Origene, Inc) using Lipofectamine
3000 (Invitrogen, CA). In brief, about 3 × 10
5 cells were seeded per well in a 6 well plate. After 24 h, the cells were transfected with 1.5 μg of cDNA or siRNA plasmid for 6 h, and the media were replaced with fresh growth medium. At 48 h after transfection, cells were harvested for analysis. The silencing or overexpressing effects of B7-H4 in TNBC cells were detected and confirmed (Additional files
1,
2).
Total RNA was extracted from cell lines and freshly frozen samples with TRIzol reagent (Invitrogen, USA) and was reverse-transcribed with the first strand cDNA synthesis kit (Invitrogen). Real-time PCR reactions were conducted using SYBR Premix Ex Taq II (Takara). Reverse transcriptase was used as the negative control, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control. All experiments were repeated three times. The PCR primers used in this study were as follows: B7-H4 (F5′: AGGGAGTGGAGGAGGATACAG, R5′: GCAGCAGCCAAAGAGACAG), GAPDH (F5′: CACCATCTTCCAGGAGCGAG, R3′: GACTCCACGACGTACTCAGC).
Quantification of apoptosis by ELISA kit
An apoptosis ELISA kit (Roche Diagnostics Co.) was used to quantitatively measure cytoplasmic histone–associated DNA fragments. After treatment with different concentration of DOX or B7-H4 mAb MIH43 (5 or 10 μg/mL) up for 72 h, cells were analyzed by following manufacturer’s protocol. Each experiment was repeated three times.
Western blot analysis
Protein from TNBC tissue samples and cells were separated by SDS-PAGE and then electro-transferred onto nitrocellulose membrane (Bio-Rad). The primary antibodies used included antibodies to B7-H4, PARP, Caspase-3, Caspase-7, Caspase-9, PETN, p-PI3K, PI3K, p-AKT, AKT and GAPDH were purchased from Abcam company. Membranes were probed with indicated antibodies by following the manufacturer’s protocol, and immunoreactive bands were visualized by using ECL Western Blotting Substrate (Pierce Biotechnology, Inc.). Each experiment was repeated three times.
Statistical analysis
Results are reported as mean ± SD. All the experimental data were analyzed by the SPSS 20.0 statistical software package. The Mann–Whitney U test, χ2 test, Pearson Chi square test or Spearman rho test were performed for comparative statistical evaluations among groups and for correlation analysis with histological and clinical parameters (age, gender, tumor stage, tumor grade, and postoperative survival). Survival periods were counted in months from the date of first visit to date of death or last follow-up before study closure. We used Kaplan–Meier method to estimate the overall survival for low and high levels of B7-H3 expression. A p value < 0.05 was considered as statistically significant.
Discussion
Evading the antitumor immunity is crucial for the development and progression of cancer [
26,
27]. Understanding the dynamic interaction between tumors and the immune system is impendent for the advance of a new cancer immunotherapy [
28,
29]. B7-H4 was identified to be one of the fellow B7 family members in 2003, and shown to bind a currently unknown receptor(s) on activated T cells thus resulting in inhibition of T cell effector function in vitro [
13,
30]. B7-H4 mRNA is widely expressed in nonlymphoid tissues [
31], but its protein expression is largely absent in most normal human somatic tissues, with the exception of epithelial cells from the female genital tract, lung, kidney and pancreas [
30]. Abnormal overexpression of B7-H4 was reported in a variety of malignancies including lung, ovarian, breast, prostate, and esophageal cancers [
32‐
36]. B7-H4 is a ligand within the B7 family that has been implicated as a negative regulator of T-cell-mediated immunity, and its expression was inversely related the number of tumor infiltrating T cells [
37,
38]. Although the mechanism is still not clear, it is proposed that B7-H4 might employ to evade the host immune system by regulating the differentiation of T cells. The most current literature supports that B7-H4 is a potential negative prognostic indicator for many tumors and could aid in transforming pre-cancerous cells and then protecting them from immunosurveillance [
39]. However, in Rahba’s study, he found that reduced MHC I expression and granzyme B expression in CD8
+T cells infiltrating tumors were detected in B7-H4
−/− background mice, together with other evidence showed that B7-H4 expression was not necessary for tumor development but could limit the mammary tumor growth [
34,
40]. Collectively, the role of B7-H4 in immune evasion in the cancer microenvironment is yet to be elucidated, especially in breast cancer. Therefore, we want to further study the expression pattern of B7-H4 in TNBC and its potential mechanism.
In this study, we used Cancer Genome Atlas Microarray Database to predict that B7-H4 transcript was dominantly increased in the subtype of invasive breast carcinoma. In the following study, we found that B7-H4 expression was elevated in TNBC cell lines and TNBC patients compared with non-TNBC cells and adjacent non-tumor tissues breast cancer patients and that increased B7-H4 expression was associated with advanced TNM stage and the tendency of metastasis and recurrence. In addition, there was a reverse correlation between the expression of B7-H4 and AR and the outcome of patients. These findings indicate that B7-H4 expression might be linked to more aggressive subtypes of breast cancer and are consistent with previous studies reporting that B7-H4 expression is associated with a poor prognosis in oral squamous cell carcinoma [
41], non-small cell lung cancer [
42], renal cell carcinoma [
43], and glioma [
44]. TNBC is a very aggressive subtype of breast cancer due to its lack of the hormonal receptors as well as HER-2 and thus unresponsive to hormonal therapies such as ER/PR antagonists or trastuzumab therapies. Till now, chemotherapy is still the first line treatment of TNBC, however, resistance, relapse, poor response rate and toxicity are common companies associated with chemotherapeutic drugs. Although Leong et al. [
45] devised an antibody–drug conjugates against B7-H4 to treat patient-derived xenograft models of triple-negative breast cancer, however, whether chemotherapy could upregulate B7-H4 upregulation and lead to cancer cells become drug-resistant have not been completely studied and reported yet. In our study, we found that B7-H4 expression levels were abnormally overexpressed on the samples of recurrence TNBC patients after neoadjuvant chemotherapy treatment, which indicated that neoadjuvant chemotherapy might induce B7-H4 upregulation. And the increasing rates of local recurrence were noted as the intensities of B7-H4 expression strengthened. Therefore, it might be highly suggested that blocking B7-H4 could be an alternative to to increase the efficacy and reduce the toxicity of the chemotherapeutic drugs.
B7-H4 is a well-defined transmembrane protein, containing one signal peptide and hydrophobic transmembrane domain uniquely anchored to the cell membrane via a GPI linkage [
13,
46,
47]. However, some tumor cells were shown to express B7-H4 protein in different subcellular distributions [
48,
49]. In our study, we found that B7-H4 protein was shown intense circumferential membranous and cytoplasmic expression in most TNBC cells. So far, the mechanisms and functional implications of B7-H4 subcellular localization remain unclear. Therefore, we selected typically monoclonal antibody MIH43 of B7-H4 for detecting its potential functions. Among the selected TNBC cell lines, the human MDA-MB-435 cell line used in our study was testified to have the highest B7-H4 expression and closely similar to those with MDA-MB-231 and MDAMB-468 breast cancer cells [
50,
51]. In this study, we examined the role of B7-H4 in doxorubicin resistance of TNBC cells. Results showed that mAb MIH43 resulted in increased cell growth inhibition of DOX-resistant MDA-MB-435 cells and the parental MDAMB-435/WT cells. In addition, treatment of mAb MIH43 with could enhance the sensitivity of both two cell lines to paclitaxel in a significant manner. Our findings show that targeting B7-H4 could counteract cellular resistance to doxorubicin, and increase the sensitivity to paclitaxel in TNBC cells. Furthermore, in attempts to elucidate the mechanisms underlying the observed effects, we obtained the evidence from a series of functional experiments.
In order to completely elucidate the function of B7-H4, the knockdown and overexpression of the B7-H4 plasmids were constructed respectively. Our finding showed that the apoptotic rate was increased 1.5-fold of TNBC cells sensitive to doxorubicin when B7-H4 was knockdown. Previous investigations showed that breast cancer with axillary lymph node metastases was associated with the abnormal suppressor gene PTEN, which could play a negative regulatory role in the PI3K/Akt signaling pathway [
52,
53]. Furthermore, Basho et al. [
54] reported that the PI3K/Akt pathway is the major frequently dysregulated pathways in TNBC, which favors the metaplastic TNBC for its transcriptional profiling as the mesenchymal subtype. Interestingly, we found that downregulation of B7-H4 restored the expression of PTEN and reduced phosphorylation of both PI3K and AKT, whereas overexpression of B7-H4 activated PI3K/AKT signaling. This may explain why the B7-H4 knockdown TNBC cells became more prone to doxorubicin-induced apoptosis, and the findings are in accordance with reports showing induction of apoptosis following a blockade of PTEN signaling in multiple cancers [
55‐
57]. On the basis of these findings, we investigated the effects of B7-H4 knockdown on PTEN/PI3K/Akt-regulated genes involved in mitochondrial-pathway apoptosis. The increased expression of cleaved-PARP, cleaved-Caspase-3, cleaved-Caspase-7 and cleaved-Caspase-9 fragmentations in B7-H4 siRNA-transfected cells than in control MDA-MB-435/WT cells, whereas the effects could be counteracted by overexpression of B7-H4.
Authors’ contributions
CY collected clinical samples and their information. XBL and LW performed the cell experiments in vitro. LW contributed to the design of the experiments and analyze all the data. FBK helped design the experiment, provided materials and revised the manuscript. All authors read and approved the final manuscript.