Background
Colorectal cancer (CRC) is the third most common cancer with 1.2 million new cases and 0.6 million deaths per year worldwide and is frequently diagnosed at advanced stages [
1]. In United States, during 2009 to 2013, the incidence rates of colon cancer were 46.9 and 35.6 per 100, 000 for male and female. Moreover, 17.7 and 12.4 per 100, 000 for male and female were death to colon cancer [
2]. The high incidence, high fatality rate and poor prognosis of CRC make it a disease that seriously influences people’s health. The efficacy of current therapies including endoscopic removal of precursor lesions and chemotherapeutic treatments are limited for CRC treatment [
3]. Therefore, searching for more effective anticancer agents is urgent for CRC therapy. Warburg effect was discovered in 1930s and widespread in solid tumor cells such as colorectal cancer, breast cancer and liver cancer and so on. Warburg effect is one of the most fundamental metabolic alterations during tumor development and progression, of which the over-expressed hexokinase 2 (HK2) plays a crucial role in glycolytic pathway [
4‐
6]. HK2 is the enzyme controlling the first step of glycolysis, and systemic deletion of HK2 can impair the tumor progression in mouse models. Moreover, the expression level of HK2 distinguishes cancer cells from normal cells, which provides exciting opportunities for the development of therapeutic strategies to preferentially kill cancer cells [
7‐
9].
Although HK2 is a novel anti-tumor target, there are few potent HK2 inhibitors identified. Nowadays, Metformin (Met), 2-Deoxyglucose (2-DG) and 3-Bromopyruvate (3-BrPA) are most commonly reported HK2 inhibitors. Met, a widely used anti-diabetic drug, is confirmed that it also exerts anti-tumor effect on several cancers [
10‐
15]. Owing to the weak effect of Met in vitro or vivo, a series of novel Met derivates are synthesized, aiming at improving the antitumor activity [
16]. 2-DG is a product-mediated HK2 inhibitor but it does not have significant therapeutic activity at the dose range of 500-2000 mg/Kg in mice as a single agent [
17]. As for 3-BrPA, which is a halogenated pyruvate and strong alkylating agent toward the free SH groups of cysteine residues in proteins, it is not surprising that it may affect multiple enzymes and causes unavoidable side-effects. In addition, 3-BrPA is unstable and only exhibits the inhibition of glycolysis at a high concentration [
18]. Because of the poor effect and side-effects of these compounds, developing novel potent HK2 inhibitors for treatment of CRC or other cancers is a matter of great urgency. So in our study, structure-based virtual ligand screening method was adopted to screen the FDA-approved drug database and Benserazide (Benz) was identified as an HK2 inhibitor. Benz, a peripheral dopadecarboxylase inhibitor, was often used in combination with levodopa for the treatment of Parkinson’s disease. The definite pharmacokinetics, pharmacodynamics and low toxicity of Benz largely encouraged the developing of Benz or its derivatives as anti-tumor agents.
Methods
Reagents
Benz for injection was purchased from Dalian Meilun Biology Technology Co., Ltd (China). The glucose-6-phosphate dehydrogenase (G6P-DH) was purchased from “Roche” (Switzerland). Antibodies against Hexokinase 2, AMPKα and p-AMPKα were obtained from “Cell Signaling Technology” (USA). And β-actin, Bcl-2, Bax and horseradish peroxidase (HRP) conjugated secondary antibody from rabbit were purchased from Wuxi UcallM Biotechnology Co., Ltd (China). Recombinant HK1 protein was obtained from Shanghai yuanye Bio-Technology Co., Ltd (China). All other common chemicals, solvents and reagents were of highest grade available from various commercial sources.
Preparation of nano-particles of Benz
Firstly, HSPC/Chol (molar ratio 55:45) was putted into CHCl3 and dried to a thin film on a rotary evaporator. Then the dried lipid mixture and Benz were rehydrated in phosphate buffer (PBS, pH 4.0) at 60 °C for 1 h in flowing nitrogen. The suspended vesicles were extruded through the 200 nm and 100 nm pore-size polycarbonate membranes at least five times using a Lipex extruder (Canada), and then purified by size exclusion chromatography to remove free Benz.
Freeze-drying of liposomes
The laboratory freeze drier (Germany) was applied for freeze-drying and detailed process was as follows: (1) freezing at -40 °C for 8 h; (2) primary drying at -40 °C for 48 h; (3) secondary drying at 25 °C for 10 h. And the chamber pressure was maintained at 20 pascals during the drying process. HPLC was used to measure the concentration of the Benz. The mean diameter and polydispersity index (PDI) of liposomes were determined by Nano Brook Zeta PALS (Brookhaven Instruments Corporation, USA), based on the dynamic light-scattering principle technique.
Expression and purification of HK2 and HK4
Genes encoding HK2 (Genebank: BC021116.1) and HK4 (Genebank: BC001890.1) were cloned into pET-26b vector respectively. The sequence-verified recombinant plasmids were transformed into E. coli BL21 (DE3) (Invitrogen) and then cultured in LB medium at 37 °C, induced by 0.4 mM isopropyl-D-thiogalactopyranoside (IPTG) at 20 °C for 24 h. Subsequently, bacterial suspension was harvested and lysed by ultrasonification. After high speed centrifugation, the protein was purified with Ni-agarose affinity chromatography, followed by anion exchange chromatography and size exclusion chromatography.
In vitro enzyme inhibition assay
To assay the inhibitory effects of Benz on HK2, HK1 and HK4, NADH which was generated through a coupled reaction with glucose-6-phosphate dehydrogenase (G6P-DH) was detected at 340 nm. Briefly, 10 μL recombinant HK2 (1 μM), HK4 (1 μM) or HK1 (1 μM) was incubated with 5 μL Benz at 37 °C for 10 min. Then 85 μL assay mix containing 100 mM Tris HCl pH 8.0, 5 mM MgCl2, 200 mM Glucose, 0.8 mM ATP, 1 mM NAD+, 0.25 Units of G6P-DH, was added. The enzyme inhibition IC50 values for Benz were calculated based on the changes in absorbance. No Benz interference with G6P-DH activity was observed.
Microscale thermophoresis (MST) assay
MST was used to analyze the binding affinity between potential ligands and receptors. The purified HK2 was labeled with the Monolith NT™ Protein Labeling Kit RED (Cat # L001) according to the supplied labeling protocol. Labelled HK2 was kept constant at 20 nM, and all tested samples were 1:1 diluted in a 20 mM HEPES (pH 7.4) and 0.05 (v/v) % Tween-20. After 10 min incubation at room temperature, samples were loaded into Monolith™ standard-treated capillaries. And the thermophoresis was measured at 25 °C after 30 min incubation on a Monolith NT.115 instrument (Germany). Furthermore, laser power was set to 20% or 40% using 30 sec on-time. The LED power was set to 100%. The dissociation constant Kd values were fitted by using the NTAnalysis software.
Molecular docking
Crystal structure of human HK2 (PDB code: 2NZT) was obtained from the Protein Data Bank. The docking was operated by ICM 3.8.2 modeling software on an Intel i7 4960 processor (MolSoft LLC, San Diego, CA). And ligand binding pocket residues were selected by graphical tools in ICM software to create the boundaries of docking search. The glucose was the co-crystallized ligand in this crystal structure for docking, and it was deleted when setting up the receptor. In docking calculation, potential energy maps of the receptor were calculated using default parameters. Compounds were inputted into ICM and an index file was created. Conformational sampling was based on the Monte Carlo procedure30, and finally the lowest-energy and the most favorable orientation of the ligand was selected [
19,
20].
Cell cultures
Human colon cancer cells SW480 (ATCC # CCL-228™) were obtained from the American Type Culture Collection (ATCC, USA). Human colon cancer cells (HCT116, Lovo), human breast cancer cells (MCF-7), human hepatoma carcinoma cells (SMMC-7721), human hepatic cells (LO2) and african green monkey kidney kidney cells (Vero) were purchased from BOSTER (Wuhan, China) and cultured in high Glucose Dulbecco’s modified Eagle’s medium supplemented with 2 mM glutamine, 10% (v/v) fetal bovine serum (FBS), 100 U/mL penicillin and 100 mg/mL streptomycin. Cell cultures were grown and maintained at 37 °C in the humidified tissue culture incubator with 5% CO2 using standard tissue procedures.
Cytotoxicity test
Cancer cells (SW480, Lovo, HCT116, MCF-7, SMMC-7721) and normal cells (LO2, Vero) were incubated with 0-500 μM Benz for 48 h and the cytotoxicity of Benz was measured using a Cell Counting Kit-8 (CCK-8). Met was used as a positive control. All experiments were performed in triplicate.
Cell proliferation assay
HCT116 and SW480 cells were seeded at a density of 2 × 103 per well into 96-well plates. Cell proliferation was assessed by incubating them with Cell Counting Kit-8 reagents (Dojindo, Shanghai, China) for 24 h,48 h, 72 h, 96 h at 37 °C and measuring the absorbance at 450 nm. The experiment was performed in triplicate.
HK2 siRNA in SW480 cancer cells
SW480 cells were transfected with either two siRNAs against HK2 or one nontargeting siRNA and cultured in 6-well plates according to the manufacturer’s instructions. The target sequences of oligo siRNAs were as follows: siRNA: 5'- CCAAAGACATCTCAGACATTG -3', nontargeting siRNA (Negative control, NC): 5'- UUCUCCGAACGUGUCACGUTT -3' [
21].
Western blot analysis
The harvested cells were lysed with radioimmunoprecipitation assay (RIPA) buffer (Beyotime, China). Insoluble debris was removed by centrifugation and the concentration of total proteins was determined using BCA Protein Assay Kit (Beyotime, China). Then lysate protein (20-40 μg) was subjected to 10% SDS-PAGE and electrophoretically transferred to polyvinylidene difluoride membranes (PVDF) (Millipore, USA). The membranes were sequentially blocked with 5% non-fat milk and incubated overnight with the following primary antibodies: β-actin (A2228), HK2 (#2867), Bcl-2 (DR0564), Bax (DR0549), AMPKα (#5832), p-AMPKα (#2535). Protein bands were visualized using an enhanced chemiluminescence reagent (ECL Plus) (GE Healthcare, USA) after hybridization with a HRP conjugated secondary antibody. All experiments were performed in triplicate and analyzed by optical density.
Glucose uptake assay
The Glucose Assay Kit (Rsbio, Shanghai, China) was used to analyse the glucose uptake. After 48 h drug treatment, media was collected and diluted within water. The amount of glucose in the media was then detected. Glucose uptake was determined by subtracting the amount of glucose in each sample from the total amount of glucose in the media (without cells). Met was used as a standard control in this assay.
Determination of lactate generation
After 48 h drug treatment, media was collected and assayed following the manufacturer’s instructions of Lactic Acid Production Detection kit (KeyGen, Nanjing, China) to measure the generation of lactic acid. The assay was determined using a plate reader (Synergy HT, BioTek, USA) at 530 nm. Met was used as a positive control.
Measurement of intracellular ATP level
Benz-treated (75, 150, 300 μM for 48 h) and Met-treated SW480 cells were harvested and sonicated in ice three times for 1 min. After centrifugation, supernatants were assayed by ATP assay kit (KeyGen, Nanjing, China) to determine the generation of ATP. The assay was determined using the plate reader (Synergy HT, BioTek, USA) at 636 nm.
Flow cytometric analysis for apoptosis
SW480 cells were cultured in six-well plates and treated with different concentrations of Benz for 48 h. Then the cells were harvested, washed twice with ice-cold PBS, and mixed in 100 μL of 1× binding buffer (10 mM HEPES/ NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2). After culturing for 15 min at room temperature in Annexin-V/PI double staining liquid (Nanjing KeyGen Biotech. Inc.), the cells were examined by flow cytometry (BD Biosciences, FACSCalibur).
JC-1 staining to determinate mitochondrial membrane potential
SW480 cells were plated in six-well plates and given various concentrations of Benz treatment for 48 h. After staining with 10 μg/mL JC-1 (JC-1 Mitochondrial Membrane Potential Detection Kit; Beyotime) for 20 min in the incubator (37 °C, 5% CO2), cells were rinsed with HBSS twice to remove the nonspecific background staining. Then cells were analyzed using a flow cytometer (BD Biosciences, FACSCalibur), and cells emitting a bright red fluorescence represented the aggregate mitochondria.
About 0.6% agar was poured into the six-well plate. After solidification, 6 × 104 SW480 cells, which were resuspended in 1 mL of 0.3% agar, were overlayed onto the bottom agar and treated with Benz at different concentrations. Media was changed every three days, and colonies were further observed for 10 days. Colonies were then stained with 0.01% of crystal violet staining solution for 2 h.
Antitumor efficacy of Benz in xenograft mouse model in vivo
All animal experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals of Tongji Medical College, Huazhong University of Science and Technology and approved by the Ethics Committee. CB-17/ SCID mice (male, 4 weeks old) were purchased from Beijing HFK Bioscience CO., LTD (Beijing, China). SW480 cells were inoculated subcutaneously (3 × 106 cells) into the left flank of each mouse. Six days later, mice were randomly divided into six groups and were injected i.p. daily for 16 days with one of the following treatments: (1) natural saline group (n = 10); (2) 300 mg/Kg Benz (n = 10); (3) 600 mg/Kg Benz (n = 10); (4) vehicle group (n = 10); (5) 100 mg/Kg liposomal Benz-treated group (n = 10); (6) 200 mg/Kg liposomal Benz-treated group (n = 10). The dose volume was 0.1 mL/10 g body weight, and the weights of mice were recorded every day. Meanwhile, the tumor volumes were measured with vernier calipers and calculated by the following formula: (A × B2)/2, where A was length and B was width of the two-dimension tumor. After animals were sacrificed, tumor weights were measured. The inhibition ratio (%) was calculated using the following equation: I% = 100% × [Wtumor (vehicle) − Wtumor (treated)]/Wtumor (vehicle)
Detection of free Benz in tumor tissue
After recording the weights of tumor mass, tumor tissues from 600 mg/Kg Benz-treated group and 200 mg/Kg liposomal Benz-treated group were lightly washed and blotted to remove any excess blood. Then tumor tissues were homogenized and extracted with methanol, and 100 μL of the extracts were then subjected to HPLC assay. HPLC analysis was conducted by using a reverse phase column (Restek C18 5 μm, 250 mm × 4.6 mm) with a mobile phase of methanol-water- trifluoroacetic acid (20: 1000: 1). Free Benz was detected by measuring the absorbance at 220 nm.
TUNEL and H&E staining assay
Apoptosis of tumor tissues was detected by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) stain, using an In Situ Cell Death Detection Kit (Roche, Switzerland). The hematoxylin-eosin (H&E) staining was performed to observe the pathological changes in different groups.
Discussion
Benz, an FDA-approved decarboxylase inhibitor for adjuvant treatment of Parkinson’s disease, herein was reported to suppress tumor growth by inhibiting HK2. Previous studies revealed that shutting down glucose flux at the earliest step in glucose metabolism by targeting HK2 could be an ideal strategy for cancer therapy [
29]. The highly dependency of tumor cells proliferation on accelerated glucose metabolism made them more vulnerable and sensitive to the disturbance of glucose metabolism. Among enzymes involved in glucose metabolism, HK2 played a prominent role in glycolysis. Given its key position in glycolysis catalytic chain and selective overexpression in cancer cells, HK2 provided an attractive target for antitumor drug discovery. However, few HK2 small-molecule inhibitors were discovered due to the extreme polarity of the active site of HK2 and the complexity of its protein functions [
30]. Therefore, finding new HK2-targeting candidates is urgent for cancer treatment.
Compared to the ever-increasing failure rates, high cost, and limited efficacy of traditional drug screening approaches, drug repurposing via the analysis of FDA-approved drug was an effective method to identify therapeutic opportunities in cancer and other human diseases [
31,
32]. For instance, Sorafenib, a well-known FDA-approved antitumor drug, was identified to be a 5-HT
2A inhibitor. Consequently, this compound, as well as other Sorafenib like analogues, had been proposed as potential 5-HT inhibitors [
33]. Structure-based virtual ligand screening is a computational method that docks small molecules into the structures of macromolecular targets and scores their potential complementarity to binding sites [
34]. Along with great advances in both computational algorithms and computer processing power, this approach is widely used in hit identification and lead optimization. Thus, the combination of structure-based virtual ligand screening and drug repositioning represents an efficient approach to accelerate drug discovery. Because of the verified bioavailability and safety evaluation of approved drugs, the obtained hits have higher probability to enter clinical trials than a new chemical entity.
Benz was identified as an HK2 inhibitor. Besides targeting the decarboxylase, Benz showed inhibitory effect against Coxsackievirus B3 3C protease [
35]. Recent studies reported that the pretreatment of Benz enhanced the base-excision DNA repair of oxidative DNA damage in the presence of mutant breast cancer susceptibility gene 1 (BRCA1) [
36]. However, the potential mechanisms of these observations remained an area of investigation. In our study, molecule docking result showed that the pyrogallol moiety of Benz occupied the glucose-binding pocket through H-bond interactions and adopted a similar conformation of the substrate glucose. Moreover, in vitro enzymatic inhibition assay and the MST binding assay further conformed the specific targeting of Benz to HK2.
HK1 is highly expressed in normal tissues of the human body, and its distribution is wider than that of HK2 (only expressed in cancer cells). In our in vitro studies, 5.52 μM of Benz can inhibit half of HK2, but it required much more drugs to reach the same extent of inhibition for HK1 and HK4. These results suggested the reasonable selectivity and significant inhibitory activities of Benz. That is to say, when effective concentration of Benz was reached, it was still not enough to significantly decrease the activity of HK1 and HK4, so Benz should not have potentially cytotoxic effects on normal tissues. Furthermore, HK2 siRNA experiments in our study validated the cytotoxicity of Benz was mediated directly by targeting HK2.
As far as we know, Benz had a better binding affinity and efficacy than other known HK2 inhibitors, representing the most potent HK2 inhibitor so far. Furthermore, HK2 located on the outer membrane of mitochondria and contributed to the evasion of apoptosis and the stability of MMP. Consistent with reported studies [
5], our data suggested that Benz had the ability to cause an increased loss of MMP and thus induced apoptosis in SW480 cells.
To further improve the antitumor efficacy and tumor targeting of Benz, nano-particles of Benz was prepared. And our results performed that liposomal Benz at the dose of 100 and 200 mg/Kg exhibited potent inhibitory effect on tumor-bearing mice, showing reduced dose and better efficacy. The results showed that the administration dose of free Benz was three times of that of liposomal Benz, but the drug concentration in tumor tissues was much less. If the liposomal NPs only improved the transport efficiency of free Benz, the distribution of Benz in normal tissues should be equal to that of in tumor tissues. However, this may not be true because the higher concentration of the drug was unable to achieve in tumor tissues when the administration dose was only 1/3 of free Benz. So these results suggested that nano-particles of Benz not only further improve the antitumor efficacy but also enhance tumor targeting of Benz.
Benz, as an existing drug with low toxicities, its favorable drug absorption, distribution, metabolism, excretion and toxicity (ADMET) properties made it easy for Benz to expand indication as the antitumor agent. In combination with other anticancer drugs, Benz would reduce the dose of chemotherapy drugs and thus alleviate toxicities and adverse effects. The identification of Benz as a HK2 inhibitor will pave the way for the development of Benz analogues as novel antitumor agents.