Background
Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders, affecting 4–10% of the women of reproductive age [
1,
2]. The clinical symptoms of PCOS include irregular menstrual cycles, infertility, hirsutism, acne, insulin resistance (IR), and hyperandrogenemia [
3]. PCOS is associated with obesity, diabetes, hypertension, endometrial cancer, and cardiovascular disease [
4‐
7]. Some adverse symptoms of PCOS can be ameliorated by regulating the menstrual cycle (oral contraceptive), by reducing blood testosterone levels (glucocorticoids), by improving IR (metformin), and by inducing ovulation (clomiphene) [
8,
9]. However, long-term drug treatments may result in gastrointestinal discomfort, diarrhea, and other serious side effects that adversely affect the patient’s standard of living. Therefore, the development of alternative treatment strategies for women with PCOS is urgently needed.
In recent years, increasing evidence has shown that natural plant-based products may play a role in the treatment and management of PCOS [
10,
11]. Berberine (BBR), a small molecule alkaloid isolated from plants, is the major active component of the Chinese herb rhizoma coptidis (Huanglian) [
12]. BBR has a variety of pharmacological properties, including anti-inflammatory, antimicrobial, glucose- and cholesterol-reducing, anti-cancer, and immunomodulatory activities [
13‐
15]. A study by Zhang et al. showed that BBR prevented obesity and IR in high-fat diet (HFD)-fed rats by partially modulating the gut microbiota composition [
16]. Additionally, another study indicated that the intake of BBR in the short term improved some metabolic and hormonal disorders in women with PCOS, and its related effects might be associated with the changes in body composition in obesity and dyslipidemia [
17]. However, the mechanisms of BBR in women with PCOS are currently unclear.
Therefore, in this study, a PCOS rat model was established by injecting rats with dehydroepiandrosterone (DHEA), and the therapeutic effect of BBR on IR in the PCOS model was investigated. Additionally, the potential mechanism of BBR on PCOS was explored by real-time quantification PCR (RT-qPCR) and western blotting. These results will improve our understanding of the development of PCOS, and may provide a novel clinical treatment strategy for PCOS.
Methods
Ethics statement
All animal experiments were conducted in strict accordance with the animal ethics standards and with ethics approval from the Ethics Committee of Obstetrics and Gynecology Hospital of Fudan University (no. [2015]45).
Animals and treatments
Female clean Sprague Dawley rats (6 weeks old, total
n = 42) were obtained from the Shanghai Laboratory Animal Centre (SLAC, Shanghai, China), and were adaptively fed for 3 days. The PCOS rat models were established following the methods reported by Abramovich et al. [
18] with some modifications. The rats were first randomly divided into the following six groups (
n = 7 per group): control, control + BBR, PCOS-high fat diet (HFD), PCOS-HFD + BBR, PCOS-normal diet (ND), and PCOS-ND + BBR. The rats in the PCOS-HFD and PCOS-HFD + BBR groups were fed with an HFD and were injected with DHEA (source leaf organisms, S24516; 6 mg/100 g body weight with 0.2 ml of sesame oil) for 21 days to induce PCOS in IR rat models. The rats in the PCOS-ND and PCOS-ND + BBR groups were fed with an ND and injected with DHEA. The other rats were fed with an ND and injected with 0.2 ml of sesame oil (control and control + BBR groups). The main energy materials of an ND and an HFD are shown in Table
1. Methylene blue staining was used to examine the changes of vaginal epithelial cells in the DHEA-treated rats under an optical microscope. The PCOS model was considered successful if the vaginal epithelial cells were continuously keratinized for 10 consecutive days [
19]. After 12 h of fasting (20,00 to 8:00), the venous blood was extracted from the tails of the PCOS rats. Fasting plasma glucose (FPG) levels were determined by using the ACCU-CHEK Performa glucose [
20] meter (Roche Diabetes Care, USA), and the fasting insulin (FINS) levels were determined using rat insulin ELISA kits (Thermo Scientific, USA). In accordance with the homeostasis model assessment of IR (HOMA-IR) method [
21], HOMA-IR = FINS × FPG/22.5. HOMA-IR > 2.8 of the PCOS rats was considered to indicate the presence of IR [
11].
Table 1
The main energy materials of normal diet and high-fat diet (kcal/100 g)
Protein | 90.46 | 87.20 |
Carbohydrate | 212.96 | 207.10 |
Fat | 48.58 | 166.20 |
In total | 352.00 | 460.50 |
Subsequently, the rats in the control + BBR, PCOS-HFD + BBR, and PCOS-ND + BBR groups were gavaged with BBR (150 mg/kg/d, Sigma-Aldrich, Louis, MO, USA). The BBR was dissolved with 0.5% sodium carboxymethyl cellulose [Sangon Biotech (Shanghai) Co., LTD, Shanghai, China]. The rats in the other groups were gavaged daily with an equal volume of 0.5% sodium carboxymethyl cellulose. The treatments were administered for 6 weeks.
Sample collection
At the end of the experiment, the body weights and HOMA-IR of all rats were determined. Further, all rats were euthanized by cervical dislocation, and serum and ovary tissue samples were collected from all rats. Additionally, a part of each ovary tissue sample was fixed in polyformic acid solution. The remaining ovary tissue was stored at − 80 °C for subsequent experiments.
Histological analysis
For histological analysis, the fixed ovary tissue was embedded in paraffin, sectioned to a thickness of 5 mm, and stained with hematoxylin and eosin (HE). Slides were scanned using the OPTIKA microscope (M.A.D. Co. LTD, Italy) and the morphological changes of the ovary tissues were observed.
Serum parameter assay
According to the manufacturer’s instructions, the levels of insulin and testosterone in sera were respectively measured using rat insulin and rat testosterone ELISA kits (KGE010, R&D systems, USA).
Cell apoptosis analysis
The cell apoptosis rate was investigated by using the TUNEL assay kit (Roche Applied Science, Penzberg, Germany). Briefly, slides with 5-μm sections of the ovary tissues were dewaxed by xylene and washed with ethyl alcohol. After sealing with H2O2 for 30 min, 20 mg/L of protease K was added to the samples. After 20 min, the TUNEL reaction solution was added and incubated for 60 min at 37 °C. Then, anti-luciferin antibodies linked by peroxidase were added and incubated for 30 min at 37 °C. Subsequently, the slides were stained with DAB and restained with hematoxylin. The number of apoptotic cells was observed and calculated under an optical microscope (M.A.D. Co. LTD, Italy). The positive apoptotic cell nuclei were dark brown in color, and the non-apoptotic cell nuclei were blue in color. The Image pro plus 6.0 software was utilized to determine the number of TUNEL-positive cells.
RT-qPCR analysis
Total RNA in the ovary tissues was isolated using the TRIzol reagent (TIANGEN, Shanghai, China) according to the manufacturer’s instructions. The RNA quantity and quality were evaluated with a microplate reader (Tecan Group LTD, Männedorf, Switzerland). Afterward, cDNA was synthesized using a cDNA Reverse Transcription Kit (TaKaRa Bio Inc., Shiga, Japan) following the manufacturer’s instructions. RT-qPCR was performed using a fluorescence ration PCR instrument (Applied Biosystems Inc., Foster City, CA, USA) with SYBR Green Ι (Thermo, Waltham, MA, USA). The sequences of all primers are shown in Table
2. The PCR conditions were as follows: 3 min at 50 °C, 3 min at 95 °C, 40 cycles of 10 s at 95 °C, 30 s at 60 °C, and 15 s at 72 °C. GAPDH was used as the reference gene.
Table 2
The sequences of all primers
TLR4-rF | GTTCCTTTCCTGCCTGAGACC |
TLR4-rR | AGGGTTTCCTGTCAGTACCA |
LYN-rF | TGAAGACTCAACCAGTTCCTGA |
LYN-rR | TTAGCTTTCCACCACTCCCC |
PI3K-rF | GCAAAAGCTTGAAAGCCTGC |
PI3K-rR | CAGGGGCTTCTTCTTGGAGG |
Akt-rF | TAGCCATTGTGAAGGAGGGC |
Akt-rR | CCTGAGGCCGTTCCTTGTAG |
NF-κB-rF | TGCCGAGTAAACCGGAACTC |
NF-κB-rR | CAGCCAGGTCCCGTGAAATA |
TNF-α-rF | ATGGGCTCCCTCTCATCAGT |
TNF-α-rR | AAATGGCAAATCGGCTGACG |
IL-1-rF | ACAAAAATGCCTCGTGCTGTC |
IL-1-rR | GTGCCGTCTTTCATCACACAG |
IL-6-rF | TCTGGTCTTCTGGAGTTCCG |
IL-6-rR | AGCATTGGAAGTTGGGGTAGG |
caspase-3-rF | TACTCTACCGCACCCGGTTA |
caspase-3-rR | CGCGTACAGTTTCAGCATGG |
CD14-rF | ACTTCTCAGATCCGAAGCCAG |
CD14-rR | CCGCCGTACAATTCCACAT |
COL15A1-rF | CCCATTACCCTCGTCTGTGTC |
COL15A1-rR | CTGAAGAAGGTCGGTGGGATG |
LY96-rF | GAATCTGAGAAGCAACAGTGGT |
LY96-rR | CTCAACATGCACAAATCCATTGG |
CXCL6-rF | GTTCCATCTCGCCATTCATGC |
CXCL6-rR | GCGGCTATGACTGAGGAAGG |
CXCL16-rF | CCTTGTCTCTTGCGTTCTTCC |
CXCL16-rR | TCCAAAGTACCCTGCGGTATC |
SHC4-rF | GAGGAGGTACTTGTTGATGGTG |
SHC4-rR | TCTGTAGCTTGAGCCTGGATG |
GAPDH-rF | AGACAGCCGCATCTTCTTGT |
GAPDH-rR | CTTGCCGTGGGTAGAGTCAT |
Western blotting analysis
The protein levels of toll-like receptor 4 (TLR4), phosphatidylinositol 3-kinase (PI3K), AKT serine (AKT), tumor necrosis factor-α (TNF-α), LYN proto-oncogene, Src family tyrosine kinase (LYN), and caspase-3 were determined by western blotting. The total proteins of ovary tissues were extracted with a protein extraction kit (Beijing Baiolaibo Technology Co. LTD, Beijing, China) and a BCA protein assay kit (Boster Biological Technology Co. LTD, Wuhan, China) was used to determine the concentration of total protein. Furthermore, the proteins were separated by 12% SDS-PAGE, transferred onto a PVDF membrane, and blocked with 5% BSA. The membranes were then incubated with anti-TLR4 (1:2000, Abcam), anti-T-PI3K (1:5000, Abcam), anti-p-PI3K (1:5000, Abcam), anti-T-AKT (1:5000, Abcam), anti-p-Akt (1:5000, Abcam), anti-TNF-α (1:2000, Abcam), anti-IL-1 (1:2000, Abcam), anti-IL-6 (1:2000, Abcam), anti-caspase-3 (1:5000, Abcam), anti-cleaved caspase-3 (1:5000, Abcam), anti-LYN (1:5000, Abcam), and anti-GAPDH (1:5000, Abcam) antibodies, respectively, at room temperature overnight. Thereafter, IgG-HRP was added to the membranes and incubated at room temperature for 2 h. After washing five times, the protein bands were visualized with ECL.
Statistical analysis
Statistical analyses were performed using GraphPad InStant 3 (San Diego, CA, USA). The data are reported as mean ± standard deviation (SD). One-way analysis of variance was used for comparison among more than two groups, and the Tukey’s test was subsequently performed to assess group differences. For comparisons of two groups, the Student’s t-test was applied. A p-value of less than 0.05 was considered to indicate a significant difference.
Discussion
PCOS is a complex disease with multiple factors and various clinical manifestations that seriously affects women’s health. BBR, a traditional Chinese herbal medicine, is used as an insulin sensitizer to improve glucose and lipid metabolism [
22]. In this study, a PCOS with IR model was successfully established by injecting rats with DHEA and by feeding an HFD. We found that BBR reduced the weight gain caused by the HFD, thereby inhibiting the levels of IR and testosterone. Additionally, RT-qPCR and western blotting results showed that BBR alleviated PCOS by suppressing cell apoptosis and by regulating the expression levels of related genes, including
TLR4,
LYN,
PI3K,
Akt,
NF-kB,
TNF-α,
IL-1,
IL-6, and
caspase-3.
IR, a major characteristic of PCOS, has been observed in 20–40% of the women with PCOS [
23]. Hyperandrogenemia, another central component of PCOS, is evaluated by measuring the levels of total testosterone in PCOS rats [
24]. A study by Chen et al. found that Quyu Huatan decoction not only ameliorated the secretion of testosterone but also regulated the body’s metabolism of glucose and lipids in patients with PCOS [
25]. In this study, BBR reduced HOMA-IR in PCOS rats and might have improved the symptoms of PCOS by inhibiting the production of testosterone, which indicated that BBR might be worth clinical promotion and application.
Additionally, an increasing number of studies continue to demonstrate that PCOS is associated with the inflammatory response and cell apoptosis [
26,
27]. Therefore, RT-qPCR and western blotting were used in this study to explore the expression of inflammation-related genes. We showed that BBR regulated the expression levels of
TLR4,
LYN,
NF-kB,
TNF-α,
IL-1, and
IL-6 caused by PCOS.
TLR4 plays an important role in proinflammatory signaling and its levels are significantly higher in rats with PCOS compared to those without PCOS [
28]. Further,
TLR4 binds to its receptor and activates
NF-kB to produce proinflammatory cytokines, including
TNF-α,
IL-1, and
IL-6 [
11,
29]. In this study, TNF-α, IL-1, and IL-6 were upregulated in the PCOS rats. Moreover, after BBR treatment, these levels were significantly downregulated. These results indicated that BBR reduced the inflammatory response of PCOS rats. Additionally,
LYN, encoding tyrosine-protein Lyn, is essential for the generation of the inflammatory environment and for the activation of the innate immune response mediated by
NF-kB [
30,
31]. Comparing the results of the present study with those of previous studies, it is apparent that BBR may alleviate the inflammatory response of PCOS rats by regulating the expressions of
TLR4,
LYN,
NF-kB,
TNF-α,
IL-1, and
IL-6, thus improving the symptoms of PCOS.
The PI3K/Akt signaling pathway changes with resistance to insulin as well as androgen and follicular development [
32]. Qiu et al. indicated that Liuwei Dihuang pills improved IR by acting on the PI3K/Akt signaling pathway, thus alleviating the symptoms of PCOS [
33]. Additionally, the upregulation of WNT5a may enhance the inflammatory response and oxidative stress in PCOS via the PI3K/Akt/NF-kB signaling pathway. In the present study, we found that BBR mediated the levels of p-PI3K/T-PI3K, p-Akt/T-Akt, and NF-kB; thus, we suggest that BBR may improve PCOS via the PI3K/Akt/NF-kB signaling pathway. However, the specific mechanism is currently unclear and requires further investigation.
Cell apoptosis in ovarian tissues plays an important role in PCOS [
34‐
36]. Therefore, TUNEL, RT-qPCR, and western blotting were used to investigate cell apoptosis and the expression of
caspase-3 and
cleaved caspase-3.
Caspase-3, the main executor of apoptosis, is essential for chromatin condensation, DNA fragmentation, and nuclear and plasma membrane vacuolization, and is also associated with different processes of apoptotic body formation [
34]. A study by Salehi et al. showed that
caspase-3 was overexpressed in patients with PCOS, and its higher expression might result in higher apoptosis levels [
34]. Elevated levels of cleaved caspase-3 are closely associated with cell apoptosis [
37]. In the present study, the expression of caspase-3 and cleaved caspase-3 was higher in PCOS rats than that in control rats, while BBR downregulated the expression of
caspase-3 and
cleaved caspase-3 as well as inhibited ovarian cell apoptosis.
However, there are some limitations to this study. The changes in steroidogenic enzymes in serum require further investigation, and the influence of BBR on estrous cycle and fertility in DHEA-treated rats also requires confirmation. Additionally, further studies are needed to elucidate the apoptosis of different cells (granulosa cells, cumulus cells, and stroma) in the ovaries.
In conclusion, BBR reduces IR and testosterone levels in PCOS rats and exerts a protective effect on PCOS. The underlying mechanism of BBR action may be involved in the regulation of the expression of TLR4, LYN, PI3K, Akt, NF-kB, TNF-α, IL-1, IL-6, and caspase-3, thus inhibiting the inflammatory response as well as cell apoptosis. Our findings provide a novel effective therapeutic strategy for PCOS.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.