C9orf72 arginine-rich dipeptide proteins interact with ribosomal proteins in vivo to induce a toxic translational arrest that is rescued by eIF1A

Drosophila stocks were maintained on SYA food (15 g/L agar, 50 g/L sugar, 100 g/L autolysed yeast, 30 ml/L nipagin (10% in ethanol) and 3 ml/L propionic acid) at 25 °C in a 12-h light/dark cycle with constant humidity. The elavGS stock was generously provided by Herve Tricoire (Paris Diderot University) [33]. The GMR-Gal4 line was obtained from the Bloomington Drosophila Stock Centre. UAS-GR50-FLAG, UAS-PR50-FLAG and UAS-GA50-FLAG flies were kindly provided by Ludo Van Den Bosch (Vlaams Instituut voor Biotechnologie) [6]. The UAS-metRS^L262G-EGFP line was described previously [9]. UAS-36R, UAS-GR100, and UAS-PR100 flies have been previously described [28]. The indicated overexpression lines were obtained from the FlyORF collection, including the UAS-eIF1A line (F001317) [4].

GA, GR and PR coding sequences were amplified without their original 3′ stop codon from the original pUAST attb plasmids containing 200-aa dipeptide sequences (described in [28], using a common forward primer and a sequence-specific reverse primer. PCR products were digested and ligated into the GS-CTAP plasmid [19]. Vectors were sequenced prior to injection into Drosophila. Repeat lengths were 199 amino acids for GR and GA, and 179 amino acids for PR. Plasmids were injected by the University of Cambridge, Department of Genetics Fly Facility.

Flies carrying UAS-dipeptide-GSTAP constructs were crossed to the GMR-GAL4 driver line. The resulting cross was allowed to develop and eclose at 25 °C; female eyes were photographed on the day of emergence.

The parental generation of the genotype indicated in each lifespan assay was allowed to lay for 24 h on grape agar plates supplemented with yeast. Eggs were deposited at a standard density into bottles containing SYA medium. Adult experimental flies were allowed to emerge and mate for 2 days before being lightly anaesthetised with CO₂, and females randomly allocated onto SYA containing RU486 (200 μM) at a standard density per vial, with a minimum 100 flies per condition. At regular intervals (see results), flies were tipped onto fresh food and dead flies counted. Escaping flies were censored from the data. Lifespans are presented as cumulative survival curves. Significance was assessed using the log rank test.

Experimental flies were bred as described for lifespans to generate the following genotypes: w; UAS-GR-GSTAP/+; elavGS/+w; UAS-GA-GSTAP/+; elavGS/+w; +; UAS-PR-GSTAP/elavGS.

Newly emerged flies were allowed to mate for 3–4 days before being tipped onto SYA medium containing 200 μM RU486 in bottles. Flies were left on RU486 for 3 days before being snap frozen in liquid nitrogen and stored at − 80 °C. Tandem affinity purification was performed as previously described, with modifications [40]. Approximately 1 g of heads was ground in a mortar on dry ice before being transferred to a chilled 15 ml Dounce homogeniser and being homogenised using a loose pestle in ice cold 8 ml lysis buffer (50 mM Tris–HCl (pH 7.4), 125 mM NaCl, 5% glycerol, 1.5 mM MgCl, 25 mM NaF, 0.2% IGEPAL, 1 mM NaVO₄, 1 mM DTT, 1 mM EDTA). Homogenates were centrifuged at 21,000×g for 30 min at 4 °C, and supernatant was centrifuged again under the same conditions. For each sample, 400 μl of IgG Sepharose 6 Fast Flow beads (GE Healthcare) was washed three times in an excess IgG wash buffer (10 mM Tris–HCl (pH 8.0), 150 mM NaCl, 0.1% IGEPAL). Cleared homogenates were incubated with IgG Sepharose beads for 2 h at 4 °C with agitation. The homogenate and bead mixture was loaded onto a 15-ml econocolumn (Biorad) at 4 °C. The homogenate was drained, and beads were washed three times with 10 ml of ice cold IgG wash buffer, before being washed once with 10 ml TEV cleavage buffer (10 mM Tris–Cl pH 8.0, 150 mM NaCl, 0.1% IGEPAL, 0.5 mM EDTA, 1 mM DTT). Following this, TEV cleavage buffer containing 100 units/ml of AcTEV enzyme (Thermo Fisher Scientific) was applied, and beads were incubated in the column with agitation at 18 °C for 2 h.

240 μl of Streptavidin Agarose beads (Pierce) were washed three times in TEV cleavage buffer. The TEV cleavage product was incubated with the Streptavidin beads for 1.5 h at 4 °C. Beads were then washed once with TEV cleavage buffer, and then three times in TEV cleavage buffer without IGEPAL.

Beads were resuspended in 10 mM Tris–HCl pH 8.0, 150 mM NaCl and split in two; each sample was resuspended in 10 mM Tris–HCl pH 8.0 and 150 mM NaCl with 10 mM TCEP, and incubated at 37 °C for 10 min with shaking. Beads were then pelleted and TCEP solution removed and replaced with 10 mM Tris–HCl pH 8.0, 150 mM NaCl with 20 mM iodoacetamide and incubated in the dark at room temperature for 30 min with shaking. Beads were pelleted and resuspended in 100 μl of 50 mM ammonium bicarbonate with 0.2 μg of sequencing-grade trypsin (Roche) (reconstituted in 0.5% formic acid) and digested overnight. After digestion, the beads were pelleted and the liberated peptides removed from the beads.

The peptide-containing supernatant was placed in a fresh Eppendorf tube, and the trypsin reaction was halted by the addition of 5% formic acid to a final concentration of 0.25%. To liberate residual peptide, beads were resuspended in 100 µl of 1 M ammonium bicarbonate solution before being pelleted as before. Supernatant was removed, and 5% formic acid was added to a final concentration of 0.25%. For each sample, the original supernatant was pooled with the wash. Samples were frozen overnight at − 20 °C before being dried in a speed vacuum at 45 °C.

All samples were filtered through in-house-made C8 tips (Empore Octyl C8, 3 M) to remove residual particulate material. Peptides were resuspended in 0.5% formic acid/100% H₂O before LC–MS/MS analysis on an Ultimate 3000 RSLCnano System coupled to a LTQ Orbitrap Velos hybrid mass spectrometer equipped with a nanospray source. The sample was first desalted on a PepMap C18 nano trap (100 μm i.d. × 20 mm, 100Å, 5 μm) at 10 μL/min for 15 min, then separated on a PepMap RSLC C18 column (75 μm i.d. × 250 mm, 100 Å, 2 μm) with a flow rate of 300 nl/min in a linear gradient of 4–32% CH₃CN/0.1% formic acid in 90 min, with total 130 min of acquisition time. The HPLC, columns and mass spectrometer were all from Thermo Fisher Scientific. The Orbitrap mass spectrometer was operated in the standard “top 15″ data-dependent acquisition mode while the preview mode was disabled. The MS full scan was set at m/z 380–1600 with the resolution at 30,000 at m/z 400 and AGC at 1 × 10⁶ with a maximum injection time at 200 ms. The siloxane ion at 445.120020 was used as lock mass. The 15 most abundant multiply charged precursor ions (z ≥ 2), with a minimal signal above 3000 counts, were dynamically selected for CID (collision induced dissociation) fragmentation in the ion trap, which had the AGC set at 5000 with the maximum injection timemat 100 ms. The precursor isolation width was set at 2 Da. The normalised collision energy for CID MS/MS was set at 35%. The dynamic exclusion duration time for selected ions for MS/MS was set for 60 s with ± 10 ppm exclusion mass width.

The raw files were processed with Proteome Discoverer v1.4 (Thermo). Database searches were performed with Mascot (Matrix Science) against the Drosophila Uniprot database (v. December 2015). The search parameters were: trypsin digestion, two missed cleavages, 10 ppm mass tolerance for MS, 0.5 Da mass tolerance for MS/MS, with variable modifications of carbamidomethyl (C), N-acetylation (protein), oxidation (M), and pyro-glu (NtermQ). Database search results were refined through Mascot Percolator (FDR < 1%). High-confidence peptides were apportioned to proteins using Mascot Protein Family summary. Protein identification required at least one high-confidence peptide (FDR < 1%) and a minimum Mascot protein score of 20. External contaminants were removed for further analysis. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE [41] partner repository with the dataset identifier PXD012099​.

To ensure equivalent baseline translation, repeat insertions were backcrossed for six generations into the w1118 background. The elavGS driver and the UAS-metRS^L262G-EGFP insertion were recombined onto the same chromosome, and UAS-repeat stocks or w1118 crossed to this stock. Adult females were split into vials containing SYA media supplemented with 200 μM RU486. 3 days after induction, flies were briefly anaesthetized using CO₂ and injected into the haemolymph with 32.2 nl of 200 mM of azidonorleucine (ANL) solution made in sterile PBS (pH7.4) or vehicle alone. Flies were allowed to recover for 48 h on food supplemented with RU486 before adult brains were dissected in haemolymph-like solution with calcium, and fixed and processed in the manner described previously [9]. Following the FUNCAT procedure, brains were mounted in vectashield with DAPI (Vectorlabs). Images of neurons were taken using a Zeiss LSM 710 confocal microscope with the 63× objective lens. An image was taken in the optic lobe of each brain, three boxes of equal size were drawn in different regions of the tissue using the GFP channel as a guide, and TAMRA intensity measured using imageJ image analysis software, GFP intensity and TAMRA intensity were averaged across the three regions. Experimenter was blinded to genotype during image acquisition and analysis.

Previously described 200-aa-encoding dipeptide repeat sequences (GA100, PR100, and GR100) [28] were subcloned into the PCDNA3.1(+) vector using BamHI and NotI restriction sites. Following this, the GFP coding sequence was liberated from the pEGFP-C3 vector (Addgene 6082-1) using the BglII and BmtI restriction sites, and was subcloned N-terminally to the dipeptide coding sequence by digesting the PCDNA3.1(+)-DPR vector with BamHI and BmtI. Human EIF1AX coding sequence was generated by gene synthesis (GeneArt) inserted into the PCDNA3.1(+) plasmid and an N-terminal FLAG tag added by PCR.

For iPSC culture, an iPSC line from a healthy donor was maintained in Essential E8^™ medium cultured on Getrex-coated plates. The control iPSC line has been used in previous study described as ‘Control 1′, the healthy donor was male and 64 years old at time of biopsy [38]. iPSCs were grown to full confluence and then induced into motor neuron-like cells as previously described [13, 38]. Briefly, after the patterning stage, at day 18 of differentiation, progenitor MNs were expanded in neuronal medium containing FGF (10 ng/µl).

Progenitor MNs were cultured with additional 10 µM, Y-27632 dihydrochloride (ROCK inhibitor), for 1 h prior to nucleofection. Cells were lifted into suspension after incubation for 5 min at 37 °C with 0.5 mM EDTA in 1× PBS. 2 × 10⁶ cells per condition were centrifuged at 300×g for 5 min. Cell pellet was gently resuspended in 100 µl of Basic Neuron Nucleofector^™ solution (Lonza). 4 µg of plasmid DNA was added before the mixture was transferred into cuvette and electroporated using Amaxa™ Nucleofector™ II device and programme A-033. Immediately afterwards, the mix was added to pre-warmed neuronal medium containing 0.1 µM Compound E (Merk, 565790) and 10 µM ROCK inhibitor. Cells were then plated onto coverslips pre-coated with Geltrex™.

24 h after nucleofection cells were placed in neuronal methionine-free medium for 30 min, made by supplementing DMEM–l-methionine–l-cysteine (Gibco^™ 21013024) with 0.23 mM sodium pyruvate, 10 mM HEPES, 0.26 mM l-cysteine, 0.067 mM l-proline, 0.674 µM zinc sulphate, 5 nM B12, non-essential amino acids 0.5% (Gibco), Glutamax 1%, 5 µg/ml insulin, B27 supplement (1×) and N2 supplement (1×). Cells to be used as negative control had neuronal methionine-free medium supplemented with 50 µM anisomycin. Cells were then cultured with 150 µM Click-iT^® AHA (L-azidohomoalanine) (Thermo Fisher), in neuronal methionine-free medium for 2 h. Negative controls had 150 µM Click-iT^® AHA and additional 100 µM anisomycin. Cells were fixed and stained with Click-iT^® Cell Reaction Buffer Kit (Cat. no. C10269) and the fluorophore Alexa 555 alkyne (1 µM).

HeLa cells were maintained in DMEM complete medium (10% FBS, 1% Glutamax, 1% sodium pyruvate, 1% Pen/Strep) and plated on coverslips in 24-well plates the day before transfection. Cells were transfected with either GFP alone (320 ng), GFP-GR100 (80 ng) together with FLAG-EIF1AX (240 ng), or GFP-GR100 (80 ng) together with FLAG alone (240 ng), using Lipofectamine 2000. After 24 h, the medium was changed to methionine-free DMEM for 30 min before the addition of AHA as described above for MN progenitors. Cells were stained with anti-FLAG antibody (F1804, Sigma) prior to imaging.

A confocal microscope (Zeiss LSM 710 for MN progenitors, Zeiss LSM 880 for HeLa cells) was used to take Z stacks and maximum intensity projection images were analysed using ImageJ to quantify the intensity of AHA staining (Alexa 555) in cells positive for GFP or GFP-tagged DPRs.

Heads from female flies induced on SYA medium containing 200 μM RU486 for 7 days were collected and processed in the manner described previously [29].

Female flies were induced on SYA medium containing 200 μM RU486 for 5 days before being flash frozen in liquid nitrogen. 9–10 heads per replicate were extracted using TRIzol reagent (Thermo Fisher Scientific) following manufacturer’s protocol. 1 μg of RNA per sample was treated with DNase I (Ambion), followed by reverse transcription using the SuperScript II system (Invitrogen) using random hexamers (Thermo Fisher Scientific). Quantitative PCR was performed using the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) using SYBR^® Green master mix (Applied Biosystems). Values were obtained using the relative standard curve method and normalised to alphaTub84B. Primers used were: EGFP forward: GGTGAACTTCAAGATCCGCC; EGFP reverse: CTTGTACAGCTCGTCCATGC; Tub84B forward: TGGGCCCGTCTGGACCACAA; Tub84B reverse: TCGCCGTCACCGGAGTCCAT.

The string network was created by uploading GR and PR-interacting proteins to the STRING web interface [39], and the resultant image was created using Cytoscape. Gene ontology analysis was performed using WebGestalt [42].

To assess overlap of mass spectrometric data sets, data sets were downloaded from supplementary material of the referenced original papers: from Lee et al. (2016) [20] GR and PR interactors with a Saint cutoff of > 0.9 were taken; from Lin et al. [22] the PR interactome common to both methods was used; for Boeynaems et al. [5] the PFA crosslinked data set was used; for Lopez-Gonzalez et al. [23] the non-RNAse-treated data set was used; the Yin et al. [45] dataset was used, with removal of the ten proteins not included in the analysis performed in the original study. Genes were converted to Drosophila orthologs using BioMart (Ensembl), and significance of overlap performed in comparison with the hypergeometric distribution in R based on an estimated Drosophila protein-coding genome size of 13,931 genes. The six-way overlap between the data sets was created using jVenn [2].

Flies carrying UAS-ribosomal and initiation factor protein transgenes inserted at the attP-86Fb integration site were ordered from the FlyORF stock repository and crossed to virgin females carrying the UAS-36R and elavGS transgenes. The attP-86Fb injection strain was crossed as the control. Emerging adult flies were allowed to mate for 24 h, before 100 flies of each genotype were split at a density of 25 flies per vial on SYA supplemented with 200 μM RU486. Flies were scored until days 12–13 (approximately 30–40% control flies had died) and mortality of each line scored as a percentage of controls. Transgenes leading to less than 30% death, relative to the control, were rescreened using a similar protocol. If the same effect was observed, transgenes were backcrossed for six generations in to the w1118 background and retested.

To determine which proteins the arginine-containing DPRs form complexes with in an intact neuronal system, DNA sequences encoding recodonised ATG-driven dipeptide proteins [28] were cloned upstream of a tandem affinity purification (TAP) tag containing a protein G module and streptavidin-binding domain separated by an internal tobacco etch virus (TEV) protease cleavage site (GSTAP tag). We generated Drosophila capable of expressing 90–100 repeats of the following DPRs: polyGR, polyPR and polyGA. After generation of transgenic Drosophila, constructs were expressed in the developing compound eye using the GMR-Gal4 driver and, as expected, strong toxicity was observed for the GR-GSTAP and PR-GSTAP constructs but not the GA-GSTAP control construct (Suppl. Figure 1a, Online Resource 1). We confirmed expression of the GSTAP-tagged constructs using the elavGS driver which drives expression in adult neurons, observing a robust expression of polyGA and a weaker expression of polyGR and polyPR (Suppl. Figure 1b, Online Resource 1).

We performed tandem affinity purification coupled to LC–MS/MS to identify dipeptide-interacting proteins in adult Drosophila neurons, performing three independent replicates and including only data present in ≥ 2/3 replicates. We used polyGA as a negative control, filtering the results to exclude polyGA-interacting proteins, as these probably represent proteins that bind to the TAP tag itself, or proteins that are unlikely to play a role in arginine-rich DPR toxicity in Drosophila. In total, we identified 94 proteins that bind to either polyPR or polyGR, with 82 specific to polyPR alone, 5 specific to polyGR alone, and 7 common between both proteins (Fig. 1a). The higher number of interactors in the polyPR data set was consistent across replicates (Suppl. Table 1, Online Resource 2), suggesting that polyPR may bind to protein complexes with a higher degree of avidity, or may be expressed at a higher level/undergo less clearance compared to polyGR. 49 proteins were found to overlap with both polyGA and polyPR and/or polyGR (Suppl. Figure 2, Online Resource 1), which are likely to have interacted with the epitope tag. Two proteins were found to be specific to GA, including unc-119, which has previously been demonstrated to be a key GA-interacting protein in transfected cells and forms aggregates in C9orf72 human post-mortem tissue [26, 37].

Several recent studies have performed mass spectrometry on PR- or GR-interacting proteins using lysates from immortalised non-neuronal cell lines [5, 16, 20, 22, 23, 45]. To determine whether these shared common interactors with our dataset, where a complete list of interactors was available, we converted the identified human genes into Drosophila orthologs, and analysed the degree of overlap, finding a highly significant overlap with each data set (Suppl. Figure 3, Online Resource 1). We performed STRING analysis to cluster the Drosophila-interacting proteins into a network, and observed a strong enrichment of ribosomal proteins in the Drosophila data set (Fig. 1b). When gene ontology analysis was performed on the total set of interacting proteins, the most significantly overrepresented ontology term was “cytoplasmic translation” (P < 1E−10). Notably, this was consistent with the human data set, where of the orthologous shared interactors present in all six data sets (five human cell line and one Drosophila neuron), 100% were ribosomal proteins, with both small and large ribosomal subunits represented (Suppl. Figure 4, Online Resource 1).

The interaction of the arginine-rich DPRs with ribosomal subunits suggested that they might be capable of interfering with the process of translation. We, therefore, transfected iPSC-derived motor neuron progenitors with plasmids encoding the N-terminally tagged arginine-rich DPR proteins GFP-GR100 and GFP-PR100 with GFP-GA100 or GFP alone as controls. We assessed translation by starving cells of methionine, and feeding them with a pulse of L-azidohomoalanine (AHA) 24 h after transfection with DPRs. Following fixation, a fluorescent label was covalently linked to the AHA-containing proteins, allowing assessment of the level of translation that had occurred. As expected, we observed robust incorporation and labelling of AHA in GFP-transfected cells, and this incorporation is prevented by the addition of the protein synthesis inhibitor anisomycin (Fig. 2a). Furthermore, when we assessed the level of translation in cells expressing DPR constructs we found that, whilst GFP-GA100 had no effect on translational activity, both GFP-GR100 and GFP-PR100 strongly and significantly reduced translation in human neurons (Fig. 2a, b).

To determine whether translation was repressed in an in vivo model system, we adapted a recently published system for fluorescent non-canonical amino acid tagging (FUNCAT) in Drosophila [9]. This method is based on delivery of the non-canonical amino acid Azidonorleucine (ANL), which can only be incorporated into nascent proteins in cells overexpressing the UAS-MetRS^L262G methionyl-tRNA synthetase, with subsequent assessment of translation rates by fluorescently labelling the newly synthesised proteins with a tetra-methyl rhodamine (TAMRA) tag using click-chemistry. We recombined the UAS-MetRS^L262G-EGFP transgene with the elavGS driver, allowing inducible expression specifically in adult neurons. Insertions were backcrossed into the same wild-type stock (w1118) for six generations prior to the experiments, to ensure that observed differences were not due to genetic background. We additionally confirmed that flies expressing arginine-containing DPRs still displayed strong toxicity when expressing the UAS-MetRS^L262G-EGFP transgene (Suppl. Figure 5, Online Resource 1), whilst flies expressing polyGA had an intermediated lifespan consistent with previous results [6, 28]. To avoid any differences in feeding behaviour affecting results, we directly injected a small volume of ANL into the haemolymph of flies 3 days after induction of expression, before performing dissection and FUNCAT labelling 48 h later. We observed a strong translation repression in flies expressing GR50, PR50 or 36 GGGGCC repeat (36R) constructs compared to controls, but not flies expressing GA50 (Fig. 3a,b). In addition, we also observed a significant reduction in the intensity of the MetRS^L262G-EGFP enzyme in these flies, (Fig. 3c). We confirmed that this is due to reduced abundance of the MetRS^L262G-EGFP enzyme using western blotting in whole head lysates (Suppl. Figure 6, Online Resource 1). Despite this reduction, we did not observe a reduction in MetRS^L262G-EGFP transcript abundance by RT-qPCR (Fig. 3d), demonstrating that translation of the MetRS^L262G-EGFP enzyme was reduced as part of the translational repression induced by the arginine-rich DPRs, rather than a suppression of transgene expression per se, an effect that has been previously reported [32]. These results show that the arginine-containing DPRs suppress translation in neurons in vivo.

We determined whether genetic interventions that could enhance translation can rescue toxic phenotypes associated with C9orf72 repeat RNA expression in vivo. We first attempted to rescue the lifespan phenotype previously reported in a 36 GGGGCC (36R) repeat-expressing Drosophila model [28] by overexpressing factors potentially regulating translation. We carried out a mini-screen looking at 70 ribosomal proteins and 11 translation initiation factors (available through the FlyORF library). These were individually expressed in adult Drosophila neurons co-expressing 36R using the elavGS driver (Suppl. Figure 7, Online Resource 1). Lifespans were run in batches, always with a wild-type control. The lifespans were scored until the 30–40% of controls had died, so we would be able to identify both factors rescuing and enhancing toxicity. The total number of dead flies in each condition was then counted and expressed as a percentage relative to the control line. Seven candidates that showed a number dead that was < 30% of the control population were considered as rescuers. To rule out a genetic background effect, these stocks were rescreened after being backcrossed, and only a single protein, eukaryotic translation initiation factor 1A (eIF1A), which is essential for translation initiation [8], was able to reduce toxicity in flies expressing 36 repeats (Fig. 4a). This reduction in toxicity was not associated with reduced levels of the toxic GR protein (Fig. 4b), demonstrating that eIF1A overexpression did not affect RAN translation or polyGR clearance. Consistent with this, overexpression of eIF1A also partially rescued the lifespan defect observed in flies expressing GR100 in adult neurons (Fig. 4c). Consistent with a shared mechanism of toxicity, overexpression of eIF1A also extended lifespan in PR100-expressing flies (Suppl. Figure 8a, Online Resource 1). However, neuronal overexpression of eIF1A alone resulted in a modest shortening of lifespan, suggesting that eIF1A does not improve general neuronal health independently of arginine rich-DPR expression (Suppl. Figure 8b, Online Resource 1). These results strongly implicate a conserved regulator of translation as a key modulator of the toxicity observed in an animal model of the C9orf72 repeat expansion.

We next sought to determine if overexpression of eIF1A enhances translation in polyGR-expressing cells. As the FUNCAT Drosophila system was not suitable (see discussion), we assessed translation in a simpler human cell model. We overexpressed GFP-GR100 in HeLa cells and again observed a strong reduction in translation using the AHA assay compared to controls expressing GFP alone (Fig. 5a, b). We cloned the human ortholog of eIF1A (EIF1AX) with an N-terminal FLAG tag. When human eIF1A is co-expressed, we observe a significant increase in translation compared to cells co-expressing GFP-GR100 with FLAG alone (Fig. 5b). Although we observed an increased translation in eIF1A-expressing cells, we also observe a slight reduction in the GFP-GR100 signal (Fig. 5b), which may be responsible for this rescue (see discussion). Overall, these data implicate eIF1A, a potential inducer of translation, as a potent suppressor of GR toxicity in an in vivo model of C9orf72 repeat expansion toxicity and in human cells.