Skip to main content
Erschienen in: Cancer Cell International 1/2016

Open Access 01.12.2016 | Primary research

Calreticulin mediates an invasive breast cancer phenotype through the transcriptional dysregulation of p53 and MAPK pathways

verfasst von: Mohammadreza Zamanian, Lama Abdel Qader Hamadneh, Abhi Veerakumarasivam, Sabariah Abdul Rahman, Shamarina Shohaimi, Rozita Rosli

Erschienen in: Cancer Cell International | Ausgabe 1/2016

Abstract

Background

The introduction of effective novel biomarkers of invasion and metastasis is integral for the advancement of breast cancer management. The present study focused on the identification and evaluation of calreticulin (CRT) as a potential biomarker for breast cancer invasion.

Methods

Two-dimensional gel protein electrophoresis and MALDI-TOF were utilized in the analysis of fresh-frozen invasive intra-ductal carcinoma specimens. Calreticulin-associated expression was analyzed using immunohistochemistry of FFPE non-malignant/malignant breast specimens. A CRT-knockdown model of MCF7 cell line was developed using siRNA and the CRT genotype/phenotype correlations based on migration and trans-well invasion assays were determined. Finally, microarray-based global gene expression profiling was conducted to elucidate the possible calreticulin pro-invasive regulatory pathways.

Results

Two-dimensional gel protein electrophoresis and MALDI-TOF analysis showed upregulation of calreticulin expression in tumor tissues as compared to the normal adjacent tissues. Meta-analysis of the immunohistochemical results confirmed significantly higher expression of calreticulin (p < 0.05) in the stromal compartments of malignant tissues as compared to non-malignant tissues. Migration and transwell invasion assays showed significant loss in the migratory and invasive potential of CRT-knockdown cells (p < 0.05). Global gene expression profiling successfully identified various putative gene networks such as p53 and MAPK pathways that are involved in calreticulin breast cancer signaling.

Conclusion

Besides confirming calreticulin overexpression in invasive breast cancer tissues, this study reveals a calreticulin-dependent pro-invasive potential and suggests possible contributing pathways. Defining the mechanistic role of invasion and characterizing the possible calreticulin-dependent molecular targets will be the focus of future work.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12935-016-0329-y) contains supplementary material, which is available to authorized users.
Abkürzungen
CRT
calreticulin
2D
two dimensional
MALDI-TOF
matrix-assisted laser desorption/ionization time of flight
FFPE
formalin-fixed paraffin-embedded
ER
endoplasmic reticulum
siRNA
small interfering RNA
HPF
high power field
qPCR
quantitative polymerase chain reaction
IDC
intra ductal carcinoma
IHC
immunohistochemistry
nm
nanometer

Background

Breast cancer is a major health problem for women as it is diagnosed at least a million times every year worldwide [1]. In the United States, it is the second leading cause of cancer deaths and the most common cancer among women [2]. In Asian countries, the peak age for the disease is between 40 and 50 with an increasing trend in incidence and associated mortality [3]. The ability to accurately predict the presence of distant metastasis; the direct consequence of the invasive ability of cancer cells significantly aids in the determination of effective patient management strategies [4].
Calreticulin (CRT) is an important endoplasmic reticulum (ER) protein with critical functions inside and outside the ER [5]. Protein chaperoning and calcium homeostasis are the two key functions of calreticulin inside the lumen of the ER [6]. Outside the ER, calreticulin is involved in cell adhesion [7], modification of gene expression [8], and immune response [9]. Calreticulin is also reported to be correlated with cellular proliferation and metaplastic events [8]. In addition, calreticulin has also been linked to malignant states [10], and as a major calcium homeostasis contributor, it plays a role in cancer invasion and metastasis [11]. Recent studies have focused on revealing an association between the presence of calreticulin and the initiation or progression of various malignant transformations [12]. In brief, the tumor-promoting effects of calreticulin or its overexpression has been reported in ductal carcinoma of the breast [13], bladder cancer [14], and prostatic adenocarcinoma [15]. Furthermore, hepatocellular carcinoma [16], pancreatic malignancies [17], esophageal cancer [18], gastric cancer [19], colon cancer [20], melanoma [21], and leukemia [22] have also been reported to be potentially correlated with calreticulin activity.
A higher expression of calreticulin protein in breast ductal adenocarcinomas has been previously reported [13], which possibly indicates to a correlation between the presence of calreticulin and the initiation and/or progression of cancer. Calreticulin overexpression was also found to be associated with a higher risk of developing invasion and metastasis in breast cancer patients [23]. In addition, calreticulin has been suggested to be a potential biomarker for breast cancer prognosis as its expression was associated with more advanced tumors [24].
Taken together, calreticulin is believed to be involved in the initiation and progression of various cancers. In breast cancer, calreticulin expression has been correlated with more advanced disease and a higher chance for the development of distant metastasis. As the mechanisms and the pathways through which calreticulin may contribute to breast cancer invasion and metastasis have not been determined, we first tried to clarify the importance of calreticulin stromal expression in conferring a more invasive phenotype to breast cancer and to subsequently propose possible mechanisms or pathways for calreticulin pro-invasive effects. The proteomic component of the present study revealed calreticulin as differentially expressed in various invasive states of breast cancer. Then we focused on evaluating the possible correlations between calreticulin expression and the conferment of an invasive phenotype in breast cancer cells as well as clarifying the related mechanisms. We aimed to probe the patterns of differential expression of calreticulin in a range of human breast tissues including non-malignant and malignant lesions. Subsequently, we established the role of CRT in conferring an invasive phenotype in breast cancer cells through siRNA gene knockdown and whole genome expression profiling.

Results

Two-dimensional gel electrophoresis protein maps in the range of pH 4–7 were obtained in duplicates and protein spots that were differentially expressed between tumor and adjacent normal epithelial tissues were selected. Figure 1a shows a representative gel where the protein spots are circled. Spots that were differentially expressed across different samples were excised and sent for MALDI-TOF analysis. Figure 1b represents the MALDI-TOF spectrogram for calreticulin tryptic peptides while all of the correlated identified spots are also listed in Additional file 1: Table S1. The results revealed that calreticulin is overexpressed in the tumoral regions of the tissue samples (spot 2 in Fig. 1a). Figure 1c represents calreticulin expression in different intra ductal carcinoma (IDC) samples including the tumoral and normal adjacent tissues. By using qPCR, CRT expression was confirmed to be higher in stages III and IV of breast cancer as compared to stage I and II tumors (Fig. 1d). Results from protein profiling revealed differential calreticulin expression patterns between tumoral and normal adjacent tissues of breast cancer specimens.
To confirm our protein profiling results and characterize the histological pattern of calreticulin expression, we applied IHC on a range of breast cancer specimens with varying degrees of invasive potential. Our results confirmed that in non-malignant tissues, calreticulin expression was more prominent in the glandular compartment as compared to the stroma (Fig. 2a). The expression was mostly cytoplasmic while low intense staining of the nucleus and cell membrane was also detectable. In malignant tissues, calreticulin was expressed in both the epithelial and stromal compartments (Fig. 2b). The expression was high in almost all malignant epithelial cells while inside the tumor stroma, high expression of calreticulin could be observed in spindle shaped cells of the stroma. The pattern of expression revealed that the higher the invasive state of the tissue, the more calreticulin was expressed. To quantify the differences in calreticulin expression among various malignant states, IHC results were scored and the different categories (non-malignant/malignant/stage/grade) were compared (Fig. 2c). One-way ANOVA followed by post hoc test (Duncan option) demonstrated a significantly higher expression of calreticulin in the stromal compartments of malignant tissues as compared to non-malignant tissues; as F(3, 41) = 4.985 and p = 0.005 (Table 1).
Table 1
Statistical analysis of immunohistochemistry results for calreticulin expression (ANOVA)
Stage
Sum of squares
df
Mean square
F
Sig.
Glandular tissue
 Between groups
10.854
3
3.618
0.777
0.516
 Within groups
139.617
30
4.654
  
 Total
150.471
33
   
Stroma
 Between groups
60.128
3
20.043
4.985
0.005
 Within groups
164.85
41
4.021
  
 Total
224.978
44
   
Invasive carcinoma
 Between groups
28.301
2
14.15
3.213
0.053
 Within groups
145.338
33
4.404
  
 Total
173.639
35
   
One-way ANOVA showed significantly higher calreticulin expression in stromal parts of malignant tissues as compared to non-malignant samples (p < 0.05)
Since IHC confirmed the differential expression of calreticulin in breast cancer tissues, we developed an in vitro CRT-knockdown model of breast cancer using siRNA to examine the effects of CRT expression modulation on the invasive potential of MCF7 breast cancer cells. The level of CRT expression decreased by 87 % following siRNA transfection (Additional file 2: Table S2; Fig. 3a), which confirmed the successful knockdown of CRT. This was further confirmed by western blot analysis (Fig. 3b). In addition, MTT assay was used to evaluate the presence of potential cytotoxic effects of the siRNA and transfection reagent. The mean viability of the CRT-knockdown cells remained at about 90 % as compared to untreated cells (Fig. 3c).
The invasive characteristics of CRT-knockdown cells were then investigated using phenotypic assays. The migration assay (Additional file 3: Table S3; Figs. 3d, 4) revealed a significant decrease in the migratory potential of CRT-knockdown cells as compared to the control group (p < 0.05). The treatment with mitomycin-C did not alter this effect, suggesting that the inhibitory effect of calreticulin on migration is not proliferation-dependent (p < 0.05).
The mean number of invaded CRT-knockdown cells in a matrigel invasion assay (Additional file 4: Table S4; Fig. 5) was compared against the controls (Fig. 3e). There was a significant decrease (p < 0.05) in the number of invaded CRT-knockdown cells as compared to the control cells.
We then tried to identify possible CRT-associated signaling pathways using gene expression microarrays. A total of 1579 genes were significantly upregulated while 992 genes were downregulated in the CRT-knockdown cells. The 10 most up/downregulated genes are summarized in Table 2. The validity of the microarray data was confirmed using qPCR (Fig. 6).
Table 2
The 10 most up/downregulated genes upon knockdown of CRT expression
Gene name
Systematic name
Log FC
p value
IFIT1
NM_001548
2.9
0.00065
IFIT2
NM_001547
2.5
2.10E−05
IFI6
NM_022873
2.3
0.00016
IFIT3
NM_001549
2.3
0.00033
IFI27
NM_005532
2.2
0.0034
DDX58
NM_014314
2
7.20E−06
DDX60
NM_017631
2
5.00E−05
IFI27
NM_005532
2
0.0045
OASL
NM_003733
1.9
2.10E−05
SAMD9
NM_017654
1.9
7.30E−05
CALR
NM_004343
−2.7
5.20E−15
MNT
AF318360
−2.1
2.30E−13
CA306742
CA306742
−1.5
9.30E−12
FAM35A
NM_019054
−0.67
4.90E−06
PCNXL3
NM_032223
−0.58
2.00E−07
C13orf37
NM_001071775
−0.57
2.70E−06
TACC2
NM_206862
−0.56
0.00025
ENST00000301038
ENST00000301038
−0.5
5.40E−07
CPOX
NM_000097
−0.46
0.00037
TAOK3
NM_016281
−0.46
0.0023
Genes are listed based on their names, systematic names, fold changes in their expression (log FC) and the p values. CRT as the most down-regulated gene is shown in bold
To understand the biological significance of the global changes in the patterns of gene expression, related gene ontologies were analyzed. GeneCards® which is one of the options of GeneDecks V3 software was used for annotation classification. DAVID (Database for Annotation, Visualization and Integrated Discovery) was also used to reveal functional relationships of the proposed subsets of genes and related ontologies. Some of the most important and related ontologies for up/down-regulated genes are summarized in Additional file 5: Table S5. The genes in each category have been previously reported in the literature as responsible for or involved in the specific ontologies.
Among the significantly upregulated genes, MIA (melanoma inhibitory activity), KLK13 (kallikrein-related peptidase 13), HEPACAM (hepatic and glial cell adhesion molecule), MADD (MAP-kinase activating death domain), TP53I11 (tumor protein p53 inducible protein 11), based on the importance of their cellular localization have been reported as being associated with a more invasive cancer phenotype. In addition, LGALS3BP (lectin, galactoside-binding, soluble, 3 binding protein), MAP3K5 (mitogen-activated protein kinase kinase kinase 5), TNFSF10 (tumor necrosis factor (ligand) superfamily, member 10) which are mainly involved in various cellular processes are potentially associated with a higher invasive potential. Finally, BTG2 (BTG family, member 2), RARRES3 (retinoic acid receptor responder 3), SERPINA3 (serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3), SMPD3 (sphingomyelin phosphodiesterase 3, neutral), XAF1 (XIAP associated factor 1), SERPINB5 (serpin peptidase inhibitor, clade B (ovalbumin), member 5) and TP53TG5 are important cancer-related genes that were also significantly up-regulated in this study.
Among the significant downregulated genes, CCT5 (chaperonin containing TCP1, subunit 5), DBF4, HDAC4 (histone deacetylase 4), HDAC4 and TAF3 with important cellular localizations were shown to be correlated with higher invasive potential. In addition, CALB2 (calbindin 2) or calretinin, MAPRE2 (microtubule-associated protein, RP/EB family, member 2), RNASE1 (ribonuclease, RNase A family, 1), ESRRG or estrogen related receptor gamma, MAPK8 (mitogen-activated protein kinase 8) and PCMT1 (protein-L-isoaspartate (D-aspartate) O-methyltransferase) which are involved in various cellular processes have been reported to be associated with a more invasive cancer phenotype. Finally, C11orf17 (A kinase interacting protein 1), MAP2K6 (mitogen-activated protein kinase kinase 6: MKK6), PARD6A (par-6 partitioning defective 6 homolog alpha), MINA (MYC induced nuclear antigen), NUDT6 (fibroblast growth factor 2: FGF-2), PSMD10 (proteasome (prosome, macropain) 26S subunit, non-ATPase, 10: p28), PSMD10, FABP3 (fatty acid binding protein 3), AMPK (AMP-activated protein kinase) and PRND (prion protein 2) have been suggested to potentially contribute towards the migratory and morphological behavioral changes of tumor cells.
We also probed for any significant changes in the expression of other genes related to calreticulin chaperoning or calcium homeostasis. Our results showed significant overexpression of ERp57, GRP78 and GRP94 in CRT-knockdown breast cancer cells. These proteins are actively involved in protein chaperoning inside the ER. In addition, ERO1A which codes for an oxidizing enzyme involved in the regulation of the redox state of various ER proteins showed significant upregulation in CRT-knockdown genes. Finally, ITPR3 which encodes the receptor for inositol 1,4,5-trisphosphate was downregulated in CRT-knockdown cells. ITPR3 contains a calcium channel and is involved in the release of intracellular calcium.

Discussion

Our results demonstrate that the level of calreticulin expression in breast cancer is directly correlated with the invasiveness of the malignant lesions; represented by tumor stage/grade. This is in concordance with previous studies in which calreticulin overexpression was described in breast tumor epithelial cells, in which a correlation between calreticulin overexpression and the development of post-operative distant metastasis were reported [23, 24]. Calreticulin overexpression have also been reported in other malignant lesions such as esophageal squamous cell carcinoma [18], gastric cancer [19], pancreatic tumors [17], and even in melanoma cells [21].
The present study also reveals a significant upregulation of calreticulin in the stromal compartment of malignant tissues as compared to non-malignant tissues. To our knowledge, this is the first report that highlights the distinct calreticulin expression in the stroma of breast cancer. It is known that the growth and progression of malignant lesions entail the involvement of tumor stroma [25]. The stroma within the cancer microenvironment is usually subjected to different changes such as fibroblast activation, remodeling of extracellular matrix and finally angiogenesis [26]; where they are thought to act as a machinery for transforming the stroma into a protective microenvironment for metastasis [27]. Among the multiple inter players of the stroma/malignant cellular reaction, cancer-associated fibroblasts are drawing more attention as the receivers and creators of pro-tumorigenic signals [28]. In the present study, the characterization of calreticulin expression in breast cancer tissues shows the potential significance of its expression in the stroma.
The in vitro part of our study demonstrated that the migratory and invasive potential of CRT-knockdown MCF7 cells declined significantly as compared to the control groups. At the same time, MTT assay confirmed that these changes were not due to the alterations in the proliferative activity of the cells. These findings are in agreement with recent studies that indicate a role for calreticulin in conferring a pro-invasive and metastatic phenotype in a range of cancers, including breast adenocarcinoma [24, 29], gastric cancer [19], and esophageal squamous cell carcinoma [18].
Although the molecular mechanisms for cancer invasion and metastasis are not fully understood [30], different classes of proteins are involved or altered throughout this process. These proteins include cell adhesion molecules (CAMs) such as calcium dependent cadherin family, integrins and matrix proteases [31]. As calreticulin is also mainly involved in calcium homeostasis and protein chaperoning [5], several mechanisms can be proposed for its role in cancer initiation and progression. Calreticulin is able to prevent the anti-metastatic effects of estrogen receptor α (ERα) in breast cancer [29], induce cell migration and wound healing [32], as well as affect apoptosis through the regulation of calcium stores of the cell [11, 33, 34]. In addition, calreticulin effects on gene expression and cell adhesion are modulated indirectly through Ca2+ which makes it a central connector molecule inside a network of signaling pathways that are located in the endoplasmic reticulum [35]. On the cell surface, calreticulin regulates focal adhesion disassembly through the interaction with TSP/hep I complex suggesting it as an important component of the TSP signaling pathway that modulates cytoskeleton structure and supports the role in cell adhesion [36].
To propose a model of CRT gene interactions and related molecular pathways involved in conferring a more invasive breast cancer phenotype, further bioinformatic analysis was performed. Functional annotation of differentially expressed genes in CRT-knockdown cells revealed several dysregulated biological processes which can be suggested to be involved in calreticulin-associated pro-invasive effects. The most important dysregulated processes amongst the top gene ontologies were extracellular region, calcium homeostasis, DNA binding, regulation of transcription, estrogen metabolism and pathways, tumor progression, metastasis and cancer related processes. As expected, among the genes that were significantly up or downregulated, there were components of important signaling pathways such p53 and MAPK (Table 3) in which their possible interactions with calreticulin may contribute towards a more invasive breast cancer phenotype.
Table 3
The fold-change in gene expression of p53 and MAPK related genes from the microarray-based whole genome expression analysis of CRT-knockdown of MCF7 cells
Pathway
Gene name
Systematic name
Log FC
p value
MAPK
MAP2K6
NM_002758
−0.37
0.00091
MAPK8
ENST00000374189
−0.16
0.031
MAP2K1 (MKK1)
NM_002755
−0.12
0.31
MAP2K4 (MKK4)
NM_003010
−0.11
0.18
MAPK1 (ERK2)
NM_138957
−0.01
0.96
MAPK14 (p38)
NM_001315
−0.08
0.39
p53
SERPINB5
NM_002639
0.18
0.032
TP53I11
NM_001076787
0.25
0.036
TP53TG5
NM_014477
0.21
0.011
In the p53 pathway, active p53 functions as a transcription factor that upon sensing DNA damage or stress, will trigger a network of genes and their products such as TP53I11, TP53TG5 and SERPINB5 (maspin) that ultimately leads to cell cycle arrest, cellular senescence or apoptosis [37]. Our gene expression study confirmed that all these three p53 targets were significantly modulated following CRT knockdown in MCF7 cells (Fig. 7a). TP53I11 is a tumor suppressor gene that is involved in apoptosis [38]. TP53TG5 is a novel p53 target gene with cell cycle localization and growth suppressive effects in glioblastoma cells [39]. Finally, SERPINB5 (maspin) is a powerful tumor suppressor gene that is regulated by p53 at the transcriptional level and inhibits cell motility, invasion, angiogenesis and metastasis [40]. SERPINB5 is downregulated in breast cancer [41], and has the ability to modify the motility of breast cancer cells in vitro by inhibiting Rac1/Cdc42 activity [42]. In addition, SERPINB5 can potently inhibit the development of brain metastasis of breast cancer [43].
Our novel finding; significant upregulation (p < 0.05) of the three p53 target genes following CRT-knockdown correlates with the inhibition of the migratory and invasive potential of breast cancer cells. Therefore, we postulate that calreticulin is possibly able to modify the inductive effects of activated p53 on its target genes. The mechanism behind calreticulin-blocking effect on p53 target genes is not clear. However, it can be related to the changes in Ca2+ homeostasis as p53 has been reported to interact with other Ca2+ binding molecules such as S100A2 [44].
The activation of MAPK signaling through the extracellular signal related kinase pathway (ERK1, 2) and or stress activated kinase pathway (JNK/p38 MAPK) will lead to sequential phosphorylation events (Fig. 7b), activation of transcription factors and finally gene expression regulation [45]. Erk1 and 2 are the most relevant MAPK components for breast cancer development [46], while the level of activated p38 expression is reported to be associated with the presence of lymph node metastasis in breast cancer [47].
Our results suggest that CRT down-regulation in MCF7 cells will result in significant downregulation (p < 0.05) of the expression levels of some of the components of MAPK pathway including MAP2K6 and MAPK8. In addition, some of the other MAPK components such as MEK1 and MEK4 also showed reduction in their level of expression. These findings correspond to the significant decrease in the migratory and invasive potential of the cells. Therefore, calreticulin can be proposed to act as a potential inducer of the MAPK pathway. This can be supported by the fact that MAPK pathway activity is also modified by other Ca2+ homeostasis proteins such as Ras-GRF1, which is a Ca2+/calmodulin-dependent Ras-guanine-nucleotide-releasing factor [45], SERCA2 [48], and CaMKII (calcium/calmodulin-dependent protein kinase II gamma) [49].

Conclusion

This study shows that calreticulin expression in breast cancer is correlated with the degree of invasiveness; especially when stromal expression is considered. Furthermore, calreticulin confers a more invasive breast cancer phenotype. We conclude that calreticulin is able to promote breast cancer migration and invasion through the transcriptional modulation of important genes and associated pathways such as MAPK and p53 signaling. These downstream genes that have an active contribution towards the malignant transformation of cancer cells are possibly the actual targets of calreticulin-associated pro-invasive effects and will need to be further evaluated in future studies.

Methods

Human breast tissue samples and breast cancer cell line

Fresh frozen breast cancer tissues for this study were obtained from Hospital Universiti Kebangsaan Malaysia. Ethics approval and patient informed consent including consent to participate in the study and consent to publish was obtained in written in accordance to the Universiti Kebangsaan Malaysia Research and Medical Ethics Committee (Approval No. FF-166-2004). Fresh frozen samples of infiltrating ductal carcinoma and adjacent normal tissues were collected from 12 patients who underwent breast surgery. The samples were snap frozen and stored at −80 °C until protein analysis was performed. Formalin-fixed paraffin-embedded (FFPE) samples were obtained from the Pathology Department of Milad Hospital, Tehran, Iran, courtesy of Dr. Saadat Molanaii. These included 10 non-malignant and 38 malignant samples. Non-malignant samples were mainly from fibrocystic changes of the breast while all of the malignant tissues were diagnosed as ductal carcinoma. Malignant samples were stratified based on the grade as well as the stage of the tumors. MCF7 cell line was purchased from the American Type Culture Collection (ATCC) and used for the in vitro part of this study,

Two-Dimensional Gel Electrophoresis

For the first dimension, 17 cm pH 4–7 L IPG strips (Bio-Rad, Hercules, CA, USA) were used. The samples were passively rehydrated overnight using a rehydration buffer containing 7 M urea (Bio-Rad), 2 M thiourea (GE healthcare, Uppsala, Sweden), 2 % CHAPS (GE Healthcare), 1 % IPG buffer (pH 4–7) (GE healthcare), 0.2 % DTT (Bio-Rad) and bromophenol blue (Bio-Rad). The rehydrated IPG strips were focused using PROTEAN IEF cell (Bio-Rad). The current was applied in 3 steps; 250 V was applied in linear ramp for 20 min, then 10,000 V for 2.5 h in linear ramp and finally, the current increased rapidly to 40,000 V/hr when the isoelectric focusing was achieved. The strips were stored at −80 °C until the second dimension gel electrophoresis was performed. Strips were then equilibrated in two steps for 15 min each using an equilibration buffer consisting of 0.1 M Tris HCl (Amresco, Solon, OH, USA) pH 8.8, 6 M urea (Bio-Rad) 30 % Glycerol (GE Healthcare), 4 % SDS (GE Healthcare), 0.002 % Bromophenol Blue (Bio-Rad). In the first step of equilibration, 26 mM DDT (Bio-Rad) was added to the buffer, while 0.38 M of Iodoacetamide (Bio-Rad) was added to the buffer in the next step. The second dimension was then performed on 10 % SDS–polyacrylamide gels.

Gel staining and analysis

The gels were stained with silver staining and scanned using the GS-800 Calibrated Densitometer (Bio-Rad). The PDQuest software 7.3 (Bio-Rad) was used for differential analysis of the gels. The spots with at least a twofold increase were picked manually and stored at 4 °C until in-gel digestion was carried out.

Protein identification by MALDI-TOF MS

The excised spots were destained by first washing with a digestion buffer (25 mM ammonium bicarbonate) and then with 50 % acetonitrile digestion buffer. These steps were repeated three times. Digestion was performed with sequencing grade trypsin (Promega, Madison, WI, USA) at 37 °C overnight. The resulting tryptic peptides were extracted from the gels, then desalted and concentrated with C18 ziptip (Millipore, Billerica, MA, USA) before spotting for matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) analysis.

Immunohistochemistry

Immunohistochemistry was performed to evaluate histological expression of calreticulin using a mouse monoclonal [FMC 75] antibody (Abcam, Cambridge, UK) through the following protocol: 0.4 µ tissue sections were mounted on polysine-coated slides (Menzel, Berlin, Germany). After dewaxation and dehydration, heat induced antigen retrieval was done using Tris–EDTA buffer (pH: 9.0) for 10 min in sub-boiling conditions. This was followed by internal peroxidase inhibition with 3 % H2O2 for 10 min, blocking with 5 % BSA for 2 h, and then treatment with a primary antibody (anti-calreticulin) for 45 min at a concentration of 0.15 µgr/mL. For detection, Real™ EnVision™ Detection System (Dako, Glostrup, Denmark) was used for 30 min followed by chromogen staining using diaminobenzidine (DAB) for 10 min and finally counterstained by hematoxylin. All the procedures were carried out at room temperature.

Scoring the IHC results

An independent committee blinded to pathologic details of the specimens was assigned to score the IHC results. Three different histological areas of each malignant tissue including glandular, invasive and stromal parts were examined. These scores were calculated based on the intensity of the brown staining (1–3 plus) as well as the proportion of stained cells in glandular epithelium (<50 % = 0, 70–50 % = 1, 90–70 % = 2 and >90 % = 3) as well as stroma (<10 % = 1, 10–50 % = 2 and >50 % = 3).

RNA isolation & cDNA synthesis

Total RNA extraction was performed using RNeasy mini kit (Qiagen, Valencia, CA, USA) following the manufacturer's protocol. The concentration and quality of RNA were examined by measuring the absorbance ratios at 260 nm and 280 nm using the NanoDrop 2000 spectrophotometer (Thermoscientific, West Palm Beach, FL, USA) and running the samples on 1 % agarose gel, respectively. Finally, the RNA samples were reverse transcribed into cDNA using the Revert Aid™ H minus First Strand cDNA Synthesis kit (Thermoscientific) according to the manufacturer’s instructions.

Real-time PCR

The expression level for CRT as the gene of interest and beta actin as the housekeeping (reference) gene were examined using the SensiMixPlus SYBR kit (Quantace, London, UK) and then quantified based on the standard curve method. The primers were designed in a manner to amplify only the cDNAs compatible to the mRNA sequence but not the genomic sequence. The sequences of the primers for CRT are as follows: GGCGGCACCACCATGTACCCT (forward) and AGGGGCCGGACTCGTCATACT (reverse) while that for beta-actin are CTTCAAGGAGCAGTTTCTGG (forward) and GCTTGTCTGCAAACCTTTATC (reverse). The protocol for PCR was as follows: initial denaturation at 95 °C for 10 min, denaturation at 95 °C for 30 s, annealing at 52 °C (59 °C for beta actin) for 30 s, elongation at 72 °C for 45 s, and final elongation at 72 °C for 10 min. The reaction was run for 35 cycles.

Protein isolation

MCF7 cells were cultured until they reached 70–90 % confluence and were then lysed with a solution of 40 mM Tris (GE Healthcare, WI, USA), 7 M urea (Invitrogen, Carlsbad, CA, USA), 2 M thiourea (Invitrogen), 4 % CHAPS (Invitrogen), 65 mM Dithiothreitol (Invitrogen), 1 mM EDTA (Amresco) and 10 μl of Halt Protease Inhibitor Cocktail (Thermoscientific).

Western blot

The isolated proteins were run on 12.5 % polyacrylamide resolving gel and then transferred to a PVDF membrane and treated with the primary antibody at 4 °C overnight either using 1:200 dilution of mouse monoclonal antibody against human calreticulin 1G6A7 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or 1:10,000 dilution of mouse monoclonal [Ac-15] antibody against human beta actin (Genetex, Irvine, CA, USA). This was followed by an incubation in 1:2500 dilution of the secondary antibody (ImmunoPure Goat Anti-Mouse IgG, (H + L), Peroxidase Conjugated, Thermoscientific). The detection was carried out by a chemiluminescence method using SuperSignal West Pico Chemiluminescent Substrate (Thermoscientific).

siRNA gene knockdown

For CRT knockdown, ON-TARGETplus SMARTpool (Thermoscientific) and DharmaFECT 1 as the transfection reagent were used. Three controls were included in the experiment including untreated, negative and mock controls. For negative control (NC), ON-TARGETplus SMARTpool was replaced by non-targeting pool of siRNA. In mock control (M), ON-TARGETplus SMARTpool was replaced by equal amounts of antibiotic- and serum-free media. Finally, ON-TARGETplus SMARTpool and DharmaFECT 1 were replaced by antibiotic- and serum-free media in the untreated control (UT). For mRNA analysis, cells were harvested 36 h post-transfection while protein extraction was carried out at 72 h post-transfection.

MTT assay

MCF7 cells were cultured on 96-well plates in triplicates containing CRT-siRNA transfected or related control groups. At 24 h post-transfection, 20 μl of 5 mg/ml MTT solution was added to each well and incubated for 3.5 h at 37 °C and 5 % CO2. The content of each well was then replaced with 100 μl of DMSO (dimethyl sulfoxide). The plate was covered with an aluminium foil and agitated in an orbital shaker at room temperature for 15 min. Finally, the absorbance was read at 590 nm with a reference filter at 620 nm using an ELISA reader.

Migration assay

Four triplicates of MCF7 cells were grown on 12-well plates and incubated at 37 °C and 5 % CO2 until the cultures reached 70 % confluency. Two sets of cells were transfected with CRT-siRNA and the cultures were kept at 37 °C and 5 % CO2 for another 72 h. Then, 10 μg/ml mitomycin C (Merck, Whitehouse Station, NJ, USA) was added to one set of each triplicate (both siRNA treated and untreated). After 2 h, a longitudinal scratch was made on the central line of each well alongside the pre-applied marks at the bottom of each plate. Using a microscope with an attached camera (Leica, Wetzlar, Germany), images were captured from the specified marked loci of the gaps that were produced by the scratch on the monolayer of cells. Image capturing was repeated at certain time points including 0, 3, 6, 10, 15, 20, 24, 28, 32 and 36 h post-scratching. Finally, the diameter of the gap was measured in three different loci of each replicate at the specified marked areas using the Nis-Elements imaging software version 3.00 SP7. The average readings were calculated and the proportion of differences in the gap diameter at 0 and 20 h were used to compare the migratory potential of the different groups.

Invasion assay

At 48 h post-transfection, the media was replaced by serum-free DMEM overnight to simulate starving conditions. The following day, cells were harvested and diluted at a concentration of 1 × 105 cells/mL. The lower compartment of BD companion plates (BD, Franklin Lakes, NJ, USA) were filled with 750 μl of DMEM including 10 % FBS. Then, matrigel-coated inserts were placed inside the wells and 500 μl of cell suspension (5 × 104 cells) was added into each well and incubated at 37 °C and 5 % CO2 for 24 h. The inserts were then incubated in 100 % methanol for 10 min, washed in PBS twice and stained in hematoxylin for 2–5 min. Finally, the filter membranes were cut and mounted on slides using DPX (Merck). The total number of invaded cells in 10 random HPF was counted at 10× magnification of a light microscope.

Genome wide expression analysis

A triplicate hybridization of CRT-siRNA transfected MCF7 cells versus mock control was prepared and total RNA was extracted 36 h post-transfection. Only RNA samples with high quality (A260/A280 and A260/230 were set at ≥1.8 and ≥1.5, respectively) were picked for further evaluation. Agilent Whole Human Genome Microarray 4 × 44 K G4112F (Agilent, Palo Alto, CA, USA) which, consisted of 43,376 oligonucleotides was used for expression profiling. The preparation of expression arrays, hybridization process and scan readings were carried out by Oxford Gene Technology (Oxfordshire, UK). The microarray data was deposited in NCBI’s Gene Expression Omnibus [50] and is accessible through GEO Series accession number GSE44371.

Statistical analysis

For the IHC results, one-way ANOVA followed by post hoc test (Duncan option) was used. In other experiments, independent Student’s t test was used to determine any statistical significance of the results.

Authors’ contributions

MZ carried out the IHC analysis, CRT-knockdown experiments and bioinformatics analysis as well as drafted the manuscript. LAQH carried out the 2D gel electrophoresis and MALDI-TOF. RR participated in the design of the study, editing and final verifications. AV conceived the study and was involved in the drafting and editing of the manuscript. SAR helped in the pathological assessment and scoring of the tissue samples. SS assisted in the statistical analysis of the IHC results. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by funding from the Research University Grant Scheme, Universiti Putra Malaysia (UPM), Grant No. 04/01/07/0110RU and a Graduate Research Fellowship from UPM that was awarded to Mohammadreza Zamanian. The authors wish to thank Professor Sharifah Noor Akmal for providing the clinical specimens used in the study.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Berns EMJJ. Use of micro array analysis to predict out come and response in breast cancer patients. Br J Cancer Suppl. 2004;9:49–50. Berns EMJJ. Use of micro array analysis to predict out come and response in breast cancer patients. Br J Cancer Suppl. 2004;9:49–50.
2.
Zurück zum Zitat Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59:225–49.CrossRefPubMed Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59:225–49.CrossRefPubMed
3.
Zurück zum Zitat Green M, Raina V. Epidemiology, screening and diagnosis of breast cancer in the Asia-Pacific region: current perspectives and important considerations. Asia-Pacific J Clin Oncol. 2008;4:S5–13.CrossRef Green M, Raina V. Epidemiology, screening and diagnosis of breast cancer in the Asia-Pacific region: current perspectives and important considerations. Asia-Pacific J Clin Oncol. 2008;4:S5–13.CrossRef
4.
Zurück zum Zitat van de Vijver M. Gene-expression profiling and the future of adjuvant therapy. Oncologist. 2005;10:30–4.CrossRefPubMed van de Vijver M. Gene-expression profiling and the future of adjuvant therapy. Oncologist. 2005;10:30–4.CrossRefPubMed
5.
6.
Zurück zum Zitat Nakamura K, Zuppini A, Arnaudeau S, Lynch J, Ahsan I, Krause R, Papp S, De Smedt H, Parys JB, Müller-Esterl W, et al. Functional specialization of calreticulin domains. J Cell Biol. 2001;154:961–72.CrossRefPubMedPubMedCentral Nakamura K, Zuppini A, Arnaudeau S, Lynch J, Ahsan I, Krause R, Papp S, De Smedt H, Parys JB, Müller-Esterl W, et al. Functional specialization of calreticulin domains. J Cell Biol. 2001;154:961–72.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Orr AW, Elzie CA, Kucik DF, Murphy-Ullrich JE. Thrombospondin signaling through the calreticulin/LDL receptor-related protein co-complex stimulates random and directed cell migration. J Cell Sci. 2003;116:2917–27.CrossRefPubMed Orr AW, Elzie CA, Kucik DF, Murphy-Ullrich JE. Thrombospondin signaling through the calreticulin/LDL receptor-related protein co-complex stimulates random and directed cell migration. J Cell Sci. 2003;116:2917–27.CrossRefPubMed
8.
Zurück zum Zitat Opas M, Dziak E, Fliegel L, Michalak M. Regulation of expression and intracellular distribution of calreticulin, a major calcium binding protein of nonmuscle cells. J Cell Physiol. 1991;149:160–71.CrossRefPubMed Opas M, Dziak E, Fliegel L, Michalak M. Regulation of expression and intracellular distribution of calreticulin, a major calcium binding protein of nonmuscle cells. J Cell Physiol. 1991;149:160–71.CrossRefPubMed
9.
Zurück zum Zitat Gao B, Adhikari R, Howarth M, Nakamura K, Gold MC, Hill AB, Knee R, Michalak M, Elliott T. Assembly and antigen-presenting function of MHC class I molecules in cells lacking the ER chaperone calreticulin. Immunity. 2002;16:99–109.CrossRefPubMed Gao B, Adhikari R, Howarth M, Nakamura K, Gold MC, Hill AB, Knee R, Michalak M, Elliott T. Assembly and antigen-presenting function of MHC class I molecules in cells lacking the ER chaperone calreticulin. Immunity. 2002;16:99–109.CrossRefPubMed
10.
Zurück zum Zitat Yoon G-S, Lee H, Jung Y, Yu E, Moon H-B, Song K, Lee I. Nuclear matrix of calreticulin in hepatocellular carcinoma. Cancer Res. 2000;60:1117–20.PubMed Yoon G-S, Lee H, Jung Y, Yu E, Moon H-B, Song K, Lee I. Nuclear matrix of calreticulin in hepatocellular carcinoma. Cancer Res. 2000;60:1117–20.PubMed
11.
Zurück zum Zitat Chen D, Texada DE, Duggan C, Liang C, Reden TB, Kooragayala LM, Langford MP. Surface calreticulin mediates muramyl dipeptide-induced apoptosis in RK13 cells. J Biol Chem. 2005;280:22425–36.CrossRefPubMed Chen D, Texada DE, Duggan C, Liang C, Reden TB, Kooragayala LM, Langford MP. Surface calreticulin mediates muramyl dipeptide-induced apoptosis in RK13 cells. J Biol Chem. 2005;280:22425–36.CrossRefPubMed
12.
Zurück zum Zitat Zamanian M, Veerakumarasivam A, Rosli R, Abdullah S. Calreticulin and cancer. Pathol Oncol Res. 2013;19:149.CrossRefPubMed Zamanian M, Veerakumarasivam A, Rosli R, Abdullah S. Calreticulin and cancer. Pathol Oncol Res. 2013;19:149.CrossRefPubMed
13.
Zurück zum Zitat Bini L, Magi B, Marzocchi B, Arcuri F, Tripodi S, Cintorino M, Sanchez J-C, Frutiger S, Hughes G, Pallini V, et al. Protein expression profiles in human breast ductal carcinoma and histologically normal tissue. Electrophoresis. 1997;18:2832–41.CrossRefPubMed Bini L, Magi B, Marzocchi B, Arcuri F, Tripodi S, Cintorino M, Sanchez J-C, Frutiger S, Hughes G, Pallini V, et al. Protein expression profiles in human breast ductal carcinoma and histologically normal tissue. Electrophoresis. 1997;18:2832–41.CrossRefPubMed
14.
Zurück zum Zitat Kageyama S, Isono T, Iwaki H, Wakabayashi Y, Okada Y, Kontani K, Yoshimura K, Terai A, Arai Y, Yoshiki T. Identification by proteomic analysis of calreticulin as a marker for bladder cancer and evaluation of the diagnostic accuracy of its detection in urine. Clin Chem. 2004;50:857–66.CrossRefPubMed Kageyama S, Isono T, Iwaki H, Wakabayashi Y, Okada Y, Kontani K, Yoshimura K, Terai A, Arai Y, Yoshiki T. Identification by proteomic analysis of calreticulin as a marker for bladder cancer and evaluation of the diagnostic accuracy of its detection in urine. Clin Chem. 2004;50:857–66.CrossRefPubMed
15.
Zurück zum Zitat Ayodele A, Uwe R, Lars E, Adelaide C, Bo F, Daniela V, Sören H, Stig L, Gert A. Polypeptide expression in prostate hyperplasia and prostate adenocarcinoma. Anal Cell Pathol. 2000;21:1–9.CrossRef Ayodele A, Uwe R, Lars E, Adelaide C, Bo F, Daniela V, Sören H, Stig L, Gert A. Polypeptide expression in prostate hyperplasia and prostate adenocarcinoma. Anal Cell Pathol. 2000;21:1–9.CrossRef
16.
Zurück zum Zitat Kim Y, Kim H-J, Song E, Lee K-J. Glucoronic acid is a novel inducer of heat shock response. Mol Cell Biochem. 2004;259:23–33.CrossRefPubMed Kim Y, Kim H-J, Song E, Lee K-J. Glucoronic acid is a novel inducer of heat shock response. Mol Cell Biochem. 2004;259:23–33.CrossRefPubMed
17.
Zurück zum Zitat Hong S-H, Misek DE, Wang H, Puravs E, Giordano TJ, Greenson JK, Brenner DE, Simeone DM, Logsdon CD, Hanash SM. An autoantibody-mediated immune response to calreticulin isoforms in pancreatic cancer. Cancer Res. 2004;64:5504–10.CrossRefPubMed Hong S-H, Misek DE, Wang H, Puravs E, Giordano TJ, Greenson JK, Brenner DE, Simeone DM, Logsdon CD, Hanash SM. An autoantibody-mediated immune response to calreticulin isoforms in pancreatic cancer. Cancer Res. 2004;64:5504–10.CrossRefPubMed
18.
Zurück zum Zitat Du XL, Yang H, Liu SG, Luo ML, Hao JJ, Zhang Y, Lin DC, Xu X, Cai Y, Zhan QM, Wang MR. Calreticulin promotes cell motility and enhances resistance to anoikis through STAT3-CTTN-Akt pathway in esophageal squamous cell carcinoma. Oncogene. 2009;28:3714–22.CrossRefPubMed Du XL, Yang H, Liu SG, Luo ML, Hao JJ, Zhang Y, Lin DC, Xu X, Cai Y, Zhan QM, Wang MR. Calreticulin promotes cell motility and enhances resistance to anoikis through STAT3-CTTN-Akt pathway in esophageal squamous cell carcinoma. Oncogene. 2009;28:3714–22.CrossRefPubMed
19.
Zurück zum Zitat Chen CN, Chang CC, Su TE, Hsu WM, Jeng YM, Ho MC, Hsieh FJ, Lee PH, Kuo ML, Lee H, Chang KJ. Identification of calreticulin as a prognosis marker and angiogenic regulator in human gastric cancer. Ann Surg Oncol. 2009;16:524–33.CrossRefPubMed Chen CN, Chang CC, Su TE, Hsu WM, Jeng YM, Ho MC, Hsieh FJ, Lee PH, Kuo ML, Lee H, Chang KJ. Identification of calreticulin as a prognosis marker and angiogenic regulator in human gastric cancer. Ann Surg Oncol. 2009;16:524–33.CrossRefPubMed
20.
Zurück zum Zitat Vougas K, Gaitanarou E, Marinos E, Kittas C, Voloudakis-Baltatzis IE. Two-dimensional electrophoresis and immunohistochemical study of calreticulin in colorectal adenocarcinoma and mirror biopsies. J BUON. 2008;13:101–7.PubMed Vougas K, Gaitanarou E, Marinos E, Kittas C, Voloudakis-Baltatzis IE. Two-dimensional electrophoresis and immunohistochemical study of calreticulin in colorectal adenocarcinoma and mirror biopsies. J BUON. 2008;13:101–7.PubMed
21.
Zurück zum Zitat Dissemond J, Busch M, Kothen T, Mörs J, Weimann TK, Lindeke A, Goos M, Wagner SN. Differential downregulation of endoplasmic reticulum-residing chaperones calnexin and calreticulin in human metastatic melanoma. Cancer Lett. 2004;203:225–31.CrossRefPubMed Dissemond J, Busch M, Kothen T, Mörs J, Weimann TK, Lindeke A, Goos M, Wagner SN. Differential downregulation of endoplasmic reticulum-residing chaperones calnexin and calreticulin in human metastatic melanoma. Cancer Lett. 2004;203:225–31.CrossRefPubMed
22.
Zurück zum Zitat Helbling D, Mueller BU, Timchenko NA, Schardt J, Eyer M, Betts DR, Jotterand M, Meyer-Monard S, Fey MF, Pabst T. CBFB-SMMHC is correlated with increased calreticulin expression and suppresses the granulocytic differentiation factor CEBPA in AML with inv(16). Blood. 2005;106:1369–75.CrossRefPubMed Helbling D, Mueller BU, Timchenko NA, Schardt J, Eyer M, Betts DR, Jotterand M, Meyer-Monard S, Fey MF, Pabst T. CBFB-SMMHC is correlated with increased calreticulin expression and suppresses the granulocytic differentiation factor CEBPA in AML with inv(16). Blood. 2005;106:1369–75.CrossRefPubMed
23.
Zurück zum Zitat Eric A, Juranic Z, Milovanovic Z, Markovic I, Inic M, Stanojevic-Bakic N, Vojinovic-Golubovic V. Effects of humoral immunity and calreticulin overexpression on postoperative course in breast cancer. Pathol Oncol Res. 2009;15:89–90.CrossRefPubMed Eric A, Juranic Z, Milovanovic Z, Markovic I, Inic M, Stanojevic-Bakic N, Vojinovic-Golubovic V. Effects of humoral immunity and calreticulin overexpression on postoperative course in breast cancer. Pathol Oncol Res. 2009;15:89–90.CrossRefPubMed
24.
Zurück zum Zitat Lwin Z-M, Guo C, Salim A, Yip GW-C, Chew F-T, Nan J, Thike AA, Tan P-H, Bay B-H. Clinicopathological significance of calreticulin in breast invasive ductal carcinoma. Mod Pathol. 2010;23:1559.CrossRefPubMed Lwin Z-M, Guo C, Salim A, Yip GW-C, Chew F-T, Nan J, Thike AA, Tan P-H, Bay B-H. Clinicopathological significance of calreticulin in breast invasive ductal carcinoma. Mod Pathol. 2010;23:1559.CrossRefPubMed
26.
Zurück zum Zitat Tuxhorn JA, McAlhany SJ, Dang TD, Ayala GE, Rowley DR. Stromal cells promote angiogenesis and growth of human prostate tumors in a differential reactive stroma (DRS) xenograft model. Cancer Res. 2002;62:3298–307.PubMed Tuxhorn JA, McAlhany SJ, Dang TD, Ayala GE, Rowley DR. Stromal cells promote angiogenesis and growth of human prostate tumors in a differential reactive stroma (DRS) xenograft model. Cancer Res. 2002;62:3298–307.PubMed
27.
Zurück zum Zitat Mueller MM, Fusenig NE. Friends or foes—bipolar effects of the tumour stroma in cancer. Nat Rev Cancer. 2004;4:839–49.CrossRefPubMed Mueller MM, Fusenig NE. Friends or foes—bipolar effects of the tumour stroma in cancer. Nat Rev Cancer. 2004;4:839–49.CrossRefPubMed
28.
Zurück zum Zitat Östman A, Augsten M. Cancer-associated fibroblasts and tumor growth—bystanders turning into key players. Curr Opin Genet Dev. 2009;19:67–73.CrossRefPubMed Östman A, Augsten M. Cancer-associated fibroblasts and tumor growth—bystanders turning into key players. Curr Opin Genet Dev. 2009;19:67–73.CrossRefPubMed
29.
Zurück zum Zitat Platet N, Cunat S, Chalbos D, Rochefort H, Garcia M. Unliganded and liganded estrogen receptors protect against cancer invasion via different mechanisms. Mol Endocrinol. 2000;14:999–1009.CrossRefPubMed Platet N, Cunat S, Chalbos D, Rochefort H, Garcia M. Unliganded and liganded estrogen receptors protect against cancer invasion via different mechanisms. Mol Endocrinol. 2000;14:999–1009.CrossRefPubMed
30.
Zurück zum Zitat Janda E, Lehmann K, Killisch I, Jechlinger M, Herzig M, Downward J, Beug H, Grünert S. Ras and TGFβ cooperatively regulate epithelial cell plasticity and metastasis. J Cell Biol. 2002;156:299–314.CrossRefPubMedPubMedCentral Janda E, Lehmann K, Killisch I, Jechlinger M, Herzig M, Downward J, Beug H, Grünert S. Ras and TGFβ cooperatively regulate epithelial cell plasticity and metastasis. J Cell Biol. 2002;156:299–314.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Gold LI, Rahman M, Blechman KM, Greives MR, Churgin S, Michaels J, Callaghan MJ, Cardwell NL, Pollins AC, Michalak M, et al. Overview of the role for calreticulin in the enhancement of wound healing through multiple biological effects. J Investig Dermatol Symp Proc. 2006;11:57–65.CrossRefPubMed Gold LI, Rahman M, Blechman KM, Greives MR, Churgin S, Michaels J, Callaghan MJ, Cardwell NL, Pollins AC, Michalak M, et al. Overview of the role for calreticulin in the enhancement of wound healing through multiple biological effects. J Investig Dermatol Symp Proc. 2006;11:57–65.CrossRefPubMed
33.
Zurück zum Zitat Mesaeli N, Phillipson C. Impaired p53 expression, function and nuclear localization in calreticulin deficient cells. Mol Biol Cell. 2004;15:1862.CrossRefPubMedPubMedCentral Mesaeli N, Phillipson C. Impaired p53 expression, function and nuclear localization in calreticulin deficient cells. Mol Biol Cell. 2004;15:1862.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat Vanoverberghe K, Vanden Abeele F, Mariot P, Lepage G, Roudbaraki M, Bonnal JL, Mauroy B, Shuba Y, Skryma R, Prevarskaya N. Ca2+ homeostasis and apoptotic resistance of neuroendocrine-differentiated prostate cancer cells. Cell Death Differ. 2003;11:321–30.CrossRef Vanoverberghe K, Vanden Abeele F, Mariot P, Lepage G, Roudbaraki M, Bonnal JL, Mauroy B, Shuba Y, Skryma R, Prevarskaya N. Ca2+ homeostasis and apoptotic resistance of neuroendocrine-differentiated prostate cancer cells. Cell Death Differ. 2003;11:321–30.CrossRef
35.
Zurück zum Zitat Michalak M, Robert Parker JM, Opas M. Ca2+ signaling and calcium binding chaperones of the endoplasmic reticulum. Cell Calcium. 2002;32:269–78.CrossRefPubMed Michalak M, Robert Parker JM, Opas M. Ca2+ signaling and calcium binding chaperones of the endoplasmic reticulum. Cell Calcium. 2002;32:269–78.CrossRefPubMed
36.
Zurück zum Zitat Goicoechea S, Pallero MA, Eggleton P, Michalak M, Murphy-Ullrich JE. The anti-adhesive activity of thrombospondin is mediated by the N-terminal domain of cell surface calreticulin. J Biol Chem. 2002;277:37219–28.CrossRefPubMed Goicoechea S, Pallero MA, Eggleton P, Michalak M, Murphy-Ullrich JE. The anti-adhesive activity of thrombospondin is mediated by the N-terminal domain of cell surface calreticulin. J Biol Chem. 2002;277:37219–28.CrossRefPubMed
37.
Zurück zum Zitat Harris SL, Levine AJ. The p53 pathway: positive and negative feedback loops. Oncogene. 2005;24:2899–908.CrossRefPubMed Harris SL, Levine AJ. The p53 pathway: positive and negative feedback loops. Oncogene. 2005;24:2899–908.CrossRefPubMed
38.
Zurück zum Zitat Wu Y, Liu X-M, Wang X-J, Zhang Y, Liang X-Q, Cao E-H. PIG11 is involved in hepatocellular carcinogenesis and its over-expression promotes Hepg2 cell apoptosis. Pathol Oncol Res. 2009;15:411–6.CrossRefPubMed Wu Y, Liu X-M, Wang X-J, Zhang Y, Liang X-Q, Cao E-H. PIG11 is involved in hepatocellular carcinogenesis and its over-expression promotes Hepg2 cell apoptosis. Pathol Oncol Res. 2009;15:411–6.CrossRefPubMed
39.
Zurück zum Zitat Isaka S, Takei Y, Tokino T, Koyama K, Miyoshi Y, Suzuki M, Takahashi E, Azuma C, Murata Y, Nakamura Y. Isolation and characterization of a novel TP53-inducible gene, TP53TG5, which suppresses growth and shows cell cycle-dependent transition of expression. Genes Chromosomes Cancer. 2000;27:345–52.CrossRefPubMed Isaka S, Takei Y, Tokino T, Koyama K, Miyoshi Y, Suzuki M, Takahashi E, Azuma C, Murata Y, Nakamura Y. Isolation and characterization of a novel TP53-inducible gene, TP53TG5, which suppresses growth and shows cell cycle-dependent transition of expression. Genes Chromosomes Cancer. 2000;27:345–52.CrossRefPubMed
41.
Zurück zum Zitat Zou Z, Anisowicz A, Hendrix M, Thor A, Neveu M, Sheng S, Rafidi K, Seftor E, Sager R. Maspin, a serpin with tumor-suppressing activity in human mammary epithelial cells. Science. 1994;263:526–9.CrossRefPubMed Zou Z, Anisowicz A, Hendrix M, Thor A, Neveu M, Sheng S, Rafidi K, Seftor E, Sager R. Maspin, a serpin with tumor-suppressing activity in human mammary epithelial cells. Science. 1994;263:526–9.CrossRefPubMed
42.
Zurück zum Zitat Shi HY, Stafford LJ, Liu Z, Liu M, Zhang M. Maspin controls mammary tumor cell migration through inhibiting Rac1 and Cdc42, but not the RhoA GTPase. Cell Motil Cytoskeleton. 2007;64:338–46.CrossRefPubMed Shi HY, Stafford LJ, Liu Z, Liu M, Zhang M. Maspin controls mammary tumor cell migration through inhibiting Rac1 and Cdc42, but not the RhoA GTPase. Cell Motil Cytoskeleton. 2007;64:338–46.CrossRefPubMed
43.
Zurück zum Zitat Stark A, Schem C, Maass N, Hugo HH, Jonat W, Mehdorn HM, Held-Feindt J. Expression of metastasis suppressor gene maspin is reduced in breast cancer brain metastases and correlates with the estrogen receptor status. Neurol Res. 2010;32:303–8.CrossRefPubMed Stark A, Schem C, Maass N, Hugo HH, Jonat W, Mehdorn HM, Held-Feindt J. Expression of metastasis suppressor gene maspin is reduced in breast cancer brain metastases and correlates with the estrogen receptor status. Neurol Res. 2010;32:303–8.CrossRefPubMed
44.
Zurück zum Zitat Mueller A, Schäfer BW, Ferrari S, Weibel M, Makek M, Höchli M, Heizmann CW. The calcium-binding protein S100A2 interacts with p53 and modulates its transcriptional activity. J Biol Chem. 2005;280:29186–93.CrossRefPubMed Mueller A, Schäfer BW, Ferrari S, Weibel M, Makek M, Höchli M, Heizmann CW. The calcium-binding protein S100A2 interacts with p53 and modulates its transcriptional activity. J Biol Chem. 2005;280:29186–93.CrossRefPubMed
45.
Zurück zum Zitat Thomas GM, Huganir RL. MAPK cascade signalling and synaptic plasticity. Nat Rev Neurosci. 2004;5:173–83.CrossRefPubMed Thomas GM, Huganir RL. MAPK cascade signalling and synaptic plasticity. Nat Rev Neurosci. 2004;5:173–83.CrossRefPubMed
46.
Zurück zum Zitat Santen RJ, Song RX, McPherson R, Kumar R, Adam L, Jeng M-H, Yue W. The role of mitogen-activated protein (MAP) kinase in breast cancer. J Steroid Biochem Mol Biol. 2002;80:239–56.CrossRefPubMed Santen RJ, Song RX, McPherson R, Kumar R, Adam L, Jeng M-H, Yue W. The role of mitogen-activated protein (MAP) kinase in breast cancer. J Steroid Biochem Mol Biol. 2002;80:239–56.CrossRefPubMed
47.
Zurück zum Zitat Han Y, Liu L, Yan D, Wang G. Correlation between expression of P38 MAPK-signaling and uPA in breast cancer. Chin J Clin Oncol. 2008;5:161–4.CrossRef Han Y, Liu L, Yan D, Wang G. Correlation between expression of P38 MAPK-signaling and uPA in breast cancer. Chin J Clin Oncol. 2008;5:161–4.CrossRef
48.
Zurück zum Zitat Andrews C, Ho PD, Dillmann WH, Glembotski CC, McDonough PM. The MKK6—p38 MAPK pathway prolongs the cardiac contractile calcium transient, downregulates SERCA2, and activates NF-AT. Cardiovasc Res. 2003;59:46–56.CrossRefPubMed Andrews C, Ho PD, Dillmann WH, Glembotski CC, McDonough PM. The MKK6—p38 MAPK pathway prolongs the cardiac contractile calcium transient, downregulates SERCA2, and activates NF-AT. Cardiovasc Res. 2003;59:46–56.CrossRefPubMed
49.
Zurück zum Zitat Kandilci A, Grosveld GC. SET-induced calcium signaling and MAPK//ERK pathway activation mediate dendritic cell-like differentiation of U937 cells. Leukemia. 2005;19:1439–45.CrossRefPubMed Kandilci A, Grosveld GC. SET-induced calcium signaling and MAPK//ERK pathway activation mediate dendritic cell-like differentiation of U937 cells. Leukemia. 2005;19:1439–45.CrossRefPubMed
50.
Zurück zum Zitat Edgar R, Domrachev M, Lash AE. Gene expression omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30:207–10.CrossRefPubMedPubMedCentral Edgar R, Domrachev M, Lash AE. Gene expression omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30:207–10.CrossRefPubMedPubMedCentral
Metadaten
Titel
Calreticulin mediates an invasive breast cancer phenotype through the transcriptional dysregulation of p53 and MAPK pathways
verfasst von
Mohammadreza Zamanian
Lama Abdel Qader Hamadneh
Abhi Veerakumarasivam
Sabariah Abdul Rahman
Shamarina Shohaimi
Rozita Rosli
Publikationsdatum
01.12.2016
Verlag
BioMed Central
Erschienen in
Cancer Cell International / Ausgabe 1/2016
Elektronische ISSN: 1475-2867
DOI
https://doi.org/10.1186/s12935-016-0329-y

Weitere Artikel der Ausgabe 1/2016

Cancer Cell International 1/2016 Zur Ausgabe

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.