Background
Global hypomethylation is often accompanied by dense hypermethylation of the specific promoters in human cancers [
1‐
3]. Promoter hypermethylation results in gene silencing, and such genes have proved to have potent tumor suppressive function and is rather rare [
1,
4]. We previously developed pharmacologic reversal of epigenetic silencing and uncovered a myriad of transcriptionally repressed genes in human cancers [
5,
6]. Using this technique, we have identified several unknown tumor suppressor gene candidates, which included HOP homeobox (HOPX) [
7,
8].
HOPX gene (GeneBank accession number NT 022853), also known as HOP, NECC1, LAGY or OB1, was initially identified as a gene essential for cardiac growth and development [
9]. Three spliced transcript variants, HOPX-α, -β, and -γ, encode the same protein, which contains a putative homeodomain motif that acts as an adapter protein to mediate transcription [
10]. HOPX expression is ubiquitous in wide arrays of normal tissue, but not in malignant tissues including choriocarcinoma, lung, uterine endometrial, and gastrointestinal (GI) cancers [
7,
8,
11‐
15]. The inactivation mechanism actually involves promoter methylation in esophageal, endometrial, and gastric cancer [
7,
8,
15]. Also, enforced HOPX expression inhibited tumor growth and RNA interference knockdown of endogenous HOPX restored it [
7,
8,
15]. These findings suggest that the HOPX gene acts as a tumor suppressor gene.
In this study, we for the first time studied methylation level of HOPX gene in PC and added the functional assay to answer the question whether HOPX plays an important role in pancreatic carcinogenesis.
Methods
Cell lines and tissue samples
The pancreatic cancer cell lines, PK-8, KLM-1, and NOR-P1 were kindly provided from the Cell Resource Centre for Biomedical Research Institute of Development, Aging and Cancer, Tohoku University (Sendai, Japan). Six other cell lines, PK-59, PK-45 H, PK-45P, MIA Paca2, PANC-1, or the esophageal squamous cell carcinoma (ESCC) cell line TE15 [
16] and gastric cancer cell line KatoIII were purchased from RIKEN BioResource Centre (Ibaraki, Japan). All cell lines except MIA Paca2 were maintained in RPMI 1640 Medium (GIBCO, Carlsbad, CA) and MIA Paca2 was maintained in DMEM (GIBCO), containing 10% fetal bovine serum.
Clinical tissue samples were categorized according to TNM classification, 7
th edition of the Union Internationale Contre Le Cancer (UICC) and the 6
th edition of the Japan Pancreas Society (JPS). The patients’ characteristics were depicted in Additional file
1 Table S1. All tissue samples were collected at the Kitasato University Hospital, and informed consent was obtained. The present study was approved by the Ethics Committee of the Kitasato University.
Bisulfite treatment of DNA and sequencing analysis
Genomic DNA from homogenized bulky tissues and cell lines was extracted using QIAamp DNA Mini Kit (QIAGEN Sciences, Hilden). Bisulfite treatment was done by using an EpiTect bisulfite kit (QIAGEN) and the DNA was applied to polymerase chain reaction (PCR). PCR primer sequences were designed using DNA sequences converted by bisulfited treatment (Table
1). The PCR products were sequenced using a Big Dye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). For the clonsed sequence analysis, the PCR products were inserted into pCR4-TOPO vector using a TOPO TA cloning kit for sequencing (Invitrogen, Carlsbad, CA, USA), selected 15 clones for each sample and then sequenced.
Table 1
PCR production and sequence of primers and fluorescent probe
bisulfite sequencing†
| HOPX-β | TAGTITTGTTTGGAAGAGGGGCG | | AACCTCCCCTAAAAACAAACTTAAC |
Q-MSP‡
| HOPX-β | TTTGGAGAGGGTTTTAAAGCG | FAM-CGGAGATAGAAGGTCGTTTATCGGGGAGGTCG-TAMRA | AACAAACTTAACAAATCGCGAA |
Q-MSP‡
| β-actin | TGGTGATGGAGGAGGTTTAGTAAGT | FAM-ACCACCACCCAACACACAATAACAAACACA-TAMRA | AACCAATAAAACCTACTCCTCCCTTAA |
RT-PCR§
| HOPX-α and γ | CAAACCCAGGGCTTGCGCTT | | GCGGAGGAGCGAAACAGAGAT |
RT-PCR§/Q-RT-PCR | HOPX-β | GGTCCCCCTTTCGGGAGGAA | | GCGGAGGAGAGAAACAGAGAT |
RT-PCR§/Q-RT-PCR | HOPX-core | CAGAGGACCAGGTGGAAATCC | | GCGGAGGAGAGAAACAGAGAT |
RT-PCR§/Q-RT-PCR | β-actin | GCTCGTCGTCGACAACGGCTC | | CAAACATGATCTGGGTCATCTTCT |
PCR for cloning#
| HOPX | CACCATGTCGGCGGAGACCGCGAGCGG | | GTCTGTGACGGATCTGACACTCTG |
Quantitative-methylation-specific PCR (Q-MSP)
TaqMan methylation specific PCR (Q-MSP) was carried out using iQ Supermix (Bio-Rad) in triplicate on the iCycler iQ
TM Real-Time PCR Detection system (Bio-Rad). PCR conditions and the primer sequences are provided in Table
1. Serial dilutions of bisulfite modified DNA from KatoIII were used as positive control and TE15 as negative control, respectively. The methylation value was defined by a ratio of HOPX-β divided by β-actin and then multiplied by 100, according to the comparative cycle threshold (C
T) method [
17].
RNA purification and reverse transcriptase-polymerase chain reaction
Total RNA from homogenized bulky tissues and cell lines was extracted using RNeasy Mini Kit (QIAGEN), and reverse-transcribed with a SuperScript III Reverse Transcriptase kit (Invitrogen). Quantitative real time RT-PCR (Q-RT-PCR) for HOPX-β or HOPX-core was performed using iQ
TM SYBR Green Supermix (Bio-Rad) in triplicate on the iCycler iQ
TM Real-Time PCR Detection system (Bio-Rad), either (Table
1). Relative quantitative analysis adjusted for β-actin was performed according to the C
T method [
17]. Table
1 depicts sequences of primers/probes and PCR condition.
Immunoprecipitation and Western blotting
Whole cells lysates were obtained using RIPA buffer (Pierce, Rockford, IL) supplemented with 10 μL/ ml HaltTM Protease Inhibitor Cocktail Kit (Pierce) and HaltTM Phosphatase Inhibitor Cocktail Kit (Pierce). Immunoprecipitation (IP) was performed using Dynabeads Protein G (Dynal Biotech, Oslo, Norway), 1 μg of anti-HOPX mouse IgG1K monoclonal antibody (3D6, Sigma), and 400 μg of each cell lysates. The anti-HOPX mouse IgG1K monoclonal antibody (3D6, dilution of 1:1000, Sigma), anti-HOPX rabbit IgG polyclonal antibody (FL-73, dilution of 1:200, Santa Cruz Biothecnology, Santa Cruz, CA, USA), anti-V5 mouse IgG2a monoclonal antibody (dilution of 1:5000, Invitrogen), and anti-β-actin mouse IgG2a monoclonal antibody (dilution of 1:10000, Sigma) were used for Western blotting (WB) or IP/WB.
5-Aza-dC and TSA treatment
Cells (1×106 cells/T-75 flask) were treated with 1 or 5 μM of the demethylating agent 5-aza-2′-deoxycytidine (5-Aza-dC) (Sigma-Aldrich) dissolved in 50% acetic acid or mock-treatment with PBS including the same amount of acetic acid every 24 hrs for 4 days. When combined with the histone deacetylase inhibitor trichostatin A (TSA) (Sigma-Aldrich), 300 nM TSA was added to the medium for the final 24 hrs.
Immunohistochemistry
Formalin fixed, paraffin-embedded histological sections (3 μm thick) were immunostained using the HOPX antibody (3D6, dilution of 1:200). And immune complexes were detected using the 3,3′-diamino-benzidine tetrahydrochloride (DAB) substrate, as a chromogen for 30 seconds or 2 minutes.
Plasmid and transfection
A full length cDNA of HOPX was previously isolated and subcloned into pcDNA
TM3.1D/V5-His-TOPO vector (pcDNA
TM3.1-HOPX) [
8]. The vector with self-ligation was used as a mock control. Plasmid vectors were transfected into 2 pancreatic cancer cell lines (MIA Paca2 and PANC-1) using Lipofectamine 2000 reagent (Invitrogen). Stable clones with HOPX or mock were established by G418 (GIBCO) selection (MIA Paca2, 800 μg/ml; PANC-1, 1200 μg/ml).
Proliferation assay
Cell proliferation and viability (2×103 cells/well) were measured using the Premix WST-1 Cell Proliferation Assay System (Takara Bio, CO., Tokyo, Japan) in 96-well plates. Experiments were performed in triplicate.
Invasion assay
Cells were seeded at density of 1× 106 cells/well in the 24-well BD BioCoat Matrigel Invasion Chamber (BD Biosciences Discovery Labware, Bedford, MA) filled with 500 μl DMEM (GIBCO). As a chemoattractant, 10% FBS in 750 μl DMEM (GIBCO) was used for the assay. After incubation for 22 hrs, the membrane of the upper chamber was fixed and stained by Diff-Quick reagent (Sysmex, Kobe, Japan). Invaded cells were counted in for randomly selected sites per membrane.
Anchorage-independent colony formation assay
Anchorage-independent cell growth was analyzed by plating 0.36% top agarose (BactoTM Ager, Becton Dickison and Company, Franklin Lakes, NL) containing 1×105 cells on a surface of 0.72% bottom agarose in 6-well plates. Two independent experiments were performed and each experiment was done in triplicate.
Cell cycle assay
Cells (1× 106 cells/ml) were fixed in 75% ethanol, 5×105 cells stained with propidium iodide (Guava cell cycle reagent, Guava Technologies, Hayward, CA) and the cell cycle assay was carried out using the Guava PCA System. The experiment was performed in triplicate and analyzed using CytoSoft 2.1.5 software (Guava Technologies).
Statistical analysis
Fisher’s exact test, the chi-square test, Mann-Whitney’s U test or Kruskal-Wallis rank test used for categorical variables, and Student’s t-test was used for continuous variables. Clinicopathological characteristics and follow up data were analyzed in association with 5 year disease specific survival (DSS). The follow up time was calculated from the date of surgery to death. DSS was calculated by Kaplan-Meier method, and survival differences were assessed in the log-rank test. Variables suggested to be prognostic factors on univariable analysis (P < 0.05) were subjected to multivariable analysis using a Cox proportional-hazards regression model. Data is expressed as mean ± standard deviation (SD), and P-value <0.05 was considered to indicate statistical significance. All statistical analyses were conducted with SAS software package (SAS Institute, Cary, NC).
Discussion
We have recently identified HOPX as genes specifically methylated in human cancers [
7,
8] after developing algorithm utilizing pharmacological unmasking microarray (PUM) [
5,
6]. Among the identified candidates of TSGs, HOPX is of particular interest in terms of methylation and functional involvement in tumor aggressiveness. Other groups also recapitulated the similar finding that HOPX promoter DNA is hypermethylated specifically in endometrial cancer [
15]. In this present study, we for the first time added pancreatic cancer to the list of organs in which HOPX is involved in carcinogenesis.
HOPX harbors 2 discrete promoter regions, promoter A and promoter B. Promoter B has CpG islands, while promoter A does not have them, and cancer-specific hypermethylation is recognized in the promoter B in primary PC tissues as well as other GI cancers [
7,
8]. Such independent regulation of the discrete promoter regions was reported in other critical methylation genes such as RASSF1 [
19], and possession of the complex promoter regions may indicate their functional importance in biological relevance. On the other hand, epigenetic reactivation of HOPX gene expression was much less than expected in PC cell lines as compared to other GI cancer cell lines. Allowing for actual expression in primary cancer tissues, constitutive HOPX expression signal was derived from carcinoma-stroma interaction in primary PC cells.
Pancreatic cancer is a ductal carcinoma, however it is controversial which normal components (ductal cells, acinar cells, or islet cells) of the pancreatic tissues are precursor cells for PC [
20,
21]. Pour et al. proved that transplantation of islets into the submandibular gland of Syrian golden hamsters followed by treating with nitrosamine N-nitrosobis-(2-oxopropyl)amin (BOP), a carcinogen for PC led to the development of ductal pancreatic adenocarcinoma in this site, while PC did not occurred after transplanting ductal and acinar cells into this gland [
22]. Schmied et al. has also insisted that islet cells contribute to pancreatic carcinogenesis in an animal model and disease exploration [
23,
24]. In mice with hamster islets implanted in the splenic lobe of the mouse pancreases, pancreatic ductal adenocarcinomas developed in the implanted animals, but not in control mice, after BOP treatment [
25]. These findings strongly supported the hypothesis that PC is generated from islet cell origin. In this current study, we for the first time revealed that islet cells expressed abundant HOPX protein in primary PC tissues as well as the normal pancreas. It is intriguing hypothesis that cancer cell with low expression of HOPX is derived from islet cells which constitutively express abundant HOPX, and that promoter DNA hypermethylation is causative for gene silencing.
Clinical findings also supported hypothesis that the islet cell is alternatively involved in PC carcinogenesis [
23], in which remarkable alteration of quality of islet cells was observed in primary PC tissues. Ten out of the 14 cancer specimens showed a significant loss of beta cells (P < 0.005) and eight of them also showed a significant increase of alpha cells (P < 0.005), all of them from hyperglycemic patients. Most affected islets were found within zone 1 (intratumoral) and zone 2 (peritumoral), to a lesser extent in zone 3 (acini close to tumor) and none in zone 4 (acini remote from tumor). The incidence of 72% with alteration of islets in their material correlates with the frequency of abnormal glucose levels in human pancreatic cancer patients. In our study, HOPX is remarkably increased in primary PC tissues, and it was predominantly expressed in the islet cells. These findings suggested that alteration of HOPX expression in the islet cells may explain the link of PC to diabetes mellitus, and this mechanistic possibility should be paid attention in the next future, as oncogenic role of islet cells remains elusive during PC carcinogenesis.
HOPX actually suppressed tumor aggressiveness of PC cells (PANC-1 and MIA Paca2). WST assay showed that HOPX suppressed cell viability putatively representing cell proliferation ability. In cell cycle analysis, HOPX increased subG1 and G0/G1 phases, representing apoptotic induction and inhibition of DNA synthesis, suggesting that cell cycle abnormalities may be linked to cell viability. More importantly, HOPX could inhibit tumor-forming ability in soft agar, which is supposed to represent metastatic trait of tumor cells [
26]. Interestingly, HOPX has been demonstrated to suppress tumorigenesis in soft agar in ESCC and gastric cancer as well as pancreatic cancer, hence anchorage independent growth suppression is the common feature of HOPX expression in human cancers. Finally, HOPX also affects Matrigel invasion less than other phenotypes in PC. These findings may directly show gene silencing of HOPX involved in PC aggressiveness.
Such tumor suppressive effects as shown in Figure
5 might include artifact effect, because expression level of HOPX protein in transfectants may not correspond to the physiological level of the originated normal cell, if precursor cells of the PC were ductal or acinar cells. On the other hand, HOPX expression level of the islet cells reached similar level of the transfectants in our current study. More importantly, the level of expression in the transfectants of the current study was comparable with those of normal mucosa of other tissues such as gastric [
8] and colorectal mucosa [
27]. As compared to such common solid tumors, PC exhibited uniquely dismal prognosis, which is consistent with low expression of HOPX in PC. As constitutive expression of HOPX in human cancer cell lines including PC cell lines was infrequently found, RNA knockdown experiments was impossible to verify the endogenous role of HOPX in human pancreatic cancer cells, however we previously investigated RNA knockdown effects of HOPX by using esophageal cancer cells, TE15 that is a rare control cell which constitutively expressed HOPX [
7,
8], and tumor suppressive role was confirmed. DNA hypermethylation of HOPX with gene silencing is therefore likely to affect PC phenotypes as in other cancers. On the other hand, there were some limitations of the conclusions that can be made based on our functional assay. In MIA Paca2 cells, HOPX was unlikely to be inactivated by methylation, and transfected HOPX protein of PANC-1 cells was expressed relatively weakly. Hence, our conclusion on tumor suppressive role of HOPX on PC was based largely on epigenetic characteristics in primary PC, and results of PC cell lines remained supplementary. We would like to know more specific and definitive conclusions as to these concerns in the near future.
HOPX affects gene transcription through recruitment of HAT and/or HDAC activity for specific transcriptional factors [
28‐
30]. Yeast two hybrid identified enhance of polycomb-1 (Epc-1), a critical component of NuA4 HAT complex, as a binding partner of HOPX, and augments transcription of heart differentiation genes. Interestingly, Epc1 was demonstrated to be associated with EZH2 which is required for cellular proliferation, E2F6-PcG complex (E2F6-EPC1) that interacts with EZH2 and may regulate genes required for cell cycle progression [
31,
32]. Thus, HOPX may therefore affect critical process of chromatin conformation change to affect expression of onco-molecules.
Collectively, we found that HOPX methylation is a very frequent and cancer specific event in PC development. We further elucidated that HOPX is a putative tumor suppressor gene critical for tumor aggressiveness in PC. We are also interested in alternate aspects of HOPX in terms of a role in islet cells. We must confirm more detailed mechanism involved in remarkable phenotype alteration by HOPX abnormalities in PC in future study.
Competing interests
There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Authors’ contributions
MW conceived of the study, performed the study, drafted the manuscript and participated in coordination. KY participated in coordination and assisted in editing of manuscript. HK, AO, HK, HN, KN, and AE helped in the collection and analysis of clinical data. MW participated in coordination. All authors read and approved the final manuscript.