Background
The
Flavivirus genus, which includes mosquito-borne dengue virus, Japanese encephalitis (JE) virus, and West Nile virus (WNV) [
1‐
3], is associated with significant morbidity and mortality due to fatal hemorrhagic fever and encephalitis. Of the flaviviruses, Japanese encephalitis virus (JEV) continues to be the leading cause of viral encephalitis in Asia and the Western Pacific. It poses an increasing threat to global health and welfare, with approximately 67,900 reported cases annually [
4]. Due to rapid changes in climate and demography, JEV is currently spreading to previously unaffected regions such as Indonesia, Pakistan, and northern Australia [
5]. The incubation period of JEV ranges from 5 to 15 days and is fatal in 25 to 30 % cases, mostly in infants, and a high proportion of patients who survive have serious neurological and psychiatric sequelae [
4], for which JE is considered to be more fatal than WNV encephalitis, resulting in 3–5 % mortality (1100 death/29,000 symptomatic infections) [
6]. Pathologically, JE is a severe neuroinflammation in the central nervous system (CNS) closely associated with the disruption of the blood–brain barrier (BBB) [
7]. Although little is known about the pathogenesis of JEV, considerable progress has been made in murine models [
8,
9]. While JEV infects and kills neurons directly in the CNS, CNS invasion of JEV causes the stimulation of microglia/glia and infiltrated leukocytes, leading to indirect neuronal killing via over-secreting pro-inflammatory cytokines (such as IL-6 and TNF-α) and soluble mediators that can induce neuronal death [
10,
11]. This notion implies that JE is an immunopathological disease caused by uncontrolled over-activation of innate and adaptive immune cells, resulting in neurological disorders in the CNS. Therefore, adequate CNS infiltration and activation of peripheral immune cells is considered to play a critical role in protecting hosts from viral encephalitis such as JE. Indeed, CNS infiltration and activation of peripheral leukocytes during JE can cause profound damage if the reaction is excessive or inappropriate [
12]. Therefore, balanced CNS infiltration and activation of peripheral leukocytes should be achieved to have a favorable prognosis of JE without tissue injury.
Chemokine-mediated influx of peripheral leukocytes into the CNS is believed to clear infection, but also be responsible for deleterious bystander neuronal damage associated with morbidity and, in some cases, increased mortality. For example, CXCR3-deficient mice are found to have enhanced CNS viral titers and mortality following WNV infection [
13], while these mice are protected from lethal infection of lymphocytic choriomeningitis virus (LCMV) or cerebral malaria [
14,
15], suggesting that the final outcome of encephalitis will depend on the nature of the pathogen and a range of host factors. Likewise, CCR5 plays a critical role in recovery from flavivirus encephalitis via appropriate CNS migration of peripheral leukocytes, including NK cells and CD4
+/CD8
+ T cells [
16‐
18]. Indeed, the important role of CCR5 in human host responses to WNV encephalitis was demonstrated by a retrospective cohort study involving persons homozygous for CCR5Δ32 [
19], a loss-of-function mutation found in 1–2 % of Caucasians [
20]. Compared to individuals without the mutation, persons carrying a homozygous CCR5Δ32 allele have an increased risk of symptomatic WNV infection. In view of the large number of human infections caused by flaviviruses and their global distribution, there are concerns about the potential adverse outcomes of CCR5 antagonist use for incurable infectious diseases, including human immunodeficiency virus (HIV).
Furthermore, CD4
+Foxp3
+ regulatory T cells (Tregs), which regulate excessive immune responses, are preferentially accumulated over effector T cells at sites of disease due to homing signals such as CCR5 [
21‐
24]. CCR5-dependent homing of CD4
+Foxp3
+ Tregs at infectious sites in parasitic pathogen infection models has been shown to promote pathogen persistence by regulating the magnitude of pro-inflammatory responses and the equilibrium between IL-17
+CD4
+ Th17 and CD4
+Foxp3
+ Tregs [
23,
24]. Recently, a putative role for CD4
+Foxp3
+ Tregs in the pathogenesis of fatal acute inflammatory diseases caused by flaviviruses has been suggested in the context of their regulatory function [
25,
26]. However, the role of CD4
+Foxp3
+ Tregs in flavivirus encephalitis remains elusive due to a lack of direct evidence. Presumably, CCR5-dependent recruitment of CD4
+Foxp3
+ Tregs may affect the progression of viral encephalitis via their regulatory function. To address the direct regulation of JE by CD4
+Foxp3
+ Tregs in CCR5-dependent homing context, we examined the role of CCR5 in JE progression using CCR5-deficient (Ccr5
−/−) mice in this study. Our results revealed that Ccr5
−/− mice had exacerbated JE, ultimately resulting in high mortality without altering CNS viral burden, NK response, or T cell response compared to Ccr5
+/+ mice. However, the increased susceptibility of Ccr5
−/− mice to JE was closely associated with decreased ratio of infiltrated CD4
+Foxp3
+ Treg to IL-17
+CD4
+ Th17 in the CNS. This was directly confirmed by the fact that injection of sorted CCR5
+CD4
+Foxp3
+ Tregs into Ccr5
−/− mice provided ameliorated JE without affecting CNS infiltration of IL-17
+CD4
+ Th17 cells or inflammatory Ly-6C
hi monocytes. Therefore, our data suggest that CCR5 could dictate JE progression by tightly regulating the balance between infiltrated CD4
+Foxp3
+ Tregs and IL-17
+CD4
+ Th17 cells in the CNS.
Methods
Animals
C57BL/6 (H-2b) mice (4- to 6-week-old female or male) were purchased from Samtako (O-San, Korea). CCR5 deficient (Ccr5−/−) mice and Foxp3GFP knock-in mice (H-2b), which co-express EGFP and regulatory T cell-specific transcription factor Foxp3 under the control of an endogenous promoter, were obtained from Jackson Laboratories (Bar Harbor, ME). Ccr5−/−·Foxp3GFP mice were generated by crossing Ccr5−/− mice with Foxp3GFP knock-in mice. All mice were genotyped and bred in the animal facilities of Chonbuk National University.
Cells, viruses, antibodies, and reagents
JEV Beijing-1 strain was obtained from the Green Cross Research Institute (Suwon, Korea) and propagated in a mosquito cell line (C6/36) using DMEM supplemented with 2 % fetal bovine serum (FBS), penicillin (100 U/ml), and streptomycin (100 U/ml) [
27]. C6/36 cells were infected with JEV Beijing-1 at a multiplicity of infection (MOI) of 0.1 and incubated in a humidified CO
2 incubator at 28 °C for 1 h. After absorption, the inoculum was removed and 7 ml of maintenance medium containing 2 % FBS was added. At approximately 6–7 days post-infection (dpi), cultures of host cells showing 80–90 % cytopathic effect (CPE) were harvested. Virus stocks were titrated by conventional plaque assay or focus-forming assay and stored in aliquots at −80 °C until use. Monoclonal antibodies used for flow cytometric analysis and other experiments were obtained from eBioscience (San Diego, CA) or BD Biosciences (San Diego, CA), including fluorescein isothiocynate (FITC)-conjugated anti-CD3ε (154-2C11), Ly6G (1A8), CD8 (53-67), phycoerythrin (PE)-conjugated anti-mouse CD11b (M1/70), Foxp3 (FJK-16s), IFN-γ (XMG1.2), F4/80(BM8), granzyme B (NGZB), peridinin chorophyll protein complex (PerCP)-conjugated anti-mouse Ly6C (HK 1.4), PE-cyanine dye (Cy7)-anti-mouse NK1.1 (PL136), allophycocyanin (APC)-conjugated anti-mouse CD45(30-F11), IL-17 (eBio17B7), TNF-α (MP6-XT22), biotin-conjugated anti-mouse IL-10 (JES5-16E3), and CD49b (DX5). Peptides of the defined I-A
b-restricted epitopes JEV NS1
132–145 (TFVVDGPETKECPD), NS3
563–574 (WCFDGPRTNAIL), and H-2D
b-restricted epitope JEV NS4B
215–223 (SAVWNSTTA) were chemically synthesized at Peptron Inc. (Daejeon, Korea). JEV-specific primers for viral RNA detection and primers specific for cytokines, chemokines, and transcription factors (Table
1) were synthesized at Bioneer Corp. (Daejeon, Korea) and used for PCR amplification of target genes.
Table 1
Specific primers for the expression of cytokines, chemokines, transcription factor, and JEV RNA used in real-time qRT-PCR
IL-1β | FP: AAGTGATATTCTCCATGAGCTTTGT | 535–559 | NM_008361 |
RP: TTCTTCTTTGGGTATTGCTTGG | 679–700 |
IL-6 | FP: TGG GAA ATC GTG GAA ATG AG | 209–228 | NM_031168 |
RP: CTC TGA AGG ACT CTG GCT TTG | 442–462 |
IL-10 | FP: CAA CAT ACT GCT AAC CGA CTC CT | 253–275 | NM_010548 |
RP: TGA GGG TCT TCA GCT TCT CAC | 405–425 |
IL-17 | FP: TCT GAT GCT GTT GCT GCT G | 87–105 | NM_010552.3 |
RP: ACG GTT AGA GGT AGT CTG AGG | 254–267 |
IFN-γ | FP: CAG CAA CAA CAT AAG CGT CA | 119–220 | NM_008337.3 |
RP: CCT CAA ACT TGG CAA TAC TCA |
CCL2 | FP: AAA AAC CTG GAT CGG AAC CAA | 347–367 | NM_011333 |
RP: CGG GTC AAC TTC ACA TTC AAA G | 426–447 |
CCL3 | FP: CCA AGT CTT CTC AGC GCC AT | 158–177 | NM_011337.2 |
RP: GAA TCT TCC GGC TGT AGG AGA AG | 206–228 |
CCL4 | FP: TTC TGT GCT CCA GGG TTC TC | 128–147 | NM_013652.2 |
RP: GAG GAG GCC TCT CCT GAA GT | 388–407 |
CCL5 | FP: CCC TCA CCA TCA TCC TCA CT | 77–96 | NM_013653.3 |
RP: CTT CTT CTC TGG GTT GGC AC | 275–294 |
CXCL1 | FP: CGC TGC TGC TGC TGG CCA CC | 101–120 | NM_008176.3 |
RP: GGC TAT GAC TTG GGT TTG GG | 245–264 |
CXCL2 | FP: ATC CAG AGC TTG AGT GTG ACG C | 194–215 | NM_009140.2 |
RP: AAG GCA AAC TTT TTG ACC GC | 264–283 |
FOXP3 | FP: GGC CCT TCT CCA GGA CAG A | 551–570 | NM_054039.2 |
RP: GCT GAT CAT GGC TGG GTT GT | 642–662 |
GATA3 | FP: AGT CCT CAT CTC TTC ACC TTC C | 1027–1048 | NM_008091.3 |
RP: GGC ACT CTT TCT CAT CTT GCC TG | 1116–1138 |
RORγt | FP: CCG CTG AGA GGG CTT CAC | 75–93 | AJ1232394 |
RP: TGC AGG AGT AGG CCA CAT TAC | 283–304 |
T-bet | FP: GCC AGG GAA CCG CTT ATA TG | 823–843 | AF241242 |
RP: GAC GAT CAT CTG GGT CAC ATT GT | 935–958 |
JEV | FP: GGC TTA GCG CTC ACA TCC A | 4132–4150 | AB920399.1 |
RP: GCT GGC CAC CCT CTC TTC TT | 4207–4226 |
β-actin | FP: TGG AAT CCT GTG GCA TCC ATG AAA C | 885–909 | NM_007393.3 |
RP: TAA AAC GCA GCT CAG TAA CAG TCC G | 1209–1233 |
Quantitative real-time RT-PCR for determination of viral burden and cytokine expression
Viral burden and the expression of cytokines (IL-1β, IL-6, IL-10, IL-17, IFN-γ) and chemokines (CCL2, CCL3, CCL4, CCL5, CXCL1, CXCL2) in inflammatory and lymphoid tissues were determined using quantitative SYBR Green-based real-time RT-PCR (real-time qRT-PCR). Mice were intraperitoneally (i.p.) infected with JEV (3.0 × 107 pfu). Tissues including brain and spleen were harvested at 3, 4, 5, and 7 dpi following extensive cardiac perfusion with Hank’s balanced salt solution (HBSS). Total RNAs were extracted from tissues using easyBLUE (iNtRON, Inc., Daejeon, Korea). Reverse transcription of total RNAs was performed using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Foster, CA). These complementary DNAs (cDNAs) were used for real-time qPCR using a CFX96 Real-Time PCR Detection system (Bio-Rad Laboratories, Hercules, CA). The reaction mixture contained 2 μl of template cDNA, 10 μl of 2× SYBR Primix Ex Taq, and 200-nM primers at a final volume of 20 μl. The reactions were denatured at 95 °C for 30 s and then subjected to 45 cycles of 95 °C for 5 s and 60 °C for 20 s. After the reaction cycle was completed, the temperature was increased from 65 to 95 °C at a rate of 0.2 °C/15 s, and the fluorescence was measured every 5 s to construct a melting curve. A control sample containing no template DNA was run with each assay, and all determinations were performed at least in duplicates to ensure reproducibility. The authenticity of amplified product was determined by melting curve analysis. Viral RNA burden in infected samples was expressed as viral RNA copies per microgram of RNA. The expression levels of cytokines and chemokines were normalized to β-actin. All data were analyzed using Bio-Rad CFX Manager version 2.1 analysis software (Bio-Rad Laboratories).
Infiltrated leukocyte analysis in the CNS
Mice infected with JEV were perfused with 30 ml of HBSS at 3, 5, and 7 dpi via cardiac puncture of the left ventricle. The brains were harvested and homogenized by gently pressing them through 100-mesh tissue sieves, after which they were digested with 25 μg/ml of collagenase type IV (Worthington Biochem, Freehold, NJ), 0.1 μg/ml trypsin inhibitor Nα-p-tosyl-l-lysine chloromethyl ketone, 10 μg/ml DNase I (Amresco, Solon, OH), and 10 mM HEPE in HBSS at 37 °C for 1 h with shaking. Cells were separated using Optiprep density gradient (18/10/5 %) centrifugation at 800×g for 30 min (Axis-Shield, Oslo, Norway), after which cells collected from the 18 to 10 % interface were washed twice with PBS. Cells were then counted and stained for CD11b, Ly6G, Ly6C, CD45, F4/80, CD3, CD4, CD8, and NK1.1 using directly conjugated antibodies (eBioscience) at 4 °C for 30 min. Finally, these cells were fixed with 10 % formaldehyde. Data collection and analysis were performed with a FACS Calibur flow cytometer (Becton Dickson Medical Systems, Sharon, MA) and the FlowJo (Tree Star, San Carlos, CA) software, respectively.
Analysis and activation of NK cells
The activity of NK cells was assessed by their capacity to produce IFN-γ following brief stimulation with PMA and ionomycin (Sigma-Aldrich). Briefly, splenocytes were prepared from Ccr5+/+ and Ccr5−/− mice at 2 dpi and stimulated with PMA and ionomycin (PMA at 50 ng/ml, ionomycin at 750 ng/ml) in the presence of monensin (2 μM) to induce the expression of IFN-γ for 1 h. After stimulation, cells were surface-stained with FITC-anti-mouse-CD3ε, PE-Cy7 anti-mouse NK1.1, biotin-conjugated anti-mouse pan-NK cells (CD49b) [DX5] antibodies, and streptavidin-APC at 4 °C for 30 min. Cells were then washed twice with FACs buffer containing monensin. After fixation, cells were permeabilized with 1× permeabilization buffer (eBioscience) and stained intracellularly with PE anti-mouse IFN-γ (XMF1.2) antibody in permeabilization buffer at room temperature for 30 min. After cells were washed with PBS twice, analysis was performed using a FACS Calibur flow cytometer and FlowJo software.
JEV-specific CD4+ and CD8+ T cell responses
To monitor CD4
+ and CD8
+ T cell responses specific for JEV, surviving mice were sacrificed at 7 dpi and splenocytes were prepared. Erythrocytes were depleted by treating single-cell suspensions with ammonium chloride-containing Tris buffer (NH
4Cl-Tris) at 37 °C for 5 min. These splenocytes were then cultured in 96-well culture plates (5 × 10
5 cells/well) with synthetic peptide epitopes (NS1
132–145, NS3
563–575, or NS4B
215–225) in the presence of anti-CD154-PE for 12 h or for 6 h to evaluate CD4
+ orCD8
+ T cell responses, respectively [
28,
29]. Monensin (2 μM) was added to the antigen-stimulated cells 6 h before harvest. Cells were washed with PBS twice and surface-stained with FITC-anti-CD4 or CD8 antibodies at 4 °C for 30 min, followed by washing twice with PBS containing monensin. After fixation, cells were washed twice with permeabilization buffer and stained with PE-anti-IFN-γ and APC-anti-TNF-α antibodies in permeabilization buffer at room temperature for 30 min. Finally, cells were washed twice with PBS and fixed using fixation buffer. Samples were analyzed using a FACS Calibur flow cytometer and FlowJo software.
Intracellular staining for analysis of CD4+ Th1, Th17, and Treg cells
To monitor CD4+ Th subsets, mice were infected i.p. with 3.0 × 107 pfu of JEV and sacrificed at 3 and 5 dpi. Brain leukocytes and splenocytes were prepared and cultured in 96-well plates (106 cells/well) with PMA/ionomycin (Th1 and Th17) in the presence of monensin (2 μM) at 37 °C for 5 h. Stimulated cells were washed twice with PBS and surface-stained with FITC-anti-CD4 at 4 °C for 30 min. After washing twice with PBS containing monensin and fixation, cells were washed twice with permeabilization buffer (eBioscience, SanDiego, CA) and then stained with PerCP-anti-IFN-γ and APC-anti-IL-17α in permeabilization buffer at room temperature for 30 min. After washing twice with PBS, cells were fixed with fixation buffer. To monitor Treg cells, brain leukocytes and splenocytes were surface-stained with FITC-anti-CD4 markers on ice for 30 min, followed by fixation with permeabilization concentrate buffer (eBioscience, sSan Diego, CA) at 4 °C for 6 h. After fixation, cells were washed twice with permeabilization and stained with PE-anti-Foxp3 in permeabilization buffer at room temperature for 30 min. Sample analysis was performed with a FACS Calibur flow cytometer.
Purification and trafficking analysis of CCR5+CD4+ Foxp3+ Treg cells
CCR5+CD4+Fopx3+ Treg cells were isolated from the spleen of Foxp3GFP knock-in mice using a FACS Aria sorter (Becton Dickson, Palo Alto, CA) with a final cell purity of ≥95 %. CCR5+CD4+Fopx3+ Treg cells were resuspended at density of 107 cells/ml in RPMI 1640 complete medium containing 10 % FBS, 1 % l-glutamine, 1 % nonessential amino acids, and 1 % penicillin/streptomycin. CCR5+CD4+Foxp3+Treg cells (2 × 106 cells/mouse) were injected intravenously into JEV-infected Ccr5−/− mice at 3 dpi. After injecting donor cells, brain and spleen tissues were harvested at 5 dpi. Infiltrated cells were analyzed for the presence of GFP-labeled cells using a FACS Calibur flow cytometer. CCR5−CD4+Fopx3+ Treg cells were purified from Ccr5−/−·Foxp3GFP mice and adoptively transferred into Ccr5−/− mice for the control group to CCR5+CD4+Foxp3+ Treg-recipients. In some experiments, IL-10-producing CCR5+CD4+Foxp3GFP Tregs were detected by intracellular IL-10 staining combined with surface staining with CCR5 and CD4.
Statistical analysis
All data are expressed as averages ± standard deviation. Statistically significant differences between groups were analyzed using an unpaired two-tailed Student’s t test for leukocyte population analysis and in vitro experiments or ANOVA and post hoc testing for multiple comparisons of the means. The significance of differences in viral burden and in vivo cytokine gene expression was evaluated by Mann-Whitney test or unpaired two-tailed Student’s t test. Kaplan-Meier survival curves were analyzed using the log-rank test. A p value ≤0.05 was considered to indicate statistical significance. All data were analyzed using the Prism software (GraphPad Prism 4, San Diego, CA).
Discussion
In this study, we evaluated the role of CCR5 in JE progression. The exacerbation of JE in Ccr5−/− mice was typically associated with a skewed response to IL-17+CD4+ Th17 cells and correspondingly reduced numbers of CD4+Foxp3+ Tregs in the spleen and brain. We provided evidence that injection of sorted CCR5+CD4+Foxp3+ Tregs into Ccr5−/− mice ameliorated JE progression without affecting CNS infiltration of IL-17+CD4+ Th17 cells, myeloid-derived Ly-6Chi monocytes, and Ly-6Ghi granulocytes. Instead, adoptive transfer of CCR5+CD4+Foxp3+ Tregs into Ccr5−/− mice increased the expression levels of two anti-inflammatory cytokines, IL-10 and TGF-β, in the spleen and brain. Our results suggest that CCR5 regulates the progression of viral encephalitis via governing a timely and an appropriate CNS infiltration of CD4+Foxp3+ Tregs and ultimately promoting survival of hosts suffering severe neuroinflammation.
CD4
+Foxp3
+ Tregs are believed to maintain host immune homeostasis by actively suppressing pathological and physiological immune responses after homing to inflamed tissues in response to the presence of foreign antigens [
21‐
24]. A putative and somewhat contradictory role of CD4
+Foxp3
+ Tregs has been demonstrated in various models of pathogenic infections [
23‐
26]. A putative correlation between CD4
+Foxp3
+ Treg levels and the outcome of infectious disease has been reported in WNV encephalitis because patients with symptomatic infection have lower CD4
+Foxp3
+ Treg frequencies throughout the infection compared to asymptomatic patients [
25]. In addition, a correlation of CD4
+Foxp3
+ Tregs with the outcome of flavivirus infection has been reported; Treg expansion but not absolute level was lower in children with severe dengue disease [
26]. However, the factors involved in amelioration by CD4
+Foxp3
+ Treg of severe flavivirus-induced disease are unclear. Our results suggest a role for CCR5 in regulating JE progression by mediating CD4
+Foxp3
+ Treg homing, subsequently inducing skewed IL-17
+CD4
+ Th17 responses in lymphoid and inflammatory tissues. Furthermore, considering that asymptomatic and symptomatic populations have similar CD4
+Foxp3
+ Treg frequencies prior to WNV infection, while asymptomatic patients exhibit greater Treg expansion within the first 2 weeks of infection [
25], the proliferation and/or differentiation of CD4
+Foxp3
+ Tregs in asymptomatic persons seems to be promoted by unknown factors (molecular or cellular components) derived from WNV infection. The expanded Tregs then migrate into inflammatory tissues by means of homing receptors such as CCR5, thereby promoting host survival. In line with this notion, the expansion of CD4
+Foxp3
+ Tregs in JEV-infected Ccr5
+/+ mice was around two-fold higher at 5 dpi, and the TLR4 signaling pathway is likely to be involved in their expansion in a JE model [
27]. Also, the impact of CCR5 in CD4
+Foxp3
+ Treg proliferation and its regulatory role in Treg homing have been clearly demonstrated in a parasitic model [
39]. CCR5-dependent recruitment of CD4
+Foxp3
+ Tregs may dictate the magnitude of the CD4
+ Th1 and/or Th17 subset responses to favor a detrimental or beneficial effect on pathogen persistence at the site of infection [
23,
24,
40,
41]. Our results favor a beneficial role for CD4
+Foxp3
+ Tregs in ameliorating severe neuroinflammation caused by JEV infection, depending on CCR5-mediated homing to inflammatory tissue. Therefore, CCR5 is involved in the putative role of CD4
+Foxp3
+ Tregs in severe flavivirus-induced diseases, such as encephalitis and hemorrhagic fever.
The role of CCR5 in infectious diseases is variable in terms of its impact on pathogenesis and disease outcome. An essential role of CCR5 in ameliorating the outcome of infectious diseases has been documented in trypanosomiasis [
42], toxoplasmosis [
43], genital herpes [
44], influenza [
45], flaviviral West Nile encephalitis, and JE [
16‐
18], while a beneficial effect of CCR5 deficiency on the outcome of other infectious diseases has been postulated [
23,
24,
39,
46,
47]. Mechanistically, these variable outcomes of CCR5 deficiency in infectious diseases have been largely attributed to its regulatory effect on trafficking of leukocytes, including NK, CD4, CD8, and CD4
+Foxp3
+ Treg cells to the site of infection as a consequence of the elevated immunopathology. Therefore, this dichotomy in the role of CCR5 in regulating the outcome of infectious diseases prevents the generalization of our findings of the impact of chemokine receptors in disease prognosis. Nevertheless, CCR5 is believed to play a crucial role in protection against severe neuroinflammation caused by flavivirus infections [
16‐
18]. In this study, we also confirmed an essential role for CCR5 in regulating JE progression. However, CCR5 deficiency failed to alter or increase the viral burden in extraneural tissue (spleen) and the CNS. The activation of innate NK cells was increased in Ccr5
−/− mice, rather than in Ccr5
+/+ mice, as corroborated by enumeration of the IFN-γ-producing NK cells. In contrast, Ccr5
+/+ mice showed a transiently higher number of CNS-infiltrated NK cells with a loss of CD3
−NK1.1
+DX5
+ NK cells in the spleen and blood of both Ccr5
+/+ and Ccr5
−/− mice after JEV infection. Although survived Ccr5
+/+ mice displayed moderately increased responses of JEV-specific CD4
+ T cells at 7 dpi, Ccr5
−/− mice showed a much higher frequency and number of JEV-specific CD8
+ T cells in response to stimulation with JEV antigen. These split innate and adaptive immune responses of Ccr5
−/− mice during JE progression are contradictory to a previous report that NK cell responses and CD4
+ as well as CD8
+ T cell responses decreased in Ccr5
−/− mice following JEV infection [
17]. The discrepancy might be due to differences in the genetic background and age of the host, strain and dosage of virus, and the route of challenge. Indeed, because Ccr5
+/+ and Ccr5
−/− mice began to show clinical signs, such as neurological disorders, at 3–5 dpi, which is before functional adaptive immune responses were fully induced, the JE model used in this study appeared to have more acute and rapid progression than that in a previous study, in which clinical signs were observed at 8–10 dpi [
17]. This accelerated and rapid progression of JE in Ccr5
+/+ and Ccr5
−/− mice might have resulted in induction of distinct NK and CD4/CD8 T cell responses in the host. Early regulation of severe neuroinflammation in the CNS through regulatory mechanisms such as CD4
+Foxp3
+ Tregs and myeloid-derived suppressor cells (MDSC) may be important for host survival in cases of acute and rapid progression of JE. This notion is strengthened by the result that Ccr5
+/+ and Ccr5
−/− mice showed similar splenic CD4
+ and CD8
+ immune responses in a WNV infection model, to which mice are highly susceptible compared to humans [
16]. Also, the fact that CD4
+Foxp3
+ Tregs can regulate the progression of WNV encephalitis in an infection model using depletion of CD4
+Foxp3
+ Treg cells suggests an important role for CD4
+Foxp3
+ Tregs in regulating the progression of fatal neuroinflammation caused by flaviviruses [
25]. In this study, the regulatory role of CD4
+Foxp3
+ Tregs in JE progression was clarified by adoptive transfer of CCR5
+CD4
+Foxp3
+ Tregs in Ccr5
−/− mice. This is strongly supported by a recent report that Tregs can ameliorate encephalitis by repressing effector T cell function [
48]. However, the CCR5-mediated regulatory function of CD4
+Foxp3
+ Tregs was likely to be relatively unimportant in JE progression, because adoptive transfer of CCR5
+CD4
+Foxp3
+ Tregs between 2 and 4 dpi ameliorated JE progression, whereas CD4
+Foxp3
+ Tregs that were adoptively transferred prior to JEV infection rendered the recipients vulnerable to JE (unpublished personal data). Therefore, we used adoptive transfer of CCR5
+CD4
+Foxp3
+ Tregs in Ccr5
−/− mice at 3 dpi, the time point at which infected mice began to show clinical signs, such as generalized piloerection, paresis, and rigidity. Although further study is warranted, CCR5 appears to play a non-committed role in JE progression by regulating the trafficking equilibrium of effector leukocytes and regulatory CD4
+Foxp3
+ Tregs, depending on disease progression.
It is likely that our results discount the role of CCR5 in ameliorating JE progression by CNS infiltration of effector leukocytes such as NK cells, macrophages, CD4
+ cells, and CD8
+ T cells. It has long been assumed that leukocyte infiltration into the CNS is critical for clearing virus and aiding recovery. CCR5 deficiency was associated with increased flavivirus burden in the CNS but not in extraneural tissues, which was mechanistically mediated by inappropriate CNS infiltration of leukocytes [
16,
17]. However, the critical role of CCR5 in flavivirus pathogenesis appears to be unique in other neurotropic viruses, because infections of Ccr5
−/− mice with several neurotropic viruses, such as LCMV [
49], retrovirus FR98 [
50], and mouse hepatitis virus (MHV) [
51], resulted in viral burdens in the CNS similar to those of Ccr5
+/+ mice. Unlike earlier works on flavivirus encephalitis [
16,
17], the present study showed that the JEV burden in the extraneural tissue and CNS of Ccr5
+/+ mice was similar to that in Ccr5
−/− mice, with transiently and early increased CNS infiltration of NK and CD4
+ cells, but not CD8
+ T cells, in Ccr5
+/+ mice. Although the mechanisms of increased CNS infiltration of leukocytes in Ccr5
−/− mice with an unchanged viral burden need to be defined, the JE model used appears to affect the dynamics of leukocyte CNS infiltration and the subsequent viral burden. CNS trafficking of Ly-6C
hi monocytes and Ly-6G
hi granulocytes is mediated through a multistep process governed by CC and CXC chemokines. In support, the enhanced expression of CC chemokines including CCL2, CCL3, CCL4, and CCL5 appeared to facilitate CNS infiltration of Ly-6C
hi monocytes in Ccr5
−/− mice at the early phase, although whether these cells function to suppress or promote pathogenesis is unclear [
52,
53]. One interesting result in this study was the reversal of CXC chemokine expression between 3 and 5 dpi. Although CXCL1 and CXCL2 play a dominant role in the trafficking of Ly-6G
hi granulocytes, CC chemokines are also likely to be involved in CNS infiltration of Ly-6G
hi granulocytes [
54]. Furthermore, increased CNS infiltration of Ly-6G
hi granulocytes in Ccr5
−/− mice is strengthened by the result that CCR5 ablation increases the recruitment of Ly-6G
hi granulocytes in herpetic encephalitis [
55]. Also, it is conceivable that CXCL2 is involved in the recruitment of granulocytic MDSCs at a later stage [
56], thereby resulting in the amelioration of JE progression. However, CCR5 appeared not to be involved in the migration of myeloid and lymphoid cells from the blood into the brain, because the accumulation of myeloid (monocytes, granulocytes) and lymphoid (NK, CD4/CD8 T cells) cells in the blood showed similar patterns to those in the brain. These data are in line with a previous report that CCR2 is not involved in monocyte migration from the blood into the brain [
57]. CCR5 ablation may cause accumulation of CCR5 ligands (CCL3, CCL4, CCL5) via their compensation mechanism [
58], which could induce dysregulation of the migration of monocytes, NK cells, and T cells expressing cognate receptors (CCR1, CCR3). Also, the appropriate adaptive CD4
+ and CD8
+ T cell responses can be achieved by orchestrated chemokine expression in secondary lymphoid tissues to promote contact between T and dendritic cells [
59]. Indeed, our results demonstrate unexpected adaptive JEV-specific CD4
+ and CD8
+ T cell responses in Ccr5
−/− mice; stronger responses of JEV-specific CD4
+ T cells were induced in Ccr5
+/+ mice, whereas Ccr5
−/− mice displayed a potent JEV-specific CD8
+ T cell response. Ultimately, these speculations suggest that other chemokine receptors may be involved in the migration of myeloid and lymphoid cells as well as adaptive T cell responses in a CCR5-ablated environment, due to redundancy and compensation of chemokines and their receptors. In addition, the role of NK and CD8
+ T cells in CNS clearance of JEV remains elusive, because the depletion or adoptive transfer of NK and CD8
+ T cells does not contribute significantly to host survival or viral clearance [
36]. Also, although IFN-γ
+CD4
+ Th1 cells are believed to play a role in regulating JE progression by reducing viral burden in the CNS [
38], only co-transfer of immune CD4
+ and CD8
+ T cells, not individual transfer of either T cell subpopulation, significantly ameliorates JE progression and promotes host survival [
37]. These facts support the possibility that transiently and early increased CNS infiltration of NK and IFN-γ
+CD4
+ Th1 cells in Ccr5
+/+ mice may not be sufficient for viral clearance from the CNS, resulting in a similar CNS viral burden in Ccr5
+/+ and Ccr5
−/− mice. Therefore, balanced and orchestrated CNS infiltration by innate NK and adaptive T cell subpopulations likely mediates viral clearance, thereby providing protection against JE progression without tissue injury.
IL-17 is produced mainly by IL-17
+CD4
+ Th17 cells. It plays a critical role in autoimmune and virus-caused immunopathologic diseases by facilitating neutrophil recruitment [
60‐
62]. In contrast, IL-17 appears to play a minor role in protective immunity against parasitic infection [
63] but a more important role in fungal infection in a CCR5-ablated environment [
39]. In the present study, CD4
+Foxp3
+ Tregs did not directly regulate CNS recruitment of IL-17
+CD4
+ Th17 cells or their IL-17 production. In addition, adoptive transfer of CCR5
+CD4
+Foxp3
+ Tregs did not influence CNS infiltration of Ly-6C
hi monocytes and Ly-6G
hi granulocytes. However, the anti-inflammatory cytokines IL-10 and TGF-β produced by adoptively transferred CCR5
+CD4
+Foxp3
+ Tregs might have played a role in regulating JE progression. This notion is supported by the finding that insufficient anti-inflammatory cytokine levels are associated with exacerbated JE [
64]. Furthermore, our data are strongly supported by the finding that IL-10 ablation exacerbates alphavirus encephalomyelitis by enhancing CNS infiltration of IL-17
+CD4
+ Th17 and IFN-γ
+CD4
+ Th1 cells, without affecting the amount of brain inflammation and viral replication [
65]. Indeed, the majority of adoptively transferred CCR5
+CD4
+Foxp3
+ Tregs in Ccr5
−/− mice produced IL-10. Furthermore, generation of CD4
+Foxp3
+ Tregs and IL-17
+CD4
+ Th17 cells is reciprocally regulated [
60‐
62]. This developmental link between CD4
+Foxp3
+ Tregs and IL-17
+CD4
+ Th17 cells has led to speculation that these T cell subsets exist in equilibrium during inflammation and infection [
66,
67]. However, this equilibrium was disturbed, thereby causing exacerbation of JE progression in Ccr5
−/− mice. Therefore, our results provide insight into the utility of IL-10 and CD4
+Foxp3
+ Tregs for regulating JE progression by maintaining the balance between CD4
+Foxp3
+ Tregs and IL-17
+CD4
+ Th17 cells at specific time points.