CDCA5 overexpression is an Indicator of poor prognosis in patients with hepatocellular carcinoma (HCC)

An anti-CDCA5 monoclonal antibody was purchased from Abcam. The lentiviruses pSICOR and pCDH-CMV-MCS-EF1-Puro, HepG2 cell lines, DNA gel recovery kits, and LATaq were purchased from Hualianke. Endotoxin plasmid extraction kits were purchased from OMEG. T4 DNA ligase and the endonucleases Xho I, BamH I, and Xba I were purchased from NEB. DMEM was purchased from HyClone. Fetal bovine serum and penicillin were purchased from Gibco. PBS, 0.25% trypsin, and propidium iodide were purchased from Bioswamp. Lipofectamine 2000 was purchased from Invitrogen. A Lentiviral Packaging Kit was purchased from Shanghai Shengsheng Biotechnology Co., Ltd. RibonucleaseA (RNaseA) was purchased from TaKaRa. The DH5α strain was obtained from existing laboratory stocks.

SMMC-7721, HepG2, and Huh-7 cells were cultured in DMEM containing 10% fetal bovine serum and 1% penicillin at 37 °C in a 5% CO2 incubator. The cells were then digested in 0.25% trypsin and subcultured.

Twelve SPF grade BALB/C-nu/nu nude mice, 4 to 6 weeks old and weighing 18–20 g, were purchased from Beijing Huafu Kang Biotechnology Co., Ltd. They were raised in an SPF animal room.

The specific steps of anti-CDCA5 monoclonal antibody immunohistochemical staining were performed according to the kit instructions. The main staining procedures were as follows: paraffin section dewaxing, hydration, 3% H2O2 incubation to eliminate endogenous peroxidase activity, high pressure antigen retrieval, normal goat serum blocking, primary antibody (CDCA5 monoclonal antibody) incubation overnight at 4 °C, and 3 PBS washes. The secondary antibody (goat anti-rabbit IgG antibody-HRP) was then added. After the incubation, the tissues were rinsed 3 times with PBS. DAB staining, hematoxylin counter staining, alcohol dehydration, transparent xylene incubation, and neutral gum sealing were performed. Prepared samples were observed via microscopy.

Total RNA was extracted from human hepatoma tissue and reverse transcribed into cDNA. This cDNA was used as a template to amplify the CDCA5 gene by using primers specific for CDCA5 (CDCA5-F: GCTCTAGATGTCTGGGAGGCGAACGC, CDCA5-R: CGGGATCCTCATTCAACCAGGAGATCA). This CDCA5 gene and the plasmid pCDH-CMV-MCS-EF1-Puro were double-digested with Xba I and BamH I, and the CDCA5 gene was subsequently ligated in to the plasmid pCDH-CMV-MCS-EF1-Puro using T4 DNA ligase. This construct was then transformed into competent DH5α cells. Positive clones were used to expand the cultures, and the plasmids were extracted using an endoviral plasmid extraction kit. The CDCA5 overexpression plasmid with the correct sequence was named pCDH-CDCA5. Based on the GenBank sequence of CDCA5 (NM_080668.3), 3 shRNA interference sequences were designed using the shRNA design program. In addition, Xho I and BamH I restriction sites were introduced into the 5′ and 3’ends of the shRNAs, and the double-stranded DNA oligo containing the interference sequence was synthesized according to this design. The pSICOR vector and the synthesized interference sequence were double-enzyme linearized by T4 DNA. The construct was then ligated into the PSICOR vectorbyT4DNA ligaseand transformed into competent DH5_αcells. The positive clones were picked and expanded. The plasmid was extracted using an endotoxin plasmid extraction kit, and the correctly sequenced CDCA5 interference plasmid was named pSICOR-shCDCA5. Plasmids were sent to Shanghai Huajin Biotechnology Co., Ltd. for sequencing.

HepG2 cells were seeded into petridishes and infected with each plasmid. The HepG2 normal cells group, CDCA5 low expression group, and CDCA5 overexpression group logarithmic phase cells were collected, and the cell suspension was distributed into a 96-well plate with 180 μL per well (1~ 5 × 10³ cells/well) in triplicate, and 100 μL culture solution was used as the blank control. The cells were incubated at 37 °C for 12 h, 24 h, 48 h, and 72 h. Then, 20 μl MTT solution (5 mg/ml) was added to each well, and then the cells were cultured for 4 h. Then, 150 μl DMSO solution was added to each well after the supernatant was discarded. The plate was shaken at low speed for 10 min to fully dissolve the crystals. The 490 nm absorbance of each well was measured in an enzyme-linked immunosorbent assay.

Cells were trypsinized, washed, diluted 1/10 and seeded into10 cm dishes after transfection. Cells were grown for 2 weeks, after which colonies were stained with Coomassie blue (0.1% Coomassie blue, 30% methanol, 10% acetic acid) and counted.

The CDCA5 low expression group cells, CDCA5 overexpression group cells and negative control HepG2 cells were digested with 0.25% trypsin, transferred to flow cytometry tubes, and centrifuged at 1000 rpm for 5 min. Each precipitate was suspended in 300 μl PBS solution containing 10% fetal bovine serum and then transferred into a clean 1.5 ml centrifuge tube. Then, 700 μl anhydrous ethanol was added, and the cells were fixed in a refrigerator at − 20 °C for at least 24 h. Flow cytometry was performed to quantify the number of cells in each stage of the cell cycle.

Six mice were assigned to each group. HepG2 cells with low expression of CDCA5 and the negative control cells were digested with 0.25% trypsin, and the cell numbers were counted. The cell concentration was adjusted to 1 × 10⁷ cells/ml with serum-free medium. A 0.2 ml cell solution was subcutaneously injected into each mouse using both HepG2 cells with low expression of CDCA5 and negative control cells. We observed the survival of the nude mice and the growth of the tumors. All nude mice were sacrificed by cervical dislocation on the 30th day, and the tumors were removed. The average weights of the tumors in each group were calculated.

Continuous data are shown as the mean ± standard deviation. Comparisons of continuous data were carried out using Student’s t test or the Mann-Whitney U test. Multiple groups of measurement data were compared using one-way ANOVA. Categorical variables were compared using the chi-square test or Fisher’s exact test as appropriate. The Kaplan-Meier method was used to estimate survival probabilities, which were compared using the log-rank test. All statistical tests were two-tailed, and a P value < 0.05 was considered significant. Statistical calculations performed using SPSS software (IBM version 22.0, NY) [10].

We used the median of the semiquantitative CDCA5 expression data from the 178 HCC tissue samples as a cutoff point for high and low expression of CDCA5. There were 89 patients with high expression of CDCA5 and 89 patients with low expression of CDCA5. Compared to normal liver tissue, HCC tissue exhibited significantly increased expression of CDCA5 (P < 0.05). (Figs. 1, 2).

We selected the SMMC-7721, HepG2, and Huh-7 HCC cell lines and detected the expression of CDCA5 protein by Western blotting. HepG2 cells had the highest expression of CDCA5 and were selected for the knockdown experiment. SMMC-7721 cells had the lowest expression of CDCA5 and were selected for the overexpression experiments. Plasmids that knocked down and overexpressed CDCA5 were constructed, and Western blotting was used to detect changes in CDCA5 expression after knockdown and overexpression (Fig. 4). Finally, we chose to use the pSicoR-shCDCA5–3 and pCDH-CDCA5 plasmids in the following experiments.

The proliferation rates were detected by an MTT assay after CDCA5 knockdown in HepG2 cells and CDCA5 overexpression in SMMC-7721 cells. The growth inhibition rates of the HepG2 cells in the knockdown group after transfection with pSicoR-CDCA5–3 were 8.40 ± 2.07%, 14.10 ± 0.53%, 65.97 ± 0.58% and 70.10 ± 1.04% at 12, 24, 48 and 72 h, respectively(P < 0.05). When the transfection time was prolonged, the growth rate of the HepG2 cells in the CDCA5 knockdown group was significantly decreased. The survival rates of the SMMC-7721 cells in the overexpression group were 102.83 ± 1.56%, 116.23 ± 1.01%, 128.93 ± 0.95% and 130.03 ± 0.35% at 12, 24, 48 and 72 h, respectively(P < 0.05). When the transfection time was prolonged, the survival rate of the SMMC-7721 cells in the CDCA5 overexpression group was significantly increased.

The colony formation rate was 16.49 ± 1.75% in the CDCA5 knockdown group compared to 32.17 ± 3.25% in the negative control group. The quantity of clones formed in the CDCA5 low expression group was less than that of the negative control group (P < 0.05)(Fig. 5.1). The proliferation ability of HepG2 cells was attenuated after CDCA5 knockdown. After CDCA5 overexpression, the colony formation rate was 51.93 ± 3.46%, while it was 34.57 ± 4.86% in the negative control group. The quantity of clones formed in the CDCA5 overexpression group was greater than that of the negative control group (P < 0.05). The proliferation ability of SMMC-7721 cells was increased after CDCA5 overexpression (Fig. 5.2).

Flow cytometry was used to analyze the cell cycle phases of the HepG2 cells with low CDCA5 expression, SMMC-7721 cells with CDCA5 overexpression, and negative controls. The accumulation of G2 phase cells was significantly increased in the CDCA5 low expression group compared with the negative controls. There were no significant differences between the CDCA5 overexpression group and the negative control group with regard to cell distribution in the cell cycle phases. The results suggested that the inhibition of HepG2 cell growth was associated with arrest in the G2 phase after CDCA5 knockdown (Fig. 6.1, 6.2, Table 2).

Changes in cell cycle profiles of SMMC-7721 cells after the overexpression of CDCA5.

There were slightly fewer cells in the G2/M phase among the SMMC-7721 cells that overexpressed CDCA5 from pCDH-CDCA5 than among the negative control SMMC-7721 cells. However, these results were statistically insignificant (Fig. 6.3, 6.4, Table 3).

In the control group injected with HepG2 cells, tumors were detectable on the fifth day. In contrast, in the CDCA5 low expression group, tumors were detectable on the sixth day. On the 30th day after injection, the tumor weights in the control group and the CDCA5 low expression group were 0.89 ± 0.07 and 0.66 ± 0.11 g, respectively. Tumors from the HepG2 group were heavier than those from the low CDCA5 expression group, and the difference between the two groups was statistically significant (P < 0.05) (Fig. 7.1, 7.2).

CDCA5 expression was significantly decreased in the tumor tissue from the CDCA5 low expression group compared with that from the HepG2 group (P < 0.05). (Fig. 8).