cGMP interacts with tropomyosin and downregulates actin-tropomyosin-myosin complex interaction

HPASMCs (ScienCell Research Laboratories, Carlsbad, USA), identified by immuefluorescent antibodies to α-smooth muscle actin and desmin, were isolated from human pulmonary arteries [6]. Smooth muscle cell medium (ScienCell Research Laboratories, Carlsbad, USA) supplemented with 2% fetal bovine serum and 1% smooth muscle cell growth supplement was utilized. HPASMCs were then maintained at 37 °C humidified atmosphere of 5% carbondioxide. P3 ~ P5 cells were used for experiments. The exponentially growing HPASMCs were treated with 100 μM of 8-Br-cGMP (Sigma–Aldrich Corp., St. Louis, USA) for 24 h.

10 μM of Biotin-cGMP and the negative control Biotin (Biolog life science institute, Bremen, Germany) were nurtured in a mix of whole HPASMC cell lysates at 4 °C for 6 h with gentle rotation. Biotin-cGMP fusion protein and Biotin protein were then attached to 100 μl of streptavidin magnetic beads at 4 °C for 6 h. After being gently washed by lysis buffer for 3–5 times gently to reduce nonspecific binding, beads were incubated with 50 μl of glycine elution buffer (100 mM, PH 2.5) for 10 min. Then, 10 μl of NH₄HCO₃ neutralization buffer was added to each elution collection tube to neutralize the pH of the contents upon elution. The elution fractions were boiled in sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS–PAGE) loading buffer and analyzed by silver staining method or immune blotting analysis. After having been excised, protein bands were subjected to in-gel trypsin digestion and analysed by mass spectrometry.

Total RNAs were extracted from HPASMCs with Trizol reagent (Invitrogen Life Technologies, Carlsberg, USA), following the manufacturer’s protocol (Invitrogen). The reverse transcription was performed with the total RNAs (2 μg) and the Moloney Murine Leukemia Virus reverse transcription kit (Invitrogen Life Technologies, Carlsberg, USA).

Real-time PCR was performed to quantify TPM1 gene, and expression of the internal control gene ACTIN was determined by iQ5 Multicolor Real-time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The PCR reaction used 9.9 μl of distilled water, 12.5 μl of 2X SYBR® Premix Ex TaqTMII, 0.8 μl each for primers, and 1 μl of DNA template, constructing a total volume of 25 μl. The two-step PCR protocol was performed using SYBR® Premix Ex TaqTM II (Takara Biotech Co., Dalian, China) following the manufacturer’s instruction. It included one cycle of 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s. Each reaction was run in triplicate. The Ct values for relative quantification of gene expression were used to determine the TPM1 expression levels. The PCR primers for TPM1 were as follows: 5’-GCTGCAGAGGATAAGTACTC-3′ (forward), 5’-CATGTTGTTTAACTCCAGT-3′ (reverse); β-ACTIN 5’-GGCGGCACCACCATGTACCCT-3′ (forward), 5’-AGGGGCCGGACTCGTCATACT -3′ (reverse). The PCR primers for TPM1 gene isoforms were as follows: Primer 1: 5′- CGGTCGCCCCCTTGGGAAAG -3′ (forward), 5′- GCTTGTCGGAAAGGACCTTGATCTC -3′ (reverse); Primer 2: 5′- AGTGAGAGAGGCATGAAAGTC -3′ (forward), 5′- AATTTAGTTACTGACCTCTCCGCA -3′ (reverse); Primer 3: 5′- CGGGCTGAGTTTGCGGAGAGG -3′ (forward), 5′- AAGGAATGGAAGTCTCGGAAGA -3′ (reverse).

Cells were collected and rinsed with PBS solution, and the protein was extracted by using the protein lysis buffer (including 1% NP-40, 1 μg/ml aprotinin, 1 μg/ml leupeptin, and 100 μg/ml PMSF). The protein concentration was assessed with a Bio-Rad DC Protein Assay (Bio-Rad, Hercules, USA). Then, 50 μg of proteins were used for sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Subsequently, the proteins were transferred to nitrocellulose membranes by electro blotting (Millipore Corp., Boston, USA). Membranes were blocked in 5% milk, washed with PBST (PBS with 0.1% Tween), and incubated with 1:1000 anti-tropomyosin antibody (cell signaling technology, Danvers, USA) at 4 °C for 12 h and 0.4 μg/ml anti-actin antibody (ZSBIO, Beijing, China) at 4 °C for 1 h. After the washing and incubation with 0.08 μg/ml horseradish peroxidase-conjugated anti-IgG antibody (ZSBIO, Beijing, China) at 4 °C for 1 h in 5% milk, the membranes were washed for three times and subjected to the enhanced chemiluminescent reagents (Millipore Corp., Boston, USA) for the distinction of protein bands.

Cells were grown and treated with 8-Br-cGMP on cover slips. Cultured cells were affixed with methanol at room temperature for 20 min. After being washed with PBS for three times, cover slips were blocked for 60 min in BSA blocking buffer, then incubated with diluted primary antibody at room temperature for 2 h. Cells were rinsed in PBS three times (for 5 min each), then incubated with diluted fluorochrome-conjugated secondary antibody (ZSBIO, Beijing, China) at room temperature for 1 h in dark. After stained with DAPI and stored with mounting medium, the samples were examined under confocal microscope.

Interaction analysis among actin, myosin, and tropomyosin were performed at 298 K (degree kelvin) with a MicroCal Isothermal Titration Calorimeter ITC200 instrument (Malvern, England). The investigations were performed according to a strictly standardized protocol [7‐9]. The highly purified proteins were prepared by Sephadex G-50 column with automated protein separation chromatography system (Jinhua Inc., Shanghai, China). Typically, the syringe was filled with 60 μL of protein solution at a concentration of 0.05 μM that subsequently titrated into a 300 μL protein with the concentration of 0.005 μM in the cell. There were twenty injections of 2 μL each with a spacing of 120 s between injections employed to allow the system to reach the equilibrium. Heat generated by titrant dilution was tested by a control experiment, titrating into buffer alone, in uniform arragements. On the basis of a self-sufficient binding sites model, the MicroCal-Origin 7.0 software was applied to fit the integrated heat data of the titrations by a non-linear least-squares minimization algorithm.

The fitting parameters were ΔH (reaction enthalpy change in cal mol^− 1), ΔS (the changes in entropyin cal mol^− 1), K (the inverse of equilibrium binding constant in M^− 1), and N (molar ratio of the proteins in the complex). Δ H value is equal to the constant pressure heat of reaction. The positive value of Δ H means heat absorption and the negative value represents heat release. Entropy is a measure of system disorder. ΔS associates with the change in the amount of substance before and after reaction in the system.Gibbs free energy (ΔG) had a relationship with ΔH that was ΔG = ΔH-TΔS = -RTlnKa (R = 8.314 J mol^− 1 K^− 1, T = 298.15 K), which was applied to calculate the reaction energy eventually. All the ΔG obtained by calculation testified the spontaneous reactions in our experiments.

All data attained in triplicate independent experiments were assessed via SPSS statistics 20.0 and GraphPad prism 5 (GraphPad software, Inc., La Jolla, USA). Data are showed as mean ± SD. Statistical comparisons were carried out with the student t test for investigating two-group data. A P value of < 0.05 was considered statistically significant

Biotin-cGMP is a cGMP analog that has similar properties with cGMP (Fig. 1a). The bands characteristic to cGMP are presented in Fig. 1b. Compared with the negative control biotin, six bands were uniquely associated with cGMP (line 2). The protein bands associated with cGMP were then extracted, digested with trypsin and analysed by mass spectrometry. The result showed that 5 peptides of the band 1 belonged to the protein tropomyosin, which was involved in the regulatory system of actin-myosin interaction. The other bands corresponded to the protein keratin and some uncharacterized proteins with protein scores less than 66, suggesting the observed match was a random event.

In order to determine which isoform was expressed in the HPASMCs, we performed three PCR using primers designed on the basis of the three difference sequences (Fig. 2). The products of PCR were cloned into pGEM®-T expression vector and sequenced, which was found to be in full compliance with isoform 4. The partial base sequences were shown in Fig. 2. The sequencing results also indicated that isoform 4 was the only isoform expressed in the HPASMCs.

To further confirm the interaction between cGMP and tropomyosin in vivo, antibody dependent pull-down was performed. Isoform 4 of TPM1 gene was amplified and cloned into pcDNA3.1(−)-cMyc vector, then transfected into cultured HPASMCs. The biotinylated cGMP and the biotin alone were both incubated with HPASMC cell lysates. Tropomyosin-Myc was validated with antibody against Myc in the biotin-cGMP pull-down protein complexes, but not in the biotin pull-down protein complexes (Fig. 3a). Meanwhile, the interaction between cGMP and tropomyosin was alterable in the existence of different amounts of biotin-cGMP (Fig. 3b). Furthermore, competition assay was performed to detect the specificity of cGMP and tropomyosin interaction. The interaction between cGMP and tropomyosin was competed by 8-Br-cGMP (non-biotinylated cGMP) in a dose-related manner (Fig. 3c).

To explore the binding sites of tropomyosin interacted with cGMP, tropomyosin fragments (aa 1–284, aa 68–284, aa 142–284, aa 209–284, aa 1–208, aa 1–141, and aa 1–67, respectively named as wild type, N-mutation 1, N-mutation 2, N-mutation 3, C-mutation 1, C-mutation 2, and C-mutation 3) were inserted into pcDNA3.1(−)-cMyc vector and then transfected into cultured HPASMCs. These vectors could express Myc-fused protein in cells. Antibody-dependent pull-down was repeated. As shown in Fig. 4a and b, wild type, N-mutation 1, and C-mutation 1 were detected in the immunocomplexes. In contrast, N-mutation 2, N-mutation 3, C-mutation 2, and C-mutation 3 were absent from the immunocomplexes with antibodies against Myc. Collectively, these results indicated that there was a cGMP binding site at aa 68–208 of the tropomyosin protein.

HPASMCs were induced by 8-Br-cGMP (100 μM), TPM1 expression was not significantly dysregulated after 8-Br-cGMP induction compared to the control cells (Fig. 5a, b, and c). cGMP has no effect on tropomyosin subcellular localization after 8-Br-cGMP induction compared to the control cells (Fig. 5d).

ITC is mainly applied to explore molecular binding reactions and provides the binding constant, the molar ratio of the proteins complex, and the enthalpy change (ΔH) of the interaction [10‐12]. We utilized ITC to detect the binding affinity of actin-tropomyosin-myosin. However, there were numerous non-specific binding activities caused by electrostatic interactions in each assay. To minimize this, the sodium chloride concentration of the buffer in the ITC assays was decreased from 50 mM to 5 mM.

Under the experimental status, the binding affinity of tropomyosin to actin-myosin was significantly up-regulated compared to the control group (Fig. 6a and b). However, the binding affinity was significantly down-regulated after adding 8-Br-cGMP, with K value changed from (4.60 × 10⁵ ± 7.84 × 10⁴) to (3.45 × 10⁵ ± 4.34 × 10⁴) (Fig. 6b and c).

Table 1 shows the binding constants and thermodynamic parameters. There was a stronger affinity of actin, tropomyosin and myosin without treatment of 8-Br-cGMP proved byΔG compared to the experimental group with 8-Br-cGMP, which is consistent with the meaning of another parameter K value. Significant difference was found between the experimental group without 8-Br-cGMP and the group with 8-Br-cGMP (P < 0.05), suggesting a distinct obstruction of the formation of actin-tropomyosin-myosin complex.