Sie können Operatoren mit Ihrer Suchanfrage kombinieren, um diese noch präziser einzugrenzen. Klicken Sie auf den Suchoperator, um eine Erklärung seiner Funktionsweise anzuzeigen.
Findet Dokumente, in denen beide Begriffe in beliebiger Reihenfolge innerhalb von maximal n Worten zueinander stehen. Empfehlung: Wählen Sie zwischen 15 und 30 als maximale Wortanzahl (z.B. NEAR(hybrid, antrieb, 20)).
Findet Dokumente, in denen der Begriff in Wortvarianten vorkommt, wobei diese VOR, HINTER oder VOR und HINTER dem Suchbegriff anschließen können (z.B., leichtbau*, *leichtbau, *leichtbau*).
T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematologic malignancy caused by mutation accumulation during hematopoiesis. The characterization of chromosomal abnormalities may provide significant insights into genetic mechanisms of malignant transformation in hematopoietic cells. However, T-ALL is genetically very heterogenous and driving mutations as well as clonal markers for the assessment of minimal residual disease are not always identifiable. Hence, there is a clinical need to further refine the genetic landscape of T-ALL including previously unrecognized fusion partners of commonly translocated genes in T-ALL of childhood.
Results
In this study, we screened n = 229 T-ALL cases by our targeted genomic capture high-throughput sequencing (gc-HTS) approach. In total, we identified n = 60 gene–gene fusions, present in n = 57 (25%) of the patients. Nine rare or even unrecognized translocations were identified and validated. Furthermore, owing to its interesting chromosomal structure, we studied the oncogenic potential of the complex rearrangement of chromosome 2 and 12, found in a near-early T-cell progenitor (ETP) ALL that leads to the fusion events PRKCE::ETV6 and ETV6::INO80D. Exogenous expression of PRKCE::ETV6 in Ba/F3 pro-B and D1 T-cells caused interleukin-independent proliferation and enhanced survival upon interleukin withdrawal, respectively.
Conclusion
Our study underlines the heterogenous mutational landscape in T-ALL. The previously unrecognized PRKCE::ETV6 resulting from a complex rearrangement involving chromosome 2 and 12 demonstrated transforming potential in cytokine-dependent cellular models support the notion of a driver mutation in near ETP-ALL. Our data reconfirm the relevance of ETV6-fusion proteins in the pathogenesis of undifferentiated T-ALL. Importantly, genomic breakpoints at the ETV6 locus represent potentially robust MRD markers for (near) ETP-ALL that lack IG/TR rearrangements.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
ALL
Acute lymphoblastic leukemia
AML
Acute myeloid leukemia
BCP-ALL
B-cell precursor-ALL
CNS
Central nervous system
ETP-ALL
Early T-cell precursor acute lymphoblastic leukemia
EFS
Event-free survival rate
ETS
E26 transformation specific
HSCT
Hematopoietic stem cell transplantation
IDR
Intrinsically disordered region
IG/TR
Immunoglobulin/T-cell receptor
IL-3
Interleukin-3
IL-7
Interleukin-7
MRD
Minimal residual disease
OS
Overall survival
SAM
Sterile alpha motif
SNV
Single nucleotide variation
T-ALL
T-cell acute lymphoblastic leukemia
TCR
T-cell receptor
UTR
Untranslated region
Background
Acute lymphoblastic leukemia (ALL) is a hematological malignancy of lymphoid progenitor cells, with accumulation of genomic lesions leading to abnormal proliferation [1]. ALL is a heterogenous disease but can be classified by immunophenotyping mainly as B-cell precursor-ALL (BCP-ALL) (85%) or T-cell ALL (T-ALL) (15%). With recent advances in treatment, risk stratification, and in supportive care, the event-free survival rate (EFS) for childhood ALL has increased to > 90% [2]. However, T-ALLs remain challenging and have an unsatisfactory rate of refractory disease and relapses. 20–30% of pediatric T-ALL cases relapse, and the five-year overall survival rate after relapse is less than 20% [3].
On the one hand, T-ALL is characterized by extensive genetic heterogeneity, therefore developing broadly applicable molecular targeted therapies poses significant challenges [4]. On the other hand, paucity of leukemia-specific T-ALL epitopes and T-cell fratricide due to shared expression of targetable antigens on both malignant and healthy T-cells challenge the development of T-cell-based immunotherapies [5]. Consequently, there are fewer available targeted therapies and limited immunotherapeutic options for T-ALL patients than for BCP-ALL [4].
Anzeige
Over the past decades, many genetic abnormalities were identified in T-ALL. Notably, chromosomal translocations of oncogenes (e.g. transcription factors) and the T-cell receptor (TCR) loci can lead to aberrant expression driven by the TCR promoter activity, resulting in dysregulated T-cell differentiation and proliferation [6]. LMO1/2, TAL1/2, or TLX1 are frequently translocated to the TCR locus. In addition, recurrent gene–gene fusion events (20–30% in T-ALL) lead to overexpression of wild type proteins (e.g. STIL::TAL) [7] or fusion proteins with aberrant protein functions (e.g. NUP214::ABL1) [8].
More recently, next-generation sequencing has extended the repertoire of genetic and epigenetic abnormalities in T-ALL uncovering a wide range of heterogenous mutations [9, 10]. Of note, an immunophenotypic subtype of T-ALL (early T-cell progenitor, ETP-ALL) shows a specific gene mutation pattern, marked by mutations within genes regulating cytokine receptors and RAS signaling [11].
In this study, we utilized data from our targeted panel for genomic capture high-throughput sequencing (gc-HTS) that we utilize to select molecular MRD markers to identify novel fusion partners of commonly translocated genes in T-ALL [12]. We screened n = 229 cases of T-ALL and identified n = 60 gene–gene fusions in 25% of the patients. Among those we identified several gene fusion events that have not been previously described in T-ALL. Notably, a near ETP-ALL sample exhibited a previously unrecognized ETV6-fusion gene with transforming potential. Our results indicate that PRKCE::ETV6 expression induces cytokine-independent growth and survival in Ba/F3 pro-B cells and D1 T-cells compatible with an oncogenic driver mutation in ETP-ALL.
Results
Patient characteristics
By use of gc-HTS [13] we screened n = 229 pediatric T-ALL patients, diagnosed in the CoALL trial centers in Germany between 2003 and 2023. Sex distribution was unequal as anticipated (f = 65 and m = 173). The average age at diagnosis was 9.4 years (range 1.1–18 years) and mean WBC was 64.3/nl (1–900).
Anzeige
Gene–gene fusions
Within the targeted gc-HTS data we identified n = 60 gene–gene fusions in 25% of the patients (n = 57 out of 229). Within the gene–gene fusion events, we identified mainly STIL::TAL1 with a frequency of 17% (38/229), NUP214::ABL1 (3%, 6/229) and KMT2A-rearrangements (3%, 6/229). Two patients with STIL::TAL1 fusions each had an independent second translocation, T-ALL 01 had a t(2;5) and T-ALL 02 had an additional t(8;9) translocation (Table 1, Fig. 1A). Detailed analysis of case T-ALL 01 with the fusion gene GCC2::PDGFRB was published elsewhere by us [14]. All other events represent rare or previously unknown events for T-ALL (Fig. 1B). In T-ALL 03, we identified two gene–gene fusions, involving chr. 2 and 12. To independently validate the findings, we performed targeted cDNA sequencing of the fusion sites (Fig. 1C).
Table 1
Overview of the findings of gc-HTS analysis in 9 cases with previously unidentified gene–gene fusions in this study cohort. The gc-HTS analysis identified 7 rare and 3 novel gene–gene fusions in the 9 samples analyzed. References indicate a previous identification of the gene–gene fusion in T-ALL or other leukemic entities
Overview of gene–gene fusions identified in 229 pediatric T-ALL cases in this study. A Number of gene–gene fusions identified by targeted gc-HTS in 229 T-ALL cases. B Circos plot of 9 rare or previously unknown rearrangements. C Validation of genomic breakpoints from detected gene–gene fusion transcripts in cDNA by Sanger sequencing
Complex rearrangement involving chromosome 2 and 12 results in two gene–gene fusion products
In regard of the distinct chromosomal breakpoint pattern, we analyzed the T-ALL 03 fusions in detail (gc-HTS identified breakpoints mapped to chr2:45,959,697, chr12:11,875,897, chr12:11,875,775 and chr2:206,006,023 (hg38)). This specific translocation generates gene fusions of PRKCE (chr. 2, p21) with ETV6 (chr. 12, p13.2) and ETV6 (chr. 12, p13.2) with INO80D (chr. 2, q33.3). The schemes of chromosomal translocations and its products are shown in Fig. 2A + B. According to our gc-HTS data, cytogenetic studies obtained from clinical records at the time of diagnosis presented a highly aberrant and complex karyotype of 47,XY,?der(2),del(11)(q14 ~ 22),add(12)(p13), + mar[cp10]/46,XY[7]. FISH analysis at that time showed a deletion at chromosome 11q leading to the loss of one of the ATM genes, located in the region 11q22.
Fig. 2
Characterization of PRKCE::ETV6 and ETV6::INO80D fusions identified in a pediatric T-ALL patient: A + B Chromosomal position and exon structure of PRKCE, ETV6 and INO80D. Dashed lines comprise the exons that occur in the PRKCE::ETV6 and ETV6::INO80D gene fusions. C Schematic structure of functional domains from PRKCE::ETV6 and ETV6::INO80D fusion proteins. The number of amino acids and molecular weight (in kDa) are specified. Asterisk marks the ATP-binding site. D Relative mRNA expression in patient’s cDNA (T-ALL) and control PBMCs (peripheral blood mononuclear cells) from healthy donors for wildtype ETV6, PRKCE, INO80D, and the fusion product ETV6::INO80D and PRKCE::ETV6. Data show 2^-ΔΔCt*1000, normalized to human B2M. aa, amino acids; chr, chromosome; kbp, kilo basepairs; IDR, intrinsically disordered region; SAM, sterile alpha motif
The in-frame fusion of PRKCE::ETV6 produces a 7,233 bp transcript, which is made of the N-terminal 838 bp residues (exon 1–2) of PRKCE (ENST00000306156) and the C-terminal 6,395 bp residues (exon 6–8) of ETV6 (ENST00000396373). ETV6::INO80D generates an in-frame fusion of 13,276 bp in total, which is made of the N-terminal 1,463 bp residues (exon 1–5) of ETV6 and the C-terminal 11,813 bp residues (exon 11) of INO80D (ENST00000403263). The PRKCE breakpoint is localized in intron 2, which leaves the C2-domain part of the PRKCE::ETV6 fusion. The ATP-binding site and the protein kinase domain from PRKCE are not part of the PRKCE::ETV6 fusion. ETV6 breakpoint is located in intron 5, preserving the ETS-domain in the PRKCE::ETV6 fusion. The reciprocal part of ETV6 remains integral to the ETV6::INO80D fusion, including its SAM-domain. INO80D breakpoint is in intron 10 (Fig. 2C). ETV6::INO80D has previously been identified in two T-ALL patients described by Zhang et al. [11]. PRKCE::ETV6 on the other hand, has not been documented in previous studies. Relative expression of fusion transcripts was determined by quantitative real-time PCR (qPCR) (Fig. 2D).
Clinical presentation of patient with complex rearrangement involving chromosome 2 and 12
The patient with this unique translocation is a 4-year-old boy, presented to the Department of Pediatric Hematology and Oncology of the Medical University Hamburg-Eppendorf (UKE) in 2011. Flow cytometric analysis revealed blasts which were positive for CD5, CD7, CD11b, CD34, HLADR, CD45 and cyCD3 compatible with a near ETP-ALL. Induction therapy was initiated with a modified CoALL-08–09 High Risk (HR) standard treatment [20]. Since there were no clonal markers available for molecular MRD, therapy response was monitored by cytomorphological analysis only (Fig. 3A). Since this patient was diagnosed with induction failure with central nervous system (CNS) infiltration, he was stratified to the HR intensified treatment arm and received an individual treatment based on response criteria, including high-dose cytarabine, followed by DNX-FLA (Daunorubicine, Fludarabin, and Cytarabin), a TVTG regimen (Topotecan, Vinorelbine, Thiotepa, Dexamethasone and Gemcitabine) [21] and Alemtuzumab. Ultimately, he received a bone marrow transplantation (HSCT) with an HLA-mismatched unrelated donor (HLA 9/10). The presence of complete chimerism after HSCT indicates the absence of relapse. Retrospectively, we utilized the genomic breakpoints (gBP) of ETV6::INO80D and PRKCE::ETV6 as molecular MRD markers to confirm a complete molecular remission by qPCR (Fig. 3B).
Fig. 3
Clinical timeline and treatment response of the T-ALL case with PRKCE::ETV6 and ETV6::INO80D: A The blast count by morphology (%) is depicted over the course of the treatment interventions. Induction therapy was initiated with a modified CoALL-08–09 High Risk Standard treatment due to hyperbilirubinemia and hepatopathy of unknown origin. Treatment was started with a Cortisone-monotherapy, later Vincristine/Cyclophosphamid instead of Vincristine/Daunorubicin was added. The therapy was continued with low doses of Daunorubicin, i.th. Methotrexat was given and another two triple therapies had to be administered. Due to inadequate further MRD decrease, it was decided to intensify therapy. Patient received a hidac block, a modified high-risk block and a TVTG block. The treatment was then switched to Alemtuzumab and Pentostatin, under which a stable remission was achieved for the first time. Patient then received a bone marrow transplant with an HLA-mismatched unrelated donor (HLA 9/10). *Reappearance of blast after HSCT was excluded by chimerism results. B Retrospective molecular MRD results, quantified by qPCR with patient specific assays for PRKCE::ETV6 and ETV6::INO80D. Asterisks mark detectable PCR-results that are below the quantifiable range (positive, not quantifiable). Modified induction therapy (Prednisolon, Daunorubicin, Vincristin, i. th. Methotrexat), CPM: cyclophosphamide, MTX: methotrexate, modif. HR1: modif. high risk 1 block, NEL: nelarabin, VP16: etoposide, DNX-FLA: Daunoxome, Fludarabin, high dose cytarabin i. th. Methotrexat
PRKCE::ETV6 induces factor independent cell-line growth in vitro
To evaluate the transforming potential of the ETV6::INO80D and PRKCE::ETV6 fusions, both fusions were exogenously expressed in Ba/F3 cells upon lentiviral transduction. Vector constructs are shown in Fig. 4A and B. Successful transduction of Ba/F3 and D1 was confirmed by relative quantification of mRNA transcripts using qPCR (Fig. 4C). Full-length protein translation was confirmed by Western Blot in Ba/F3 cells (Fig. 4D). Upon withdrawal of interleukin-3 (IL-3), Ba/F3 cells expressing the PRKCE::ETV6 fusion protein continued to proliferate in the absence of IL-3, whereas cells transduced with an empty vector control and ETV6::INO80D did not exhibit IL-3-independent growth (Fig. 4E). Ba/F3 cells co-transduced with both fusion transcripts also showed IL-3 independent cell survival and growth, demonstrating similar behavior to Ba/F3 cells expressing only the PRKCE::ETV6 fusion protein (Fig. 4E).
Fig. 4
Functional characterization of PRKCE::ETV6 and ETV6::INO80D fusion proteins. A + B Maps of lentiviral plasmids containing the fusion constructs for PRKCE::ETV6-Flag-eGFP and ETV6::INO80D-HA-mCherry. Validation of fusion constructs by C relative quantification of mRNA level by qPCR in Ba/F3 and D1 cells and D Western Blot in Ba/F3. Cells were lentivirally transduced with empty vector (eGFP or mCherry appropriate to the corresponding fusion protein), PRKCE::ETV6-Flag-eGFP, or ETV6::INO80D-HA-mCherry or in combination of both, as indicated. Ct-values from qPCR for PRKCE::ETV6 and ETV6::INO80D were normalized to murine GAPDH and are presented as 2^-ΔΔCt*1000. Fusion proteins were detected in Ba/F3 cells via HA- or Flag-Tag Western Blot. Transformation potentials of PRKCE::ETV6-Flag and ETV6::INO80D-HA were analysed by E IL-3 withdrawal in Ba/F3 cells and F IL-7 withdrawal in D1 cells. Ba/F3 were counted 48 h, 72 h, and 96 h after seeding and proliferation potential is depicted (cells/ml medium). For D1 cells, the percentage of living cells was determined after 24 h, 48 h, and 72 h. Both plots show the average values of three independent experiments with technical triplicates each
For validation purposes, PRKCE::ETV6 was then introduced into the T-cell line D1 via lentiviral transduction. D1 cells expressing the PRKCE::ETV6 fusion protein exhibited reduced apoptosis rates in the absence of interleukin-7 (IL-7) compared to those only transduced with the empty vector control (Fig. 4F).
Discussion
Several genetic alterations have previously been described to exert an influence on the pathogenesis of T-ALL [22]. Abnormalities such as aberrant expression of transcription factors or cell cycle regulators, as well as fusion genes resulting from chromosomal translocations, are frequent and lead to aberrant differentiation, proliferation and apoptosis of T-cell progenitors [23]. Here, we identified novel and recurrent gene fusion partners for commonly translocated genes in ALL with potential driving capacities by utilization of targeted gc-HTS.
The most common gene–gene fusion is STIL::TAL1, arising from a submicroscopic interstitial deletion between STIL and TAL1. In line with literature, we identified STIL:TAL1 in 17% of our cases [7]. In our cohort, STIL::TAL1 had no impact on EFS. Interestingly, we identified two JAK2 rearrangements, the novel CEP120::JAK2 fusion and PCM1::JAK2, which has so far only been reported in two T-ALL [15]. The latter was found in a case of therapy-refractory disease and nowadays, such a patient could benefit from treatment with Ruxolitinib [24].
Anzeige
The ETV6 gene has been identified to play a role in the development of multiple hematologic malignancies [25]. As a member of the E26 transformation specific (ETS) family of transcription factors, ETV6 contains three major functional domains. The C-terminal ETS-domain mediates specific DNA-binding activities, while the sterile alpha motif (SAM) domain facilitates together with the internal domain protein–protein interactions with ETS-factors [26]. Various single nucleotide variations (SNVs) and chromosomal translocations involving ETV6 have been identified that lead to leukemic development [27, 28]. While most of the ETS-domain proteins are transcriptional activators, ETV6 has been found to act as a strong transcriptional repressor [29].
Here, we found three patients with ETV6-fusions, namely MN1::ETV6, ETV6::CRX, and PRKCE::ETV6/ETV6::INO80D, resulting from a complex rearrangement involving chromosome 2 and 12. MN1::ETV6 is a recurrent translocation in AML but to our knowledge, this is the first reported case in T-ALL [30]. ETV6::CRX has recently been described in an ETP-ALL patient, where the CRX homeodomain was postulated to induce a T-cell differentiation block [16]. ETV6::INO80D has been described in two ETP-ALL cases but none of these patients had the co-translocation with PRKCE [11]. Interestingly, all three ETV6-translocated cases in our cohort show a near ETP immunophenotype, consistent with the findings by Van Vlierberghe et al., who postulated a predominant occurrence of ETV6 mutations in undifferentiated T-ALL [28]. The term “near ETP-ALL” refers to a group of T-ALL that shares a comparable genotype and phenotype as ETP-ALL but exhibits higher CD5 expression levels [16]. ETP-ALL has recently been defined by the WHO as a high-risk subtype of T-ALL, accounting for 11–12% of pediatric ALL cases [31]. Originating from early T-cell precursors, multilineage pluripotency is retained and it displays a distinct immunophenotypic and genomic profile compared to other subtypes of T-ALL.
The novel in-frame fusion PRKCE::ETV6 results in a PRKCE::ETV6 fusion protein, containing C2-domain of PRKCE and ETS-domain of ETV6. Since the kinase domain is not contained the PRKCE::ETV6 fusion protein, we propose that the oncogenic potential of PRKCE::ETV6 fusion protein might arise from dysregulated protein–protein interaction, leading to aberrant transcriptional regulation of ETV6 target genes. The fusion was identified in a child with near ETP-ALL ultimately undergoing HSCT. Like ETP-ALL, near ETP-ALL show five-fold higher rates of induction failure compared to non-ETP T-ALL subgroups, but near ETP-ALL is not associated with an inferior survival [16]. However, Wood et al. demonstrated that near ETP-ALL patients with a day-29 MRD ≥ 0.1% exhibited reduced OS and 5-year EFS, which was not observed in patients with ETP-ALL [16]. Another study demonstrated that outcomes for these patients were improved by allogenic HSCT [32]. These findings suggest that intensified treatment strategies, including HSCT, may enhance survival rates in childhood ETP-ALL [33]. Given the high rate of induction failure, Wood et al. postulates an early therapy intensification may be necessary, targeting resistance pathways specific to ETP-ALL [16].
Since MRD is such a crucial parameter for therapy guidance, the choice of a stable molecular MRD marker is essential for an appropriate therapy regiment. Most patients are monitored via the quantification of leukemia specific TCR or immunoglobulin (IG) sequences by real time PCR. However, consistent with its undifferentiated phenotype, ETP-ALL and near ETP-ALL frequently lack TCR or IG gene rearrangement, which hampers the identification of molecular MRD marker [34]. Unfortunately, results from the morphological analysis reveal that significant discrepancies can occur, as demonstrated post-HSCT, where relapse of blasts was excluded by chimerism analysis. The morphological assessment indicated over 15% blasts, reflecting regenerating donor-derived cells rather than a relapse of the original malignancy, particularly as the patient has remained in remission to date. Therefore, alternative genomic markers are required to allow highly sensitive molecular MRD monitoring and genomic breakpoints resulting from chromosomal translocations are in focus of MRD researchers. For example, Hoffmann et al. presented that ETV6::RUNX1 breakpoints represent sensitive and stable markers for MRD in ALL [35]. In this patient, the PRKCE::ETV6 fusion might be a driver mutation that could be exploited as a potential marker for molecular MRD in the future. However, as we have previously demonstrated, the careful selection of an appropriate qPCR-MRD marker plays a crucial role in the accurate patient stratification [14]. Uncommon genomic breakpoints need to be evaluated carefully before utilization for MRD.
Anzeige
INO80D is an essential regulator for chromatin remodeling and genome integrity and we reasoned that it acts as a tumor suppressor [36]. Unexpectedly, our in vitro studies show that only PRKCE::ETV6 single and PRKCE::ETV6/ETV6::INO80D double transduced Ba/F3 cells maintain proliferation capacities after IL-3 withdrawal. ETV6::INO80D alone did not show any transforming potential. To confirm these findings in a more relevant T-cell lineage context we transduced D1-cells as well. D1 is a murine thymocyte cell line that is IL-7-dependent for survival and growth in vitro [37]. In line with our findings in the Ba/F3 pro-B cell model, PRKCE::ETV6 rescues D1 T-cells from cell death. Altogether, these data provide evidence that PRKCE::ETV6 represents a biological active gene–gene fusion event that qualifies as a reliable MRD target in this near ETP-ALL.
Conclusions
In this study, we focused on uncommon gene–gene fusion events in a comprehensive T-ALL cohort. Utilizing a targeted gc-HTS approach we were able to identify n = 60 gene–gene fusion events, eight of which are rare or unknown in T-ALL. Notably, a complex rearrangement identified in a near ETP-ALL, involving chr. 2 and chr. 12, resulted in the two fusion proteins INO80D::ETV6 and PRKCE::ETV6. Only PRKCE::ETV6 showed factor independence in Ba/F3 and D1 cell line models supporting the notion of PRKCE::ETV6 as a driver oncogene in ETP-ALL. Our data underline the relevance of ETV6-fusion proteins in the development of undifferentiated T-ALL and support the use of genomic breakpoints within ETV6 as potential MRD markers for (near) ETP-ALL that otherwise lack clonal markers.
Methods
Patient samples
We screened a patient cohort of 229 T-ALL, recruited for COALL03 (n = 89), COALL09 (n = 108), COALL20 (n = 23) and Alltogether1 (n = 9). Clinical information and hematological values were retrieved from patient files. The Ethics Committee of the Hamburg Medical Association gave the ethics vote PVN7286. The study was performed in accordance with the Declaration of Helsinki. Written informed consent was obtained from all patients and/or their legal representatives. All sample IDs are completely pseudonymized.
gc-HTS
To detect gene–gene fusions in T-ALL cases we utilized our targeted genomic capture high-throughput sequencing (gc-HTS) approach. Method is described elsewhere in detail [13]. Beside the TCR and immunoglobulin loci, we capture the loci of ETV6, KMT2A, TCF3, TAL1, ABL1/2, PDGFRb, CSF1R, EPOR, and JAK2. Chromosomal coordinates from the probes are listed in Supplemental Table 1. We used genomic DNA from bone marrow (BM) or peripheral blood (PB) from day of diagnosis for the screen. Gene fusions were detected by Segemehl [13].
Anzeige
RNA isolation, cDNA synthesis and qPCR
RNA was isolated from 5–10 mio. cells from with RNeasy Mini Kit (QIAGEN) and reverse transcribed to cDNA by M-MLV reverse transcription from Promega for 1 h at 37 °C using random primers (Promega), both appropriate to the manufacturer’s instructions. Quantitative qPCR was performed with SYBR Green I (Roche), according to the manufacturer’s instructions. Sanger sequencing of the qPCR products was performed with according primers at Microsynth Seqlab GmbH. Primer sequences are listed in Table 2.
Table 2
Overview of primers for qPCR, Sanger sequencing, and cloning
Fusion
5’ Primer
3’ Primer
CALM2::ABL1
ATGATCAGGGAAGCAGATATTGAT
TGAGGCTCAAAGTCAGATGC
CEP120::JAK2
TGGAATCTGCAACTAAGTCTAAACT
ATCCCGGTCTTCAAAGGCAC
ETV6::CRX
ACCACATCATGGTCTCTGTCT
CGCTCCCGCCGCTGCT
ETV6::INO80D
CAACCTCTCTCATCGGGAAG
CGAGAGAAGTTACAGCCTGC
PRKCE::ETV6
ATTGATCTGGAGCCAGAAGGAA
AGCAACTGATAGACGTAATCCC
KMT2A::STK4
ACCACAGGATGGAGACTACG
CTCTTGCTGATGGGGTAGGT
MN1::ETV6
CAGAACCCCAACAGCAAAGAA
GTGTTGCTGTCAATTGGCCTTA
PCM1::JAK2
CGTCTGCACAGGCCAGCCTG
GTCCTGTAGAGGGTCATACC
SLC12A6::NUTM1
CTTCGCTGGCAACTGTTGCA
GTTGGTGGGAGAAAGGGAAGT
ETV6_WT
TGACCAAAGAGGACTTTCGCTAT
GAATCCGAGGTTTCCTCTGC
INO80D_WT
CCAGCGCCTCTCACTCTG
AATGCCGCAGAATCAGGATGAA
PRKCE_WT
CATCCAGTTTGAGGAGCTGC
ACTCTTCCTTCTGGCTCCAG
PRKCE::ETV6
full length
ATGGTAGTGTTCAATGGCCTTCT
TCAGCATTCATCTTCTTGGTATATTT
(Flag-Tag: TCACTTGTCGTCATCGTCTTTGTAGTC
GCATTCATCTTCTTGGTATATTT)
ETV6::INO80D full length
ATGTCTGAGACTCCTGCTCAG
TCAGTTAGGGGAGGGAAAGG
(HA-Tag: TCAAGCGTAATCTGGAACATC
GTATGGGTAGTTAGGGGAGGGAAAGG)
Relative quantification
Relative expression levels were depicted after normalization to beta-2-microglobulin (B2M; human) or mGAPDH (murine) as a reference gene (2^-ΔΔCt*1000). Mononuclear cells from peripheral blood (PBMCs) from healthy donors were used as normal controls.
Molecular MRD quantification
Quantification of gBP as molecular MRD markers followed EUROMRD guidelines [38]. Primer and probes are P::E-fw CAGGATGGCTCAGATCAGATTTA, P::E-rv GCTCAGATCAGATTTAGGGAACA, P::E-TM ACGTTTGATGCTCTCTGCCTTGCA, E::I-fw TCAAGTTTTCCTGGAAAACAGC, E::I-rv TTGAGCACAACACTAAATGCC, E::I-TM TGGTATTGCCTATGTCTGCTTCCATGC.
Cloning of full-length transcripts
The fusion transcripts were amplified by using the TOPO XL-2 complete PCR Cloning Kit, with One Shot™ OmniMAX™ 2 T1R Chemically Competent E. coli Cells (Thermo Fisher Scientific) and full-length primer sets (Table 2). 3’ Flag-tag to PRKCE::ETV6 and 3’ HA-tag to ETV6::INO80D were added by PCR with indicated primers (Table 2). Tagged full length constructs were subcloned into pLenti-LeGO-eGFP or -mCherry, using T4 DNA ligase (Thermo Fisher Scientific).
Cell culture
Human embryonic kidney 293 T (HEK293T) cells were cultured in DMEM (gibco) supplemented with 10% FBS (gibco), 2% HEPES Buffer Solution (1 M) (gibco), 1% sodium pyruvate (100 mM) (gibco). Ba/F3 cells were cultured 1 × 105/ml in RPMI 1640 medium (gibco) supplemented with 10% heat inactivated (h.i.) FBS (gibco) and 10 ng/ml recombinant murine interleukin-3 (PeproTech). D1 cells were cultured 5 × 105/ml in RPMI 1640 medium (gibco) supplemented with 10% h.i. FBS (gibco), 2% HEPES Buffer Solution (1 M) (gibco) and 25 ng/ml recombinant murine IL-7 (biolegend). All cells were incubated at 37 °C and 5% CO2.
Lentiviral transduction
Lentiviral transduction was described in detail elsewhere [39]. Successful transduction of Ba/F3 and D1 cells was verified 48 h later with fluorescence activated cell sorting (FACS). Two weeks post-transduction eGFP-/mCherry positive cells were purified by FACS.
Proliferation and viability assays
For long-term viability and proliferation experiments transduced cells were seeded without interleukin supplementation as triplicates in 24-well plates. Ba/F3 cells were seeded at a concentration of 1 × 105/ml and D1 cells at a density of 5 × 105/ml. Cell counts and viability of Ba/F3 and D1 cells were assessed on day 2, day 3, and day 4 using Trypan Blue and Countess 3 (Thermo Fisher Scientific). Results represent average values of three independent replicates.
Western blot analysis
Cells were lysed with Ripa Lysis Buffer (ChemCruz) complemented with PMSF, sodium orthovanadate and protease inhibitor cocktail (all from Santa Cruz) and sonicated with the Bioruptor™ (Diagenode). The samples were loaded on NuPAGE™ 4–12% Bis–Tris Gel (Thermo Fisher Scientific) with 1X MES SDS Running Buffer (Thermo Fisher Scientific, NuPAGE®, 20X). Protein gels were transferred as a wet-blot at 100 V (equals to 200 mA), using Towbin-Buffer (6.06 g Tris, 28.8 g Glycine, 400 ml Methanol, 1600 ml H2O), Whatman paper and Nitrocellulose Blotting Membrane (GE Healthcare, Amersham™ Protran™ 0.45 µm NC). Following antibodies were used: 1:500 monoclonal Anti Flag-tag antibody (Lot: #VC296117, Thermos Fisher Scientific), 1:1000 Anti HA-Tag monoclonal antibody (Lot: #ZF393513, Thermo Fisher Scientific), 1:5000 Monoclonal Anti-ß-Actin (Lot: 067M4856V, Sigma), 1:20.000 IRDye® 800CW Goat anti-rabbit IgG (Lot: #D30425-15, Li-Cor), 1:20.000 IRDye® 680RD Goat anti-mouse IgG (Lot: #D30418-05, Li-Cor). Images were acquired and analyzed using Odyssey XF Imager (Li-Cor).
Acknowledgements
We are grateful to all coworkers from the lab for their support. Special thanks go to Nicole Kasdepke, Silvia Rogasch and Manuela Adao. Cytogenetic analyses were performed at the Institute for Pathology, University Hospital Giessen, Germany by J. Brandtke. Cell sorting was performed at the cytometry and cell sorting core facility of the Leibniz Institute of Virology Hamburg. D1 cells were provided from Joao Barata (University of Lisbon), originally generated by Scott K. Durum, National Cancer Institute, Frederick.
Declarations
Ethics approval and consent to participate
The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of Ethik-Kommission der Ärztekammer Hamburg (code PVN7286). Informed consent was obtained from all subjects involved in the study.
Consent for publication
All authors have read and agreed to the published version of the manuscript.
Competing interests
The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Characterization of a PRKCE::ETV6 fusion as a potential oncogenic driver in T-cell acute lymphoblastic leukemia
Verfasst von
Esther L. Monsees
Udo zur Stadt
Julia Strauss
Sabrina Schuster
Nadja Kleist
Richard T. Hauch
Michael Spohn
Gerrit Wolters-Eisfeld
Martin A. Horstmann
Gabriele Escherich
Lena Behrmann
Devilli L, Garonzi C, Balter R, Bonetti E, Chinello M, Zaccaron A et al (2021) Long-term and quality of survival in patients treated for acute lymphoblastic leukemia during the pediatric age. Hematol Rep 13(1):8847CrossRefPubMedPubMedCentral
Huang YH, Wan CL, Dai HP, Xue SL (2023) Targeted therapy and immunotherapy for T cell acute lymphoblastic leukemia/lymphoma. Ann Hematol. 102(8):2001–13CrossRefPubMed
5.
Riillo C, Caracciolo D, Grillone K, Polerà N, Tuccillo FM, Bonelli P et al (2022) A novel bispecific T-cell engager (CD1a x CD3ε) BTCE is effective against cortical-derived T cell acute lymphoblastic leukemia (T-ALL) cells. Cancers 14(12):2886CrossRefPubMedPubMedCentral
6.
Larmonie NSD, Dik WA, Meijerink JPP, Homminga I, van Dongen JJM, Langerak AW (2013) Breakpoint sites disclose the role of the V(D)J recombination machinery in the formation of T-cell receptor (TCR) and non-TCR associated aberrations in T-cell acute lymphoblastic leukemia. Haematologica 98(8):1173–1184CrossRefPubMedPubMedCentral
7.
D’Angiò M, Valsecchi MG, Testi AM, Conter V, Nunes V, Parasole R et al (2015) Clinical features and outcome of SIL/TAL1-positive T-cell acute lymphoblastic leukemia in children and adolescents: a 10-year experience of the AIEOP group. Haematologica 100(1):e10–e13CrossRefPubMedPubMedCentral
8.
Veltri G, Sandei M, Silvestri D, Bresolin S, Pession A, Santoro N et al (2022) NUP214–ABL1 fusion in childhood T-ALL. Pediatr Blood Cancer 69(9):e29643CrossRefPubMed
9.
Pölönen P, Di Giacomo D, Seffernick AE, Elsayed A, Kimura S, Benini F et al (2024) The genomic basis of childhood T-lineage acute lymphoblastic leukaemia. Nature 632(8027):1082–1091CrossRefPubMedPubMedCentral
10.
Van der Meulen J, Van Roy N, Van Vlierberghe P, Speleman F (2014) The epigenetic landscape of T-cell acute lymphoblastic leukemia. Int J Biochem Cell Biol 53:547–557CrossRefPubMed
11.
Zhang J, Ding L, Holmfeldt L, Wu G, Heatley SL, Payne-Turner D et al (2012) The genetic basis of early T-cell precursor acute lymphoblastic leukaemia. Nature 481(7380):157–163CrossRefPubMedPubMedCentral
12.
Zur Stadt U, Alawi M, Adao M, Indenbirken D, Escherich G, Horstmann MA (2019) Characterization of novel, recurrent genomic rearrangements as sensitive MRD targets in childhood B-cell precursor ALL. Blood Cancer J. 9(12):96CrossRefPubMedPubMedCentral
13.
Stadt U, Escherich G, Indenbirken D, Alawi M, Adao M, Horstmann MA (2016) Rapid capture next-generation sequencing in clinical diagnostics of kinase pathway aberrations in B-cell precursor ALL. Pediatr Blood Cancer 63(7):1283–1286CrossRefPubMed
14.
Monsees EL, Hauch RT, Wrzeszcz A, Spohn M, Strauss J, zur Stadt U et al (2025) A case report of a pediatric T-cell acute lymphoblastic leukemia with a subclonal GCC2::PDGFRB t(2;5) translocation – implementation for the selection of MRD-targets. Leuk Lymphoma. https://doi.org/10.1080/10428194.2025.2480395CrossRefPubMed
15.
Kaplan HG, Jin R, Bifulco CB, Scanlan JM, Corwin DR (2022) PCM1-JAK2 fusion tyrosine kinase gene-related neoplasia: a systematic review of the clinical literature. Oncologist 27(8):e661–e670CrossRefPubMedPubMedCentral
16.
Wood BL, Devidas M, Summers RJ, Chen Z, Asselin B, Rabin KR et al (2023) Prognostic significance of ETP phenotype and minimal residual disease in T-ALL: a Children’s Oncology Group study. Blood 142(24):2069–2078CrossRefPubMedPubMedCentral
17.
Hormann FM, Hoogkamer AQ, Beverloo HB, Boeree A, Dingjan I, Wattel MM et al (2019) NUTM1 is a recurrent fusion gene partner in B-cell precursor acute lymphoblastic leukemia associated with increased expression of genes on chromosome band 10p12.31–12.2. Haematologica. 104(10):e455-9CrossRefPubMedPubMedCentral
18.
Meyer C, Larghero P, Almeida Lopes B, Burmeister T, Gröger D, Sutton R et al (2023) The KMT2A recombinome of acute leukemias in 2023. Leukemia 37(5):988–1005CrossRefPubMedPubMedCentral
19.
Buijs A, van Rompaey L, Molijn AC, Davis JN, Vertegaal ACO, Potter MD et al (2000) The MN1-TEL Fusion Protein, Encoded by the Translocation (12;22)(p13;q11) in Myeloid Leukemia, Is a Transcription Factor with Transforming Activity. Mol Cell Biol 20(24):9281–9293CrossRefPubMedPubMedCentral
20.
Escherich G, Zur Stadt U, Borkhardt A, Dilloo D, Faber J, Feuchtinger T et al (2022) Clofarabine increases the eradication of minimal residual disease of primary B-precursor acute lymphoblastic leukemia compared to high-dose cytarabine without improvement of outcome. Results from the randomized clinical trial 08–09 of the Cooperative Acute Lymphoblastic Leukemia Study Group. Haematologica. 107(5):1026–33CrossRefPubMed
21.
Kolb EA, Steinherz PG (2003) A new multidrug reinduction protocol with topotecan, vinorelbine, thiotepa, dexamethasone, and gemcitabine for relapsed or refractory acute leukemia. Leukemia 17(10):1967–1972CrossRefPubMed
22.
Girardi T, Vicente C, Cools J, De Keersmaecker K (2017) The genetics and molecular biology of T-ALL. Blood 129(9):1113–1123CrossRefPubMed
23.
Chen B, Jiang L, Zhong ML, Li JF, Li BS, Peng LJ et al (2018) Identification of fusion genes and characterization of transcriptome features in T-cell acute lymphoblastic leukemia. Proc Natl Acad Sci U S A 115(2):373–378CrossRefPubMed
24.
Rumi E, Milosevic JD, Selleslag D, Casetti I, Lierman E, Pietra D et al (2015) Efficacy of ruxolitinib in myeloid neoplasms with PCM1-JAK2 fusion gene. Ann Hematol 94(11):1927–1928CrossRefPubMed
25.
Wang Q, Dong S, Yao H, Wen L, Qiu H, Qin L et al (2014) ETV6 mutation in a cohort of 970 patients with hematologic malignancies. Haematologica 99(10):e176–e178CrossRefPubMedPubMedCentral
26.
Bohlander SK (2005) ETV6: a versatile player in leukemogenesis. Semin Cancer Biol 15(3):162–174CrossRefPubMed
27.
De Braekeleer E, Douet-Guilbert N, Morel F, Le Bris MJ, Basinko A, De Braekeleer M (2012) ETV6 fusion genes in hematological malignancies: A review. Leuk Res 36(8):945–961CrossRefPubMed
28.
Van Vlierberghe P, Ambesi-Impiombato A, Perez-Garcia A, Haydu JE, Rigo I, Hadler M et al (2011) ETV6 mutations in early immature human T cell leukemias. J Exp Med 208(13):2571–2579CrossRefPubMedPubMedCentral
29.
Hock H, Shimamura A (2017) ETV6 in hematopoiesis and leukemia predisposition. Semin Hematol 54(2):98–104CrossRefPubMedPubMedCentral
30.
Shao H, Cen J, Chen S, Qiu H, Pan J (2018) Myeloid neoplasms with t(12;22)(p13;q12)/MN1-EVT6: a systematic review of 12 cases. Ann Hematol 97(3):417–424CrossRefPubMed
31.
Jain N, Lamb AV, O’Brien S, Ravandi F, Konopleva M, Jabbour E et al (2016) Early T-cell precursor acute lymphoblastic leukemia/lymphoma (ETP-ALL/LBL) in adolescents and adults: a high-risk subtype. Blood 127(15):1863–1869CrossRefPubMedPubMedCentral
32.
Schrappe M, Valsecchi MG, Bartram CR, Schrauder A, Panzer-Grümayer R, Möricke A et al (2011) Late MRD response determines relapse risk overall and in subsets of childhood T-cell ALL: results of the AIEOP-BFM-ALL 2000 study. Blood 118(8):2077–2084CrossRefPubMed
33.
Bond J, Graux C, Lhermitte L, Lara D, Cluzeau T, Leguay T et al (2017) Early response-based therapy stratification improves survival in adult early thymic precursor acute lymphoblastic leukemia: a group for research on adult acute lymphoblastic leukemia study. J Clin Oncol 35(23):2683–2691CrossRefPubMed
34.
Neumann M, Coskun E, Fransecky L, Mochmann LH, Bartram I, Sartangi NF et al (2013) FLT3 Mutations in Early T-Cell Precursor ALL Characterize a Stem Cell Like Leukemia and Imply the Clinical Use of Tyrosine Kinase Inhibitors. PLoS ONE 8(1):e53190CrossRefPubMedPubMedCentral
35.
Hoffmann J, Krumbholz M, Gutiérrez HP, Fillies M, Szymansky A, Bleckmann K et al (2019) High sensitivity and clonal stability of the genomic fusion as single marker for response monitoring in ETV6-RUNX1-positive acute lymphoblastic leukemia. Pediatr Blood Cancer 66(8):e27780CrossRefPubMed
36.
Falbo KB, Shen X (2012) Function of the INO80 chromatin remodeling complex in DNA replication. Front Biosci Landmark Ed 17(1):970–975CrossRefPubMedPubMedCentral
37.
Li WQ, Jiang Q, Khaled AR, Keller JR, Durum SK (2004) Interleukin-7 Inactivates the Pro-apoptotic Protein Bad Promoting T Cell Survival *. J Biol Chem 279(28):29160–29166CrossRefPubMed
38.
Van Der Velden VHJ, Cazzaniga G, Schrauder A, Hancock J, Bader P, Panzer-Grumayer ER et al (2007) Analysis of minimal residual disease by Ig/TCR gene rearrangements: guidelines for interpretation of real-time quantitative PCR data. Leukemia 21(4):604–611CrossRefPubMed
39.
Behrmann L, McComb S, Aguadé-Gorgorió J, Huang Y, Hermann M, Pelczar P et al (2017) Efficient Generation of Multi-gene Knockout Cell Lines and Patient-derived Xenografts Using Multi-colored Lenti-CRISPR-Cas9. Bio-Protoc 7(7):e2222PubMedPubMedCentral
Metastatische Rezidive sind bei Jugendlichen und jungen Erwachsenen mit Krebs häufig und verschlechtern die Prognose deutlich. Eine umfassende Kohortenstudie aus Kalifornien zeigt klare Unterschiede nach Tumorart, Stadium und Diagnosejahr.
Daten der Phase-III-Studie STELLAR sprechen für eine klinisch relevante Aktivität der Therapiekombination aus Eflornithin und Lomustin bei Personen mit rezidivierten Grad-3-Astrozytomen. Besonderheiten im Studiendesgin machen die Interpretation indes nicht ganz leicht.
In einer Fallserie mit 276 Kindern mit Hodentorsion verringerte der Versuch einer manuellen Detorsion das Risiko eines gonadalen Verlusts deutlich. Bei erfolgreicher Entdrehung traten nach elektiver Orchidopexie keine Testisverluste auf.
Aluminiumhydroxide gehören seit nahezu einem Jahrhundert zu den zentralen Adjuvanzien in Kinderimpfstoffen. Trotz ihrer langen Erfolgsgeschichte hinsichtlich Sicherheit und Wirksamkeit geraten sie immer wieder in die öffentliche Diskussion, da sie mit neurologischen Erkrankungen, Allergien und Autoimmunstörungen in Verbindung gebracht werden.
