Background
A wide variety of physiological processes is controlled by sequestering regulatory proteins to specific membrane domains. Derivates of phosphatidyl inositol play a crucial role in this process. The inositol ring can be phosphorylated at the 3
rd, 4
th or 5
th position, resulting in different phosphatidyl inositol phosphates. During the last decades the signal transduction processes mediated by the diverse phosphatidyl inositol phosphates have been deciphered. Phosphatidyl inositol(4,5)-bisphosphate (PI(4,5)P
2) is synthesized by type I (PIPKI) or type II (PIPKII) kinases using either phosphatidyl (4)-phosphate or phosphatidyl (5)-phosphate as a substrate [
1]. PI(4,5)P
2 is an adaptor for several proteins containing a PDZ domain, e.g. phospholipase C (PLC), syntenin and the tight junction protein 1 (ZO-1), and is involved in the regulation of the cytoskeleton [
2], cytokinesis [
3] and in the stabilization and activation of integral membrane proteins such as transporters and ion channels. Furthermore, PI(4,5)P
2 can be either hydrolyzed to the secondary messengers diacylglycerol (DAG) and inositol (1,4,5)-trisphosphate (IP
3), or further phosphorylated by PI3 kinases to phosphatidyl inositol (3,4,5)-trisphosphate (PI(3,4,5)P3), an important activator of the AKT signaling pathway [
4].
A great body of evidence suggests that the oncogenic activation of AKT contributes to cellular transformation and influences tumor development and progression [
5‐
7]. Therefore, AKT is an interesting and promising target for pharmacological intervention [
8]. Several synthetic AKT inhibitors like perifosine, GSK2110183, and RX-0201 entered phase I and II clinical trials. During the last years, synthetic analogs of phosphatidyl inositol phosphates (PIAs) were developed to block AKT activity in tumor cells [
9].
In our study, we used two synthetic phosphatidyl inositol phosphate analogs (SH-5 and SH-6), which lack the hydroxyl group at position three of the inositol ring and display modified aliphatic side chains conferring a higher metabolic stability [
9]. Previous cell culture studies have suggested that the two compounds prevent AKT activation by interfering with its phosphatidyl inositol binding domain and thereby induce apoptosis [
10]. Most of the experiments were done either under moderate serum conditions (5%) or after serum starvation (0.1%) [
11,
12]. To mimic the conditions in tumors exhibiting a high angiogenic activity, resulting in a growth factor-rich micro-milieu, we decided to test the effects of PIAs under standard conditions in the presence of 10% fetal calf serum. We verified the inhibition of AKT in three colorectal cancer cell lines deprived of growth factors, but did not observe a reduction of AKT activity under normal cell culture conditions including fetal calf serum at standard concentration. Despite the missing effects on AKT activity under full supplemented cell culture conditions, we detected a broad range of morphological and transcriptional alterations, indicating that these compounds affect other sub cellular targets too. Most remarkably, both compounds mediated a defect in the abscission, the last step of cytokinesis, in the SW480 cells, resulting in binucleation.
Discussion
Genome-wide expression profiling of inhibitor-treated colorectal cancer cells revealed some unexpected and novel features of two synthetic AKT inhibitors. The most remarkable alteration was the down-regulation of genes associated with mitosis in the SW480 cell line, accompanied by the induction of binucleation. Using confocal laser scanning microscopy and time-lapse recordings, we identified a specific defect during the abscission of the daughter cells as the cause of binucleation. Perturbation studies with pharmacological inhibitors suggested an involvement of PKC signaling in this process.
Expression profiling of treated SW480 cells demonstrated down-regulation of genes associated with mitosis. The effect of this reduced gene expression on cell growth was surprisingly weak, indicating that the remaining expression of most of these genes was sufficient to allow cell cycle progression. In addition, the XTT proliferation assay is based on a metabolic process, in which the tetrazolium salt XTT is cleaved to form soluble colored formazan. It is well established that metabolic activity is highly correlated with the number of cells in the assay (Roche). Since PIA-treated SW480 cells divide until the last step of the abscission, they behave like two cells after re-fusion regarding the metabolic activity. We assume that binucleated cells retain this metabolic activity.
Despite the down-regulation of several genes associated with spindle formation and genes with critical functions during mitosis, we observed no defects in the mitosis until the last step of the abscission. The mitotic spindle is not only implicated in chromosome segregation during mitosis but also affects the crucial steps of cytokinesis. The central spindle complex concentrates key regulators of the cytokinetic machinery, thus providing the basis for the final step of cell division. As spindle assembly, chromosome segregation and cytokinesis require complex protein interactions and possibly critical thresholds of individual components, not necessarily reflected in mRNA levels, the deregulation of mitotic spindle genes might affect cytokinesis without affecting chromosomal segregation.
We validated the down-regulation of ASPM (abnormal spindle homolog, microcephaly associated), NUSAP1 (nucleolar and spindle associated protein 1), PRC1 (protein regulator of cytokinesis 1) and CENPF (centromere protein F (mitosin)) which are all necessary for proper mitotic cell division. The NUSAP1 protein is localized at the central spindle tubules during mitosis and gene silencing by RNA interference resulted in defects of chromosome segregation and cytokinesis [
20,
21]. ASPM is located at the spindle poles or centrosomes during mitosis [
22]. Mutations in ASPM are associated with autosomal recessive microcephaly as a consequence of failures in the chromosome segregation. The knock-down of CENPF with specific siRNA caused defects in metaphase chromosome alignment, anaphase chromosome segregation and cytokinesis [
23]. PRC1 encodes a microtubule bundling protein with an essential function in the formation of the contractile ring in the cleavage furrow and in cytokinesis. The knock-down of PRC1 results in the induction of binucleated cells as a result of defects during abscission [
24,
25]. In contrast to the decreased RNA expression, we detected comparable levels of PRC1 protein in immune fluorescence analysis of treated and control cells, suggesting an additional control at the level of translation or protein stability that might compensate for transcriptional down-regulation. Based on this observation we propose that PRC1 is not the major cause of binucleation in our cell model. Since expression profiling showed down-regulation of multiple mitosis-associated genes it is likely that the binucleation in SW480 cells is a result of a multi-gene effect rather than due to the perturbation of a single gene. The synthetic compounds SH-5 and SH-6 used in our study are thought to work as competitive inhibitors of the naturally occurring phosphatidyl inositol phosphates by sequestering inactive AKT in the cytoplasm and preventing its translocation to the membrane. Therefore it is likely, that the efficiency of these analogs depends on the amount of endogenous PI(4,5)P
2 and PI(3,4,5)P
3. Under normal cell culture conditions a broad range of growth factors stimulate signaling pathways, resulting in an increase of PI(3,4,5)P
3 [
26]. Our experiments suggest that the applied concentrations of SH-5 and SH-6 are not sufficient to inhibit the phosphorylation of AKT efficiently in three colorectal cancer cell lines in this context. However, since both compounds have strong structural similarities to PI(4,5)P
2, they may interact with targets distinct from AKT, e.g. PLC. PLC isoforms are localized to the cleavage furrow and may be involved in the control of the progression through cytokinesis by regulating local PI(4,5)P
2 levels [
17]. Based on the different cellular effects of the specific PLC inhibitor U73122, we conclude that the PIA-induced binucleation is independent on global PLC activity. Nevertheless we cannot exclude the possibility that SH-5 and SH-6 alter the sub cellular localization of PLC during cytokinesis, resulting in a disorganization of the PI(4,5)P
2 dependent signaling.
Gene expression signatures derived from PIA-treated SW480 cells have a high similarity to those observed in MCF7 cells treated with PKC signaling pathway inhibitors. The PKC protein family consists of at least 10 serine/threonine protein kinases which are involved in the control of a wide variety of cellular processes. Activation of PKCs is mediated by diacylglycerol (DAG), Ca
2+ and PDK1, which are influenced by the PI(4,5)P
2 levels [
27]. It was shown that resveratrol inhibits the polyphospho-inositide metabolism in activated platelets resulting in a decrease of the PI(4,5)P
2 level [
28]. We therefore suppose that a similar mechanism contributes to the perturbation of PI(4,5)P
2 levels in SW480 cells, followed by a decreased PKC activity. Rottlerin is a known inhibitor of PKC δ, pointing at a special role of this isoform during cytokinesis in SW480 cells. Interestingly, we recognized a more than two-fold mRNA expression of PKC δ in SW480 cells as compared to the other cell lines. We can speculate that this expression difference may be partially responsible for the different sensitivity of the cell lines to the treatment with the PIAs.
In this context it is also interesting that the response of SW480 cells to long term LY294002 treatment is different compared to the two other cell lines both at the transcriptional and phenotypic level. Whereas the phosphorylation of AKT was strongly inhibited in 2 hours, it was re-phosphorylated within 48 hours. Experiments with conditioned culture medium exclude the possibility that LY294002 decayed during this time. Even after 48 hours the remaining LY294002 in the culture medium was sufficient to block AKT phosphorylation in prior untreated SW480 cells within two hours (data not shown). It is also remarkable that we detected more transcriptional alterations in the SW480 cells as in the two other cell lines. In contrast to SW480 cells, HT29 and the HCT116 harbor an oncogenic mutation in the PIK3CA gene resulting in an increased PI3 kinase activity. This may compensate for the effects caused by SH-5 and SH-6 [
29].
Methods
Cell lines and cell culture
SW480, HT29 and HCT116 cells were cultured in complete L-15 medium at 37°C and 5% CO2 in a humified incubator. Following chemical compounds were used for treament: LY-294002 (20 μM; Alexis Deutschland GmbH, Grünberg, Germany), Wortmannin (1 μM; Sigma) , SH-5 (10 μM; Alexis Deutschland GmbH, Grünberg, Germany), SH-6 (10 μM; Alexis Deutschland GmbH, Grünberg, Germany), U73122 (1, 3 and 10 μM; Merck KGaA, Darmstadt, Germany), Rottlerin and Resveratrol (10 μM and 50 μM, respectively; (Calbiochem) Merck KGaA, Darmstadt, Germany). DMSO served as a negative control unless otherwise specified. The DMSO content of the different experiments was adjusted to a final concentration of 0,29%. Cells were treated for 2 hours, 48 hours or 72 hours.
Immunoblots
Cells were lysed at the corresponding time points using SDS-lysis buffer (1% SDS, 10 mM Tris-HCl pH 7.5, 2 mM EDTA pH 8). 10 μg of protein of whole cell lysates per lane were fractionated by SDS-PAGE and blotted onto nitrocellulose membranes (Schleicher & Schuell Bioscience GmbH, Dassel, Germany). Following primary antibodies were used: AKT (polyclonal, Cell Signaling Technology Inc., Beverly, USA), Phospho-AKT (phospho-Serine 473; polyclonal; Cell Signaling), and beta-actin (Santa Cruz Biotechnology, Inc., Santa Cruz, USA). For protein detection secondary antibodies coupled to horseradish peroxidase (Cell Signaling Technology Inc., Beverly, USA) and ECL (Amersham Biosciences Europe GmbH, Freiburg, Germany) were applied.
Cell proliferation
Cells were treated for 24 hrs, 48 hrs and 72 hrs with the inhibitors or DMSO. Cell proliferation was assessed at the corresponding time points using the colorimetric XTT-assay (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's protocol. The extinction measurements were calculated relative to the negative control at 72 hrs. The means of three independent experiments are presented.
Fluorescence activated cell sorting (FACS)
Both adherent and floating cells were collected after 48 hrs of treatment and washed twice in phosphate-buffered saline, then fixed overnight using 70% ethanol. Following centrifugation the supernatant was discarded and the cell pellet was resuspended in dilution buffer (0.1% Triton X 100, 0.5% BSA in phosphate buffered saline, supplemented with 80 μg/ml RNase (RNase, DNase free; Roche Diagnostics GmbH, Mannheim, Germany)). Samples were kept at room temperature for 30 min. and then centrifuged. The supernatant was discarded and cells were stained with 20 μg/ml propidium iodide (Fluka, Heidelberg, Germany) in dilution buffer. Samples were analysed by flow cytometry (FACS Calibur System; BD Biosciences, Heidelberg, Germany). Fragments of damaged or apoptotic cells were determined as pre-G1 fraction using WinMDI (WinMDI V. 2.8; Joseph Trotter; freeware). All experiments were performed in triplicate.
RNA extraction and purification
Following inhibitor-treatment for 48 hours cells were washed twice with ice-cold phosphate buffered saline supplemented with diethylpyrocarbonate and then lysed using Trizol (Invitrogen). The suspension was transferred to a new tube and chloroform was added at a ratio of 1:6. After mixing thoroughly the suspension was centrifuged for 15 min. at 8°C at 12.000 G. The interphase was transferred to fresh tube and an equivalent amount of isopropanol was added. The suspension was inverted several times. Following 10 min. at room temperature samples were centrifuged for 15 min. at 4°C at 12.000 G. The supernatant was discarded, the pellet washed twice with 75% ice-cold ethanol and then dissolved in RNase free water. RNA extracts were further purified using RNeasy-Kit (Qiagen) according to the manufacturer's clean-up protocol.
Microarray analysis
The human arrays HG-U133A (Affymetrix, Santa Clara, CA, USA) comprised a set of 22,283 known genes. Labelling of RNA targets, hybridization and post-hybridization procedures were performed according to protocols provided by Affymetrix; quality control of RNA extracts was performed using Test-3-Chips (Affymetrix, Santa Clara, CA, USA). Following washing and staining, probe arrays were scanned twice at 3 μm resolution using a confocal scanner with argon laser instrument (Hewlett-Packard, Santa Clara, CA, USA), controlled by Microarray Suite 5.0 software (Affymetrix). Photoemission was detected by a photomultiplier tube through a 570-nm long pass filter. Computer-generated array images were overlaid with a virtual grid controlled by Microarray Suite 5.0 software (Affymetrix, Santa Clara, CA, USA). This step allowed definition of each feature and alignment within known array dimensions. About 40 pixels within each feature were averaged after discarding outliers and pixels near feature boundaries. Gene expression levels were calculated according to the average hybridization intensities of perfectly matched versus mismatched oligonucleotide probes. Arrays were scaled to by Microarray Suite 5.0 software to an average intensity of 2,500 per gene and analyzed independently. Probe sets were either marked absent or present according to their signal intensity and quality of hybridisation. Probe sets which were marked absent in all array experiments were excluded from further analysis. Probe sets which showed at least two fold change in intensity compared to DMSO control were considered up regulated or down regulated respectively.
RT-PCR
Transcript sequences were obtained from NCBI Entrez Nucleotide
http://www.ncbi.nlm.nih.gov/entrez. Primers were designed using primer-3-input
http://frodo.wi.mit.edu/primer3/. Primer sequences were checked for unspecific overlap with other transcripts using NCBI Blast
http://www.ncbi.nlm.nih.gov/BLAST. To identify unwanted amplification of genomic DNA by product size, primers were checked with Ensembl
http://www.ensembl.org/index.html to span introns. Selected primers were synthesized by MWG Biotech (Berlin, Germany). Rt-PCR was performed using Access RT-PCR-Kit (Promega) using 4 ηg of purified RNA. Products were fractioned using agarose gel electrophoresis with ethidiumbromide. Products were analysed under UV-light. Primer sequences and reaction conditions are listed below (see Table
1)
Table 1
Primer sequences and reaction conditions
GAPDH L | 5' - CGACCACTTTGTCAAGCTCA - 3' | 56°C | 205 bp |
GAPDH R | 5'- AGGGGTCTACATGGCAACTG - 3' | 56°C | |
ASPM L | 5' - CAGTGATGTCACAGGGTTGG - 3' | 54°C | 272 bp |
ASPM R | 5' - CTCGTGAAAAAGCCAAAAGG - 3' | 54°C | |
CENPF L | 5' - GCCCATATATCCTGCGAAGA - 3' | 56°C | 258 bp |
CENPF R | 5' - GGCTGTCAGTCGGACTTCTC - 3' | 56°C | |
NUSAP1 L | 5' - TGTGCTTGGGACACACAAAT - 3' | 54°C | 297 bp |
NUSAP1 R | 5' - CGTTTCTTCCGTTGCTCTTC - 3' | 54°C | |
PRC1 L | 5' - ACAAAGGCTTCTAGGCGTGA - 3' | 56°C | 290 bp |
PRC1 R | 5' - GTGGCCACAGCTTCTCTTTC - 3' | 56°C | |
Fluorescence microscopy
Cells were seeded on cover slides and treated with the inhibitors for 48 hrs. Cells were then washed twice with ice-cold phosphate buffered saline and fixed with pre chilled acetone/methanol (1:1) at -20°C. The cells were pre incubated in PBS containing 1.5% horse serum to block non-specific binding of antibodies. The same buffer was used for all incubation steps. We used the following antibodies for staining of the cells: anti-lamin A/C, anti-vimentin, anti-PRC1 and anti-γ-Tubulin (all: Santa Cruz Biotechnology, Inc., Santa Cruz, USA). In order to detect the DNA we included DAPI (Sigma, Germany) in the last incubation step. Bound antibodies and stained DNA were detected using a confocal laser scanning microscope from Leica (DM IRBE). For quantification of binucleation, 200-300 nuclei per sample were counted. Three independent experiments were performed, each counted by at least two independent, blinded investigators and the means are presented.
Time lapse recording
We used the Biozero microscope from Keyence (Neu-Isenburg, Germany) equipped with a time lapse unit. We started 24 hours after adding the PIAs or DMSO to take pictures every 30 seconds. Pictures were aligned to a movie with a frequency of 25 pictures per second using the free software JPGVideo (NDW Ltd., Nottingham, England). Cutting and cropping of the movies were done with the free software VirtualDub 1.8.8.
Statistical analysis
Statistical analysis of the number of binucleated cells was performed using Students t-Test. A p-value < 0.05 was considered significant. For the GO analysis, we used the implemented statistical features of Expander 4.0 with an adjusted p-value < 0.05.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
TK designed and performed experiments, analyzed data and wrote the paper; MT and EH performed experiments; RS conceived the study and wrote the paper, KJ conceived the study, designed and performed experiments, analyzed data, supervised the project and wrote the paper. All authors read and approved the final manuscript.