Zum Inhalt

Chicken as a carrier of emerging virulent Helicobacter species: a potential zoonotic risk

  • Open Access
  • 01.12.2025
  • Research
Erschienen in:

Abstract

Background

The research scope regarding Helicobacter species in chickens, other than H. pullorum, is largely overlooked. This study aimed to investigate the prevalence of emerging Helicobacter species in chickens and the occurrence of the virulence gene cytolethal distending toxin B (cdtB) among the identified Helicobacter species, referring to their public health significance.

Methods

A total of 390 cloacal swabs were collected from 205 broilers and 185 layers. The swabs were pooled into 78 pools. DNA was extracted from these pools, followed by Helicobacter 16S rRNA gene PCR. Twenty pools positive for Helicobacter 16S rRNA were analyzed for H. pylori and H. pullorum, then Helicobacter 16S rRNA sequencing was performed on ten negative pools for H. pullorum and H. pylori to identify Helicobacter species. Subsequently, cdtB was investigated in the 20 pools positive for Helicobacter. Following that, partial DNA sequencing of one H. pullorum and one H. brantae cdtB gene from broiler and layer chickens, respectively, was carried out.

Results

Overall, 25.6% of the examined pools were positive for Helicobacter spp., with 3 (7.3%) and 17 (45.9%) broiler and layer pools being positive, respectively. All three broiler pools were identified as H. pullorum; seven-layer pools were positive for H. pullorum, while H. pylori could not be detected. Helicobacter 16S rRNA sequencing of ten negative layer pools for H. pullorum and H. pylori revealed 6 H. brantae, 2 H. kayseriensis, 1 H. winghamensis, and 1 Helicobacter sp. Tul. The cdtB gene was found in 10 H. pullorum, 5 H. brantae, 1 H. winghamensis, and 1 Helicobacter sp. Tul. Phylogenetic analysis of Helicobacter 16S rRNA sequences and BLAST analysis of H. pullorum and H. brantae cdtB partial sequences underscore the public health importance of the obtained sequences.

Conclusion

This study highlights that the occurrence of emerging virulent Helicobacter species in chicken feces poses a potential zoonotic relevance and public health risk.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Background

Helicobacter is a Gram-negative, microaerophilic, spiral to curve-shaped bacterium isolated from the stomachs of mammals, including humans [1]. Based on phylogenetic analysis and ecological niches, this genus is broadly classified into two major subgroups: Gastric Helicobacter (GH) and Enterohepatic Helicobacter (EHH) species [2]. The most significant among gastric Helicobacter species is Helicobacter pylori (H. pylori), which has received priority attention worldwide due to its association with a variety of illnesses, such as peptic ulcer disease, gastric cancer, type B gastritis [3], and mucosa-associated lymphoid tissue (MALT) lymphoma [4]. The WHO has designated this bacterium as a Class I definite carcinogen [5] due to its significant role in most gastric malignancies. Later, Helicobacter pullorum (H. pullorum), an enterohepatic Helicobacter species [6], emerged and gained significant public health concern [7]. H. pullorum was identified as a new species by Stanley et al. [8] based on 16S rRNA phylogenetic analysis. This organism inhabits the intestinal tract of poultry and has been found in the liver and duodenum of asymptomatic birds, as well as in the liver and cecal contents of broiler chickens and laying hens suffering from vibrionic hepatitis [7, 9, 10]. In poultry slaughterhouses, H. pullorum has been found on chicken carcasses, possibly due to its high concentration in the cecum and subsequent contamination of raw chicken meat during slaughtering and evisceration [11]. Hence, it is considered an emerging foodborne zoonotic pathogen [7, 12]. Moreover, H. pullorum has been isolated from human patients suffering from gastroenteritis [13], chronic liver disorders [14], and even from clinically healthy persons [13].
Subsequently, other Helicobacter species have been recognized in poultry, although they remain beyond the primary research focus. For instance, H. canadensis was isolated from the feces of Barnacle geese (Branta leucopsis) and Canada geese (Branta canadensis) on the Atlantic coast of Europe [15], as well as from diarrheic and bacteremic patients [16, 17]. H. pametensis has been detected in the feces of wild birds [18]. Additionally, Helicobacter anseris (urease-positive) and H. brantae (urease-negative) have been identified in the feces of resident Canada geese in the United States [19]. Notably, several reports indicate that some enterohepatic Helicobacter species, including H. hepaticus, H. bilis, H. cinaedi, and H. pullorum, produce a well-characterized bacterial virulence element, the cytolethal distending toxin (CDT) [2023]. CDT induces edema, cytoskeleton anomalies, and G2/M cycle arrest in host cells [24]. It is responsible for symptoms of infection, such as inflammation [25] and the development of diarrhea [22], and it has a potential role in intestinal carcinogenesis [26].
Although the conventional culture method is regarded as the gold standard test for Helicobacter detection, the delicate and fastidious nature of this pathogen makes it a challenging task [27]. This drives the development of molecular techniques like PCR, which do not rely on living bacteria as culture does and provide rapid and reliable results [2831]. Since the majority of studies have focused on investigating H. pullorum in avian species [6, 911, 3234], and knowledge is scarce regarding other Helicobacter species in poultry, the current study was conducted to investigate the prevalence of emerging Helicobacter species among broiler and layer chicken cloacal swabs, as well as to detect the cdtB virulence gene among the retrieved Helicobacter species to highlight their public health significance.

Methods

Sample collection

A total of 390 cloacal swabs were collected from 205 broilers and 185 layers at commercial poultry farms in Giza, Fayoum, and Qalyubia governorates, Egypt, from March 2023 to October 2023. Both apparently healthy (n = 210) and diseased chickens (n = 180) were included in this study. Each swab was placed in a tube containing 2 mL of normal saline (0.9%) and transported to the laboratory of Microbiology Department, Faculty of Veterinary Medicine, Cairo University, within two hours. Upon arrival, the cloacal swabs were processed in pools, each consisting of five cloacal swabs [35].

DNA extraction

The pooled cloacal swabs were vigorously vortexed, and DNA was extracted from 78 pools using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germany) according to the manufacturer's instructions. All extracted DNAs were stored at -20 °C for further PCR analysis.

Molecular identification of Helicobacter 16S rRNA gene

For genus confirmation through Helicobacter 16S rRNA amplification, the following oligonucleotide primers were used: (F:5-GGCTATGACGGGTATCCGGC-3 & R:5-GCCGTGCAGCACCTGTTTTC-3), as described by Moyaert et al. [36], 5 μL of DNA template was mixed with 12.5 μL of Cosmo PCR RED Master Mix (Willowfort, UK), 1 μL of each primer (10 pmol), and 5.5 μL of nuclease-free water. The PCR reaction was carried out under the following conditions: 95 °C for 5 min, followed by 45 cycles of 95 °C for 30 s, 65 °C for 30 s, 72 °C for 30 s, and a final extension at 72 °C for 10 min.

Molecular detection of H. pullorum and H. pylori

Twenty pools positive for Helicobacter spp. were subjected to polymerase chain reaction using oligonucleotide primers targeting the H. pullorum 16S rRNA gene and the H. pylori phosphoglucosamine mutase gene (glmM) according to the protocol described by Elrais et al. [6]. The PCR conditions for the H. pullorum 16S rRNA gene were as follows: 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 60 °C for 1 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. For the H. pylori glmM gene, the PCR mixture was preheated at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min.

Partial Helicobacter 16S rRNA gene sequencing and phylogenetic analysis

To identify Helicobacter species in ten pools of layer hens positive for Helicobacter 16S rRNA but negative for H. pylori and H. pullorum, partial 16S rRNA sequencing was performed. Amplicons were purified using a QIAquick purification kit (Qiagen, Germany) and sequenced with an ABI 3500 Genetic Analyzer (Applied Biosystems, USA). The recovered Helicobacter sequences in this study were aligned against those retrieved from birds, humans, and the environment available on the GenBank database to understand the genetic relatedness of our sequences. ClustalW multiple alignment was conducted using BioEdit software version 7.0.9, while MEGA 7 software was used to construct a phylogenetic tree via a neighbor-joining approach where a bootstrap consensus tree was obtained with 500 replicates (Fig. 1).
Fig. 1
A phylogenetic bootstrap consensus tree was inferred via a neighbor-joining approach using MEGA 7 software to show the evolutionary history and genetic relatedness between Helicobacter 16S rRNA partial sequences obtained in this study and Helicobacter strains retrieved from the GenBank records
Bild vergrößern

Nucleotide sequence accession numbers

The partial Helicobacter 16S rRNA sequences generated in this study from layer chickens were Helicobacter brantae (accession no. PP390176, PP391029, PP391658, PP391550, PP814627, and PP814629), Helicobacter kayseriensis (accession no. PP392689 and PP397169), Helicobacter winghamensis (accession no. PP814592), and Helicobacter sp. TUL (accession no. PP401975).

Molecular investigation of virulence gene cytolethal distending toxin B (cdtB) among Helicobacter species

Twenty positive pools for Helicobacter spp. were investigated for cytolethal distending toxin B (cdtB) as previously reported by Laharie et al. [37]. The primer sequence was F1: GTCTTTTGAGTGGATTGGATTCT and R2: CACTCCGGGTGCTTGTGTAT. Briefly, a 25 μL reaction mixture was created for each sample by adding 12.5 μL of COSMO PCR RED Master Mix (Willowfort, UK), 1 μL (10 pmols) of each primer, 5 μL of DNA template and 5.5 μL of PCR-grade water. The PCR thermal profile was as follows: 5 min initial denaturation at 94 °C, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 60 s, and extension at 72 °C for 30 s, with a final extension at 72 °C for 10 min. The amplified amplicons were photographed after electrophoresis in 0.5 Tris–borate-EDTA using 1.5% agarose gel stained with ethidium bromide solution, where specific bands were detected at 148 bp (Fig. 2).
Fig. 2
PCR amplification of the cdtB virulence gene in Helicobacter species. Lane M: DNA ladder (100 bp); lane 1: negative control; lanes 2, 3, 4, and 5: positive samples showed specific bands at 148 bp
Bild vergrößern

Partial DNA sequencing of Helicobacter cdtB virulence gene

The PCR products of one H. pullorum and one H. brantae cdtB gene obtained from broiler and layer chickens, respectively, were purified via a QIAquick purification kit (Qiagen, Hilden, Germany). Afterwards, sequencing was carried out using Big Dye Terminator V3.1 kit (Thermo Fisher, USA) in an ABI 3500 Genetic Analyzer (Applied Biosystems, USA).

Nucleotide sequence accession numbers

Partial sequences of the H. brantae and H. pullorum cdtB gene were submitted to GenBank and deposited in the GenBank database with the following accession numbers: PP486371 for H. pullorum cdtB from broilers and PP486372 for H. brantae cdtB from layers.

Sequence identity BLAST analysis

The obtained H. pullorum and H. brantae cdtB partial sequences from broilers and layers, respectively, were compared with H. pullorum cdtB strains isolated from human cases available on GenBank using the NCBI website via BLAST analysis to display the identity percentage between our sequences and those of humans to clarify the public health impact of such sequences.

Statistical analysis

The modified Wald method was used to calculate the 95% confidence interval (CI) of an overall prevalence value using the GraphPad QuickCalc online tool. The chi-square (χ2) test was utilized to evaluate the correlation between the examined chickens' clinical status and Helicobacter's prevalence using IBM SPSS Statistics for Windows, software version 29.0.2.0 (Armonk, NY: IBM Corp). The result was considered statistically significant when the p-value was less than 0.05.

Results

Prevalence of Helicobacter spp. among the examined chickens

Overall, Helicobacter spp. was detected in 20 out of 78 examined pools (25.6%; 95% CI 17.19–36.38), where 7.3% and 45.9% of the investigated broilers and layers were positive, respectively (Table 1). Regarding the clinical status of the examined chickens, Helicobacter spp. was found in 18 (42.9%) apparently healthy and 2 (5.6%) diseased chickens, as shown in Table 2. The difference in the prevalence of Helicobacter among apparently healthy and diseased chickens was significant (p-value = 0.000169).
Table 1
Prevalence of Helicobacter spp. among broiler and layer chickens
Chicken species
No. of examined pools
Positive pools
 
  
No
%
Layers
37
17
45.9
Broilers
41
3
7.3
Total
78
20
25.6
Table 2
Prevalence of Helicobacter spp. among apparently healthy and diseased chickens
Chicken  clinical status
No. of examined pools
Positive pools
 
  
No
%
Apparently healthy
42
18
42.9
Diseased
36
2
5.6
Total
78
20
25.6

Prevalence of H. pylori and H. pullorum among the examined chickens

H. pullorum was found in 10 (12.8%) out of 78 examined pools where all three pools of broilers (3/41; 7.3%) were identified as H. pullorum and seven pools of layers (7/37; 18.9%) were positive for H. pullorum, whereas H. pylori could not be recognized among the examined broilers and layers in this study.

Prevalence of Helicobacter species other than H. pullorum in layer chickens

The partial 16S rRNA sequencing of 10 pools of layers positive for Helicobacter 16S rRNA but negative for H. pylori and H. pullorum revealed Helicobacter brantae (n = 6; 16.2%), Helicobacter kayseriensis (n = 2; 5.4%), Helicobacter winghamensis (n = 1; 2.7%), and Helicobacter sp. TUL (n = 1; 2.7%), as shown in Table 3.
Table 3
Prevalence of Helicobacter species other than H. pullorum in layer chickens
Chicken species
No. of examined pools
 
Helicobacter spp.
  
Total
  
H. brantae
H. kayseriensis
H. winghamensis
Helicobacter sp. TUL
 
Layers
37
6 (16.2%)
2 (5.4%)
1 (2.7%)
1 (2.7%)
10 (27%)

Phylogenetic analysis of partial Helicobacter 16S rRNA sequences

The phylogenetic analysis exhibited that Helicobacter spp. 16S rRNA sequences retrieved from layer hens in this study were closely related to Helicobacter strains isolated from wild birds as well as there was a genetic relationship between our sequences and those obtained from humans and the environment (Fig. 1).

The distribution of cdtB virulence gene among Helicobacter species

Regarding H. pullorum, seven from apparently healthy layers and three from broilers (one and two from apparently healthy and diseased chickens, respectively) were positive for cdtB gene. For H. brantae, cdtB could be found in five H. brantae from apparently healthy layers. In addition, one H. winghamensisand one Helicobacter sp. Tul from apparently healthy layers carried cdtB, whereas two H. kayseriensis from apparently healthy layer hens were negative for cdtB, as exhibited in Table 4.
Table 4
The distribution of the cytolethal distending toxin B (cdtB) virulence gene among the obtained Helicobacter species
Helicobacter species
Number
Chicken species
Clinical status
cdtB
H. pullorum
7
Layers
Apparently healthy
 + ve
H. pullorum
1
Broilers
Apparently healthy
 + ve
H. pullorum
2
Broilers
Diseased
 + ve
H. brantae
5
Layers
Apparently healthy
 + ve
H. brantae
1
Layers
Apparently healthy
 − ve
H.kayseriensis
2
Layers
Apparently healthy
 − ve
H. winghamensis
1
Layers
Apparently healthy
 + ve
Helicobacter sp. Tul
1
Layers
Apparently healthy
 + ve

Sequence identity BLAST analysis

The similarity ratios between the obtained cdtB sequences of H. pullorum and H. brantae of broilers and layers, respectively, in the current study and those of H. pullorum cdtB of public health significance as determined by BLAST analysis are displayed in Table 5.
Table 5
The identity percentage between the obtained Helicobacter cdtB partial sequences in this study and H. pullorum cdtB strains deposited in the GenBank of public health significance
Sequence
GenBank ID
Isolation source
% identity
PP486371 H. pullorum cdtB sequence, broiler chickens
JX434699.1
Patients with gastroenteritis
99.07
H. pullorum cdtB sequence, broiler chickens
JX434696.1
Patients with gastroenteritis
99.07
 
AY394475.1
Liver of patient with cirrhotic
Hepatitis C and without hepatocellular carcinoma
99.07
PP486372
H. brantae cdtB sequence, layer chickens
JX434699.1
Patients with gastroenteritis
98.68
 
JX434698.1
Patients with gastroenteritis
98.68
 
JX434697.1
Immunodeficient patient with diarrhea
99.48

Discussion

Currently, understanding the epidemiological aspects of zoonotic Helicobacter species is a subject of great interest among researchers and scholars worldwide [7, 3840]. In the present study, the prevalence of Helicobacter species 16S rRNA in cloacal swabs from the examined chickens (25.6%) was higher than that reported by Elrais et al. [6] (12%) in chicken meat in Egypt and García-Amado et al. [41] (5%) in the feces of wild birds in Venezuela, but lower than that detected by Fox et al. [19] (40.2%) in the feces of resident Canada geese in the Greater Boston region. Notably, Helicobacter spp. was found in apparently healthy chickens at a higher prevalence than in diseased ones. There was a significant difference between the two groups, suggesting that apparently healthy chickens may serve as a potential reservoir for Helicobacter species, raising public health concerns.
Regarding H. pylori, all broilers and layers in this study were negative for H. pylori. However, Elrais et al. [6] detected H. pylori in 300 broiler chicken samples (meat and giblets) with a prevalence rate of 5.33% (16/300) and El Dairouty et al. [42] revealed that 5% (1/20) of raw poultry meat samples were positive for H. pylori. Almashhadany et al. [43] found that 18 (13.8%) of 260 raw chicken meat samples tested positive for H. pylori, with 11 (15.7%) and 7 (11.7%) from the thigh and breast, respectively, while Asadi et al. [44] identified H. pylori in raw chicken meat samples at a rate of 15%. In the study conducted by Hamada et al. [45], 7 (7.78%) of 90 chicken samples were positive for H. pylori, including 6.67% of chicken meat and gizzards and 10% of liver. The detection of H. pylori in chicken meat in previous studies might be attributed to contamination by the hands of butchers, veterinarians, and abattoir workers during handling, preparation, and packaging, as well as the use of unclean water for washing chicken carcasses [6]. This could explain why H. pylori was not identified in cloacal swabs from the examined chickens in the present study.
For Helicobacter pullorum, the overall prevalence in the examined chickens was 12.8%. Our findings were higher than those of Hassan et al. [46], who detected H. pullorum in 7% (21 out of 300) of chicken cloacal swabs. Many studies have focused on investigating H. pullorum in chicken meat, breast, thigh, liver, ceca, and wings [6, 911, 4648] rather than cloacal swabs. For instance, H. pullorum was detected in 32.29% and 10.15% of broiler chicken caeca and colon, respectively, in Turkey [49]; in caeca (7.5%), liver (5%) and thigh (2.5%) of broiler chickens with gastroenteritis in Aradabil [50]; and in 41% of broiler chicken caeca in Iran [10]. H. pullorum was also identified in the cecum, colon, jejunum, and liver of broiler chickens in Belgium with a prevalence of 33.6%, 31.8%, 10.9%, and 4.6%, respectively [9]; 24.72% of broiler and village chickens in Malaysia [51]; 23.52% of chicken meat in Lisbon [11]; and 30% of tested chicken wings in Iran [52]. Furthermore, the commercial chicken eggs are also believed to be infected with this pathogen [7]. In Egypt, H. pullorum was isolated from the examined baladi hen’s eggshells and egg contents in a percentage of 3.33% for each [53], as well as 10% and 5% of Baladi and poultry farm hen’s eggshells were contaminated with H. pullorum, respectively [54]. The occurrence of H. pullorum in cloacal swabs suggests that this pathogen may be transmitted to chicken carcasses via cross-contamination during the slaughtering process [7], and hens' feces may spread H. pullorum to eggs [54]. As H. pullorum is directly transmitted to humans through fecal contamination [8], poultry excreta represent a potential source of infection to various human populations, particularly slaughterhouse workers, farmers, and housewives [7]. It was noted that the prevalence of H. pullorum was higher in layers (18.9%) than in broilers (7.3%) in this study, whereas a study conducted in Iran found a higher occurrence in broilers (30%) compared to laying hens (13.3%) [55]. From a public health perspective, H. pullorum is an emerging zoonotic pathogen responsible for life-threatening human infections [12]. It has been detected in stool samples from human patients suffering from gastroenteritis, with a prevalence of 6% in Aradabil [50], as well as in the feces from patients with gastrointestinal disease (4.3%) and clinically healthy individuals (4.0%) in Belgium [13]. Furthermore, H. pullorum is associated with recurrent diarrheal illness [56] and it is implicated in cholelithiasis, cirrhosis [14], and gallbladder cancers [57, 58]. This association is attributed to the pathogen's ability to tolerate high bile stress [12]. Additionally, it has been recognized in patients with Crohn's disease [37, 59].
In the current work, partial Helicobacter 16S rRNA gene sequencing revealed other Helicobacter species in layer chickens. H. brantae was the most prevalent species identified in cloacal swabs of layers (16.2%), followed by H. kayseriensis (5.4%), H. winghamensis (2.7%), and Helicobacter sp. TUL (2.7%). To the best of our knowledge, H. brantae, H. kayseriensis, H. winghamensis, and Helicobacter sp. TUL were detected for the first time in layer chickens in this study. Regarding H. brantae, Kaakoush et al. [60] found this species in 64.5% of broiler chicken fecal samples. This urease-negative Helicobacter species was first identified in the feces of seven resident Canada geese within the Greater Boston area [19], and it was detected at a low incidence in tropical terrestrial wild birds in Venezuela [41]. Although the pathogenesis of this bacterium remains unclear, the occurrence of H. brantae in chickens may pose a zoonotic risk, potentially infecting other species of birds and mammals [19]. H. kayseriensis was recognized by Aydin et al. [61] in the feces of urban wild birds in Turkey. Moreover, H. kayseriensis was the most common species (28.57%) isolated from Taiwan's Yanshui and Donggang rivers [2]. H. winghamensis was first discovered in patients with gastroenteritis in Canada, displaying a morphology similar to Campylobacter [62]. Also, it was recovered from wild rodents in China [63] and dogs in Taiwan [28]. Concerning Helicobacter sp. TUL, it is closely related to Helicobacter equorum and classified as an enterohepatic Helicobacter species. This novel species was named after its discovery in a febrile patient with a bloodstream infection in Caesarodunum (Tours, France) [64]. Accordingly, chicken feces may constitute an essential medium for transmitting emerging Helicobacter spp. where fecal droppings can directly or indirectly infect humans through water contamination. Water is a significant vehicle for the dissemination of Helicobacter species [2, 65], and this pathogen can persist in various environments, including soil [66, 67], raising concerns about cross-contamination between birds and the environment. Moreover, wild birds exposed to poultry excreta may transmit Helicobacter spp. [15, 41, 61, 68] to other birds, water sources, and new environments. In the meantime, phylogenetic analysis of the obtained Helicobacter sequences from layer hens in this study showed two distinct clusters. The first cluster demonstrated that H. brantae (PP390176), H. kayseriensis (PP397169), and Helicobacter sp. TUL (PP401975) sequences retrieved in this study were closely related to each other, implying that these Helicobacter spp. share a similar relationship. Furthermore, these sequences were grouped with those isolated from human cases (gastroenteritis and bloodstream infection) and environmental samples (wastewater and drinking water). In the second cluster, H. brantae (PP391550) was similar to H. brantae obtained from the feces of a resident Canada goose in the United States. H. kayseriensis (PP392689) exhibited a genetic relatedness to H. kayseriensis isolated from the feces of wild birds in Turkey. Additionally, H. winghamensis and H. brantae (PP814592 and PP814629, respectively) were grouped in the same clade and showed close relationship with Helicobacter sp. recovered from wild birds in Venezuela. These findings suggest that these Helicobacter spp. may spread from chickens to wild birds, humans, and the environment. Consequently, a comprehensive understanding of the transmission routes of Helicobacter infection can promote One Health approaches and facilitate the development of effective preventive strategies. The prevention and control strategies for Helicobacter spp., particularly H. pullorum, were based on the implementation of biosecurity measures in poultry farms and increasing the resistance of chickens to colonization by introducing organic acid additives to drinking water and/or feed. In addition, improved hygienic measures are required during the transport of live birds, slaughtering, and dressing of carcasses, as carcass contamination may occur through fecal matter spillage or cross-contamination [69]. Control measures should be established to reduce human exposure by minimizing the contamination of chicken meat along the food chain. Furthermore, monitoring and surveillance data would be highly crucial to mitigate the risk of Helicobacter infection through the implementation of One Health policies, especially in developing countries [7].
Investigation of the cdtB virulence gene among the Helicobacter species retrieved from broilers and layers in this work showed that it was present in 10 H. pullorum, 5 H. brantae, 1 H. winghamensis, and 1 Helicobacter sp. TUL; however, none of H. kayseriensis had cdtB. The cdtB gene appears to be the most conserved gene amongst all cdt genes in terms of differences between bacterial species [70]. For instance, Ceelen et al. [71] and Qumar et al. [33] detected cdtB in all H. pullorum strains obtained from poultry, while Mohamed et al. [72] observed cdtB in H. pullorum isolates from clinically healthy and diseased chickens at a prevalence rate of 32.9% and 67%, respectively. Yet, there is limited data regarding the occurrence of this virulence gene in H. brantae, H. winghamensis, H. kayseriensis, and Helicobacter sp. TUL, which requires further study. The cdtB is an important virulence factor that induces edema, cytoskeletal anomalies, and G2/M cycle arrest in the host cell. It causes cellular and nuclear enlargement, accompanied by profound remodelling of the actin cytoskeleton, resulting in the formation of large actin-rich cortical lamellipodia and membrane ruffle structures. Furthermore, disturbance of focal adhesion and the microtubule network were also observed. These effects may have significant consequences on bacterial adhesion and intestinal barrier integrity [22, 25]. The presence of cdtB in H. pullorum may play a significant role in various complications associated with human infections, such as gastroenteritis [22] and Crohn's disease [37]. Moreover, previous reports have shown that chronic infection by CDT-producing H. pullorum might lead to malignant transformation and cancer [73]. Detailed explanations of cdtB pathogenesis, interaction with its natural host, and factors contributing to the expression of Helicobacter cdtB remain unclear [21, 22, 74]. The findings of experimental infection carried out by Pratt et al. [75] suggested that CDT expression may reflect a bacterial adaptation that influences the interaction between the pathogen and the host immune system. CDT has been shown to induce apoptosis in primary human peripheral blood mononuclear cells and cultured T-cell lines [76, 77]. In addition to its direct effect on T cells, CDT may be able to interfere with immune responses via interfering with antigen-presenting cells [75]. Moreover, the bacterial adaptation of CDT production allows long-term persistence within the mammalian host and modifies the development of host immunity, resulting in specific immune responses which fail to clear the organism. In a host with an altered immune system, this modification of the specific immune response leads to the development of dysregulated immunity and colitis [75]. In this study, we provided partial sequences of H. brantae and H. pullorum cdtB from layer and broiler chickens, respectively, where these sequences exhibited a high identity percentage (98.68%-99.07%) to H. pullorum cdtB strains isolated from patients suffering from gastroenteritis, diarrhea, and liver cirrhosis, highlighting the public health significance of such sequences.

Conclusion

The occurrence of emerging virulent Helicobacter species in broiler and layer chickens highlights the potential zoonotic role of chickens as a reservoir of Helicobacter infection, which raises a public health concern. Establishing zoonotic links of Helicobacter spp. requires a variety of ways to determine how this pathogen can be transmitted between animals and humans. There are several important methods to identify zoonotic links, including molecular and genetic analysis such as multi-locus sequence typing and whole genome sequencing; epidemiological studies like cross-sectional studies, case–control studies, surveys of animal populations, and risk factor analysis. In addition, experimental animal models should not be ruled out. When these methods are combined, they can provide compelling evidence of zoonotic linkages of Helicobacter species since the findings of these studies help to improve our understanding of the transmission dynamics and potential public health risks posed by these bacteria. From a One Health perspective, the interconnection between human, animal, and environmental health sectors is crucial, necessitating continuous monitoring and surveillance of Helicobacter infections to mitigate their public health threat.

Acknowledgements

Not applicable.

Declarations

The protocol of this study was approved by the ethical committee of the Faculty of Veterinary Medicine, Cairo University, Egypt (Vet CU 18042024890). All methods were performed in accordance with the relevant guidelines and regulations.
Not applicable.

Competing interests

The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Download
Titel
Chicken as a carrier of emerging virulent Helicobacter species: a potential zoonotic risk
Verfasst von
Ahmed Samir
Hala M. Zaher
Publikationsdatum
01.12.2025
Verlag
BioMed Central
Erschienen in
Gut Pathogens / Ausgabe 1/2025
Elektronische ISSN: 1757-4749
DOI
https://doi.org/10.1186/s13099-025-00707-2
1.
Zurück zum Zitat Fox JG. The non-H pylori helicobacters: their expanding role in gastrointestinal and systemic diseases. Gut. 2002;50:273–83. https://doi.org/10.1136/gut.50.2.273.CrossRefPubMedPubMedCentral
2.
Zurück zum Zitat Cao XD, Huang YL, Chen JS, Liao CS. Molecular surveillance of Helicobacter species with high prevalence from two streams with various wastewater pollution in Taiwan. One Health. 2024;18: 100757. https://doi.org/10.1016/j.onehlt.2024.100757.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Zhang S, Moise L, Moss SFH. pylori vaccines: why we still don’t have any. Hum Vaccin. 2011;7:1153–7. https://doi.org/10.4161/hv.7.11.17655.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Kennemann L, Didelot X, Aebischer T, Kuhn S, Drescher B, Droege M, et al. Helicobacter pylori genome evolution during human infection. Proc Natl Acad Sci U S A. 2011;108:5033–8. https://doi.org/10.1073/pnas.1018444108.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Alfarouk KO, Bashir AHH, Aljarbou AN, Ramadan AM, Muddathir AK, AlHoufie STS, et al. The possible role of Helicobacter pylori in gastric cancer and its management. Front Oncol. 2019;9:75. https://doi.org/10.3389/fonc.2019.00075.CrossRefPubMedPubMedCentral
6.
Zurück zum Zitat Elrais AM, Arab WS, Sallam KI, Elmegid WA, Elgendy F, Elmonir W, et al. Prevalence, virulence genes, phylogenetic analysis, and antimicrobial resistance profile of Helicobacter species in chicken meat and their associated environment at retail shops in Egypt. Foods. 2022;11:1890. https://doi.org/10.3390/foods11131890.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Akhlaghi H, Javan AJ, Chashmi SHE. Public health significance of Helicobacter pullorum, a putative food-associated emerging zoonotic pathogen in Iran. Comp Immunol Microbiol Infect Dis. 2022;87: 101849. https://doi.org/10.1016/j.cimid.2022.101849.CrossRefPubMed
8.
Zurück zum Zitat Stanley J, Linton D, Burnens AP, Dewhirst FE, On SL, Porter A, et al. Helicobacter pullorum sp. nov.-genotype and phenotype of a new species isolated from poultry and from human patients with gastroenteritis. Microbiology. 1994;140:3441–9. https://doi.org/10.1099/13500872-140-12-3441.CrossRefPubMed
9.
Zurück zum Zitat Ceelen LM, Decostere A, Van den Bulck K, On SL, Baele M, Ducatelle R, et al. Helicobacter pullorum in chickens, Belgium. Emerg Infect Dis. 2006;12:263–7. https://doi.org/10.3201/eid1202.050847.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Jamshidi A, Bassami MR, Salami H, Mohammadi S. Isolation and identification of Helicobacter pullorum from caecal content of broiler chickens in Mashhad, Iran. Iran J Vet Res. 2014;15:179–82. https://doi.org/10.22099/ijvr.2014.2369.CrossRef
11.
Zurück zum Zitat Borges V, Santos A, Correia CB, Saraiva M, Ménard A, Vieira L, et al. Helicobacter pullorum isolated from fresh chicken meat: antibiotic resistance and genomic traits of an emerging foodborne pathogen. Appl Environ Microbiol. 2015;81:8155–63. https://doi.org/10.1128/AEM.02394-15.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Javed S, Gul F, Javed K, Bokhari H. Helicobacter pullorum: an emerging zoonotic pathogen. Front Microbiol. 2017;8:604. https://doi.org/10.3389/fmicb.2017.00604.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Ceelen L, Decostere A, Verschraegen G, Ducatelle R, Haesebrouck F. Prevalence of Helicobacter pullorum among patients with gastrointestinal disease and clinically healthy persons. J Clin Microbiol. 2005;43:2984–6. https://doi.org/10.1128/JCM.43.6.2984-2986.2005.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Ponzetto A, Pellicano R, Leone N, Cutufia MA, Turrini F, Grigioni WF, et al. Helicobacter infection and cirrhosis in hepatitis C virus carriage: is it an innocent bystander or a troublemaker? Med Hypotheses. 2000;54:275–7. https://doi.org/10.1054/mehy.1999.0987.CrossRefPubMed
15.
Zurück zum Zitat Waldenström J, On SL, Ottvall R, Hasselquist D, Harrington CS, Olsen B. Avian reservoirs and zoonotic potential of the emerging human pathogen Helicobacter canadensis. Appl Environ Microbiol. 2003;69:7523–6. https://doi.org/10.1128/AEM.69.12.7523-7526.2003.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Fox JG, Chien CC, Dewhirst FE, Paster BJ, Shen Z, Melito PL, et al. Helicobacter canadensis sp. Nov. isolated from humans with diarrhea as an example of an emerging pathogen. J Clin Microbiol. 2000;38:2546–9. https://doi.org/10.1128/JCM.38.7.2546-2549.2000.CrossRefPubMedPubMedCentral
17.
Zurück zum Zitat Tee W, Montgomery J, Dyall-Smith M. Bacteremia caused by a Helicobacter pullorum-like organism. Clin Infect Dis. 2001;33:1789–91. https://doi.org/10.1086/323983.CrossRefPubMed
18.
Zurück zum Zitat Dewhirst FE, Seymour C, Fraser GJ, Paster BJ, Fox JG. Phylogeny of Helicobacter isolates from bird and swine feces and description of Helicobacter pametensis sp. nov. Int J Syst Bacteriol. 1994;44:553–60. https://doi.org/10.1099/00207713-44-3-553.CrossRefPubMed
19.
Zurück zum Zitat Fox JG, Taylor NS, Howe S, Tidd M, Xu S, Paster BJ, et al. Helicobacter anseris sp. Nov. and Helicobacter brantae sp. Nov., isolated from feces of resident Canada geese in the greater Boston area. Appl Environ Microbiol. 2006;72:4633–7. https://doi.org/10.1128/AEM.02876-05.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Chien CC, Taylor NS, Ge Z, Schauer DB, Young VB, Fox JG. Identification of cdtB homologues and cytolethal distending toxin activity in enterohepatic Helicobacter spp. J Med Microbiol. 2000;49:525–34. https://doi.org/10.1099/0022-1317-49-6-525.CrossRefPubMed
21.
Zurück zum Zitat Young VB, Knox KA, Schauer DB. Cytolethal distending toxin sequence and activity in the enterohepatic pathogen Helicobacter hepaticus. Infect Immun. 2000;68:184–91. https://doi.org/10.1128/IAI.68.1.184-191.2000.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Young VB, Chie CC, Knox KA, Taylor NS, Schauer DB, Fox JG. Cytolethal distending toxin in avian and human isolates of Helicobacter pullorum. J Infect Dis. 2000;182:620–3. https://doi.org/10.1086/315705.CrossRefPubMed
23.
Zurück zum Zitat Taylor NS, Ge Z, Shen Z, Dewhirst FE, Fox JG. Cytolethal distending toxin: a potential virulence factor for Helicobacter cinaedi. J Infect Dis. 2003;188:1892–7. https://doi.org/10.1086/379837.CrossRefPubMed
24.
Zurück zum Zitat Péré-Védrenne C, Prochazkova-Carlotti M, Rousseau B, He W, Chambonnier L, Sifré E, et al. The cytolethal distending toxin subunit CdtB of Helicobacter hepaticus promotes senescence and endoreplication in xenograft mouse models of hepatic and intestinal cell lines. Front Cell Infect Microbiol. 2017;7:268. https://doi.org/10.3389/fcimb.2017.00268.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Varon C, Mocan I, Mihi B, Péré-Védrenne C, Aboubacar A, Moraté C, et al. Helicobacter pullorum cytolethal distending toxin targets vinculin and cortactin and triggers formation of lamellipodia in intestinal epithelial cells. J Infect Dis. 2014;209:588–99. https://doi.org/10.1093/infdis/jit539.CrossRefPubMed
26.
Zurück zum Zitat Ge Z, Feng Y, Ge L, Parry N, Muthupalani S, Fox JG. Helicobacter hepaticus cytolethal distending toxin promotes intestinal carcinogenesis in 129Rag2-deficient mice. Cell Microbiol. 2017. https://doi.org/10.1111/cmi.12728.10.1111/cmi.12728.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Wang YK, Kuo FC, Liu CJ, Wu MC, Shih HY, Wang SS, et al. Diagnosis of Helicobacter pylori infection: current options and developments. World J Gastroenterol. 2015;21(40):11221–35. https://doi.org/10.3748/wjg.v21.i40.11221.CrossRefPubMedPubMedCentral
28.
Zurück zum Zitat Ashaolu JO, Tsai YJ, Liu CC, Ji DD. Prevalence, diversity and public health implications of Helicobacter species in pet and stray dogs. One Health. 2022;15: 100430. https://doi.org/10.1016/j.onehlt.2022.100430.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Fernandez-Caso B, Miqueleiz A, Valdez VB, Alarcón T. Are molecular methods helpful for the diagnosis of Helicobacter pylori infection and for the prediction of its antimicrobial resistance? Front Microbiol. 2022;13: 962063. https://doi.org/10.3389/fmicb.2022.962063.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Sulo P, Šipková B. DNA diagnostics for reliable and universal identification of Helicobacter pylori. World J Gastroenterol. 2021;27(41):7100–12. https://doi.org/10.3748/wjg.v27.i41.7100.CrossRefPubMedPubMedCentral
31.
Zurück zum Zitat Contreras M, Mujica H, Garca-Amado MA. Molecular tools of antibiotic resistance for Helicobacter pylori: an overview in Latin America. Front Gastroenterol. 2024;3:1410816. https://doi.org/10.3389/fgstr.2024.1410816.CrossRef
32.
Zurück zum Zitat Zanoni RG, Rossi M, Giacomucci D, Sanguinetti V, Manfreda G. Occurrence and antibiotic susceptibility of Helicobacter pullorum from broiler chickens and commercial laying hens in Italy. Int J Food Microbiol. 2007;116:168–73. https://doi.org/10.1016/j.ijfoodmicro.2006.12.007.CrossRefPubMed
33.
Zurück zum Zitat Qumar S, Majid M, Kumar N, Tiwari SK, Semmler T, Devi S, et al. Genome dynamics and molecular infection epidemiology of multidrug-resistant Helicobacter pullorum isolates obtained from broiler and free-range chickens in India. Appl Environ Microbiol. 2016;83:e02305-e2316. https://doi.org/10.1128/AEM.02305-16.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat Zanoni R, Piva S, Rossi M, Pasquali F, Lucchi A, De Cesare A, et al. Occurrence of Helicobacter pullorum in turkeys. Vet Microbiol. 2011;149:492–6. https://doi.org/10.1016/j.vetmic.2010.11.013.CrossRefPubMed
35.
Zurück zum Zitat Germeraad EA, Elbers ARW, de Bruijn ND, Heutink R, van Voorst W, Hakze-van der Honing R, et al. Detection of low pathogenic avian influenza virus subtype H10N7 in poultry and environmental water samples during a clinical outbreak in commercial free-range layers, Netherlands 2017. Front Vet Sci. 2020;7:237. https://doi.org/10.3389/fvets.2020.00237.CrossRefPubMedPubMedCentral
36.
Zurück zum Zitat Moyaert H, Pasmans F, Ducatelle R, Haesebrouck F, Baele M. Evaluation of 16S rRNA gene-based PCR assays for genus-level identification of Helicobacter species. J Clin Microbiol. 2008;46:1867–9. https://doi.org/10.1128/JCM.00139-08.CrossRefPubMedPubMedCentral
37.
Zurück zum Zitat Laharie D, Asencio C, Asselineau J, Bulois P, Bourreille A, Moreau J, et al. Association between entero-hepatic Helicobacter species and Crohn’s disease: a prospective cross-sectional study. Aliment Pharmacol Ther. 2009;30:283–93. https://doi.org/10.1111/j.1365-2036.2009.04034.x.CrossRefPubMed
38.
Zurück zum Zitat Mladenova-Hristova I, Grekova O, Patel A. Zoonotic potential of Helicobacter spp. J Microbiol Immunol Infect. 2017;50:265–9. https://doi.org/10.1016/j.jmii.2016.11.003.CrossRefPubMed
39.
Zurück zum Zitat Ochoa S, Collado L. Enterohepatic Helicobacter species: clinical importance, host range, and zoonotic potential. Crit Rev Microbiol. 2021;47:728–61. https://doi.org/10.1080/1040841X.2021.1924117.CrossRefPubMed
40.
Zurück zum Zitat Akhlaghi H, Javan AJ, Chashmi SHE. Helicobacter pullorum and Helicobacter canadensis: etiology, pathogenicity, epidemiology, identification, and antibiotic resistance implicating food and public health. Int J Food Microbiol. 2024;413: 110573. https://doi.org/10.1016/j.ijfoodmicro.2024.110573.CrossRefPubMed
41.
Zurück zum Zitat García-Amado MA, Sanz V, Martinez LM, Contreras M, Lentino M, Michelangeli F. Low occurrence of Helicobacter DNA in tropical wild birds, Venezuela. J Wildl Dis. 2013;49:991–5. https://doi.org/10.7589/2012-09-222.CrossRefPubMed
42.
Zurück zum Zitat El Dairouty R, Murad H, El Shenawy M, Hosny I, Okda A, El Shamy S. Helicobacter pylori and its interrelations with other foodborne pathogenic bacteria in Egyptian meat and some meat products. Curr Sci Int. 2016;5:139–46.
43.
Zurück zum Zitat Almashhadany DA, Mayas SM, Ali NL. Isolation and identification of Helicobacter pylori from raw chicken meat in Dhamar Governorate, Yemen. Ital J Food Saf. 2022;11:10220. https://doi.org/10.4081/ijfs.2022.10220.CrossRefPubMedPubMedCentral
44.
Zurück zum Zitat Asadi S, Rahimi E, Shakerian A. Helicobacter pylori strains isolated from raw poultry meat in the Shahrekord Region, Iran: frequency and molecular characteristics. Genes (Basel). 2023;14:1006. https://doi.org/10.3390/genes14051006.CrossRefPubMed
45.
Zurück zum Zitat Hamada M, Elbehiry A, Marzouk E, Moussa IM, Hessain AM, Alhaji JH, et al. Helicobacter pylori in a poultry slaughterhouse: prevalence, genotyping and antibiotic resistance pattern. Saudi J Biol Sci. 2018;25:1072–8. https://doi.org/10.1016/j.sjbs.2018.02.002.CrossRefPubMedPubMedCentral
46.
Zurück zum Zitat Hassan A, Shahata M, Refaie E, Ibrahim R. Detection and identification of Helicobacter pullorum in poultry species in upper Egypt. J Adv Vet Res. 2014;4:42–8.
47.
Zurück zum Zitat Akhlaghi H, Emadi Chashmi SH, Jebelli Javan A. Isolation and antibiotic resistance of Helicobacter pullorum from chicken wings using the culture method and a molecular technique. J Nutr Fast Health. 2021;9:306–11. https://doi.org/10.22038/JNFH.2021.60986.1358.CrossRef
48.
Zurück zum Zitat Jebellijavan A, Emadi Chashmi SH, Staji H, Akhlaghi H. A comparison of culture and PCR method to determine the prevalence and antibiotic resistance of Helicobacter pullorum isolated from chicken thigh samples in Semnan, Iran. J Hum Environ Health Promot. 2020;6:167–72. https://doi.org/10.29252/jhehp.6.4.3.CrossRef
49.
Zurück zum Zitat Beren KB, Seyyal AK. Investigation of Helicobacter pullorum occurence in chicken in the Marmara Region of Turkey. Istanbul Üniv Veteriner Fakultesi Dergisi. 2013;39:63–6.
50.
Zurück zum Zitat Shahram B, Javadi A, Mahdi GR. Helicobacter pullorum prevalence in patients with gastroenteritis in humans and chicken in the province of Ardabil in 2014. Indian J Fundam Appl Life Sci. 2015;5:87–94.
51.
Zurück zum Zitat Wai S, Saleha A, Zunita Z, Hassan L, Jalila A. Occurrence of co-infection of Helicobacter pullorum and Campylobacter spp. in Broiler and Village (Indigenous) Chickens. Pak Vet J. 2012;32:503–6.
52.
Zurück zum Zitat Akhlaghi H, Chashmi SHE, Jebelli AJ. Isolation and antibiotic resistance of Helicobacter pullorum from chicken wings. J Nutr Fasting Health. 2021;9:306–11.
53.
Zurück zum Zitat Ezzat AKM, Khalil MM, Mohamed SN, Mohamed NHM. Occurrence of Helicobacter species with special priority to H pylori in hen’s eggs. Assiut Vet Med J. 1999;64:22–30. https://doi.org/10.21608/avmj.2018.168944.CrossRef
54.
Zurück zum Zitat Abdel Hameed KJ, Sender G. Prevalence of Helicobacter pullorum in Egyptian hen’s eggs and in vitro susceptibility to different antimicrobial agents. Anim Sci Papers Rep. 2011;29:257–64.
55.
Zurück zum Zitat Akhlaghi H, Chashmi SHE, Javan AJ. Prevalence and antibiotic resistance of Helicobacter pullorum isolates in poultry from Semnan province. Iran Int J Enteric Pathog. 2020;8:101–6. https://doi.org/10.34172/ijep.2020.22.CrossRef
56.
Zurück zum Zitat Steinbrueckner B, Haerter G, Pelz K, Weiner S, Rump JA, Deissler W, et al. Isolation of Helicobacter pullorum from patients with enteritis. Scand J Infect Dis. 1997;29:315–8. https://doi.org/10.3109/00365549709019053.CrossRefPubMed
57.
Zurück zum Zitat Fox JG, Dewhirst FE, Shen Z, Feng Y, Taylor NS, Paster BJ, et al. Hepatic Helicobacter species identified in bile and gallbladder tissue from Chileans with chronic cholecystitis. Gastroenterology. 1998;114:755–63. https://doi.org/10.1016/s0016-5085(98)70589-x.CrossRefPubMed
58.
Zurück zum Zitat Karagin PH, Stenram U, Wadström T, Ljungh A. Helicobacter species and common gut bacterial DNA in gallbladder with cholecystitis. World J Gastroenterol. 2010;16:4817–22. https://doi.org/10.3748/wjg.v16.i38.4817.CrossRefPubMedPubMedCentral
59.
Zurück zum Zitat Bohr UR, Glasbrenner B, Primus A, Zagoura A, Wex T, Malfertheiner P. Identification of enterohepatic Helicobacter species in patients suffering from inflammatory bowel disease. J Clin Microbiol. 2004;42:2766–8. https://doi.org/10.1128/JCM.42.6.2766-2768.2004.CrossRefPubMedPubMedCentral
60.
Zurück zum Zitat Kaakoush NO, Sodhi N, Chenu JW, Cox JM, Riordan SM, Mitchell HM. The interplay between Campylobacter and Helicobacter species and other gastrointestinal microbiota of commercial broiler chickens. Gut Pathog. 2014;6:18. https://doi.org/10.1186/1757-4749-6-18.CrossRefPubMedPubMedCentral
61.
Zurück zum Zitat Aydin F, Saticioglu IB, Ay H, Kayman T, Karakaya E, Abay S. Corrigendum to "Description of the two novel species of the genus Helicobacter: Helicobacter anatolicus sp. nov., and Helicobacter kayseriensis sp. nov., isolated from feces of urban wild birds”. Syst Appl Microbiol. 2022;45:126326. https://doi.org/10.1016/j.syapm.2022.126357.CrossRefPubMed
62.
Zurück zum Zitat Melito PL, Munro C, Chipman PR, Woodward DL, Booth TF, Rodgers FG. Helicobacter winghamensis sp. Nov., a novel Helicobacter sp. isolated from patients with gastroenteritis. J Clin Microbiol. 2001;39:2412–7. https://doi.org/10.1128/JCM.39.7.2412-2417.2001.CrossRefPubMedPubMedCentral
63.
Zurück zum Zitat Goto K, Jiang W, Zheng Q, Oku Y, Kamiya H, Itoh T, et al. Epidemiology of Helicobacter infection in wild rodents in the Xinjiang-Uygur autonomous region of China. Curr Microbiol. 2004;49:221–3. https://doi.org/10.1007/s00284-004-4287-6.CrossRefPubMed
64.
Zurück zum Zitat van der Mee-Marquet NL, Bénéjat L, Diene SM, Lemaignen A, Gaïa N, Smet A, et al. A potential new human pathogen belonging to Helicobacter genus, identified in a bloodstream infection. Front Microbiol. 2017;8:2533. https://doi.org/10.3389/fmicb.2017.02533.CrossRefPubMedPubMedCentral
65.
Zurück zum Zitat Gomes BC, De Martinis ECP. The significance of Helicobacter pylori in water, food and environmental samples. Food Control. 2004;15:397–403. https://doi.org/10.1016/S0956-7135(03)00106-3.CrossRef
66.
Zurück zum Zitat Pérez LM, Codony F, López Leyton D, Fittipaldi M, Adrados B, Morató J. Quantification of Helicobacter pylori levels in soil samples from public playgrounds in Spain. J Zhejiang Univ Sci B. 2010;11:27–9. https://doi.org/10.1631/jzus.B0900238.CrossRefPubMedPubMedCentral
67.
Zurück zum Zitat Wai SS, Abdul-Aziz S, Bitrus AA, Zunita Z, Abu J. Helicobacter pullorum in broiler chickens and the farm environment: a one health approach. Int J One Health. 2019;5:20–5. https://doi.org/10.14202/IJOH.2019.20-25.CrossRef
68.
Zurück zum Zitat Elhelw R, Elhariri M, Salem HM, Khalefa HS, Hamza DA, Ahmed ZS. Molecular screening of gastric Helicobacter pullorum recovered from different avian species in Egypt. Pol J Vet Sci. 2022;25:369–74. https://doi.org/10.24425/pjvs.2022.142019.CrossRefPubMed
69.
Zurück zum Zitat Quaglia NC, Capuozzo F, Ioanna F, De Rosa M, Dambrosio A. Occurrence of Helicobacter pullorum in retail chicken meat: a one-health approach to consumer health protection. Foods. 2024;13:845. https://doi.org/10.3390/foods13060845.CrossRefPubMedPubMedCentral
70.
Zurück zum Zitat Ceelen LM, Decostere A, Ducatelle R, Haesebrouck F. Cytolethal distending toxin generates cell death by inducing a bottleneck in the cell cycle. Microbiol Res. 2006;161:109–20. https://doi.org/10.1016/j.micres.2005.04.002.CrossRefPubMed
71.
Zurück zum Zitat Ceelen LM, Haesebrouck F, Favoreel H, Ducatelle R, Decostere A. The cytolethal distending toxin among Helicobacter pullorum strains from human and poultry origin. Vet Microbiol. 2006;113:45–53. https://doi.org/10.1016/j.vetmic.2005.10.020.CrossRefPubMed
72.
Zurück zum Zitat Mohamed MA, Ibrahim RS, Shahata MA, El-Refaie EM. Helicobacter pullorum among poultry in Assiut-Egypt: genetic characterization, virulence and MIC. Int J Poult Sci. 2010;9:521–6.CrossRef
73.
Zurück zum Zitat Rocha M, Avenaud P, Ménard A, Le Bail B, Balabaud C, Bioulac-Sage P. Association of Helicobacter species with hepatitis C cirrhosis with or without hepatocellular carcinoma. Gut. 2005;54:396–401. https://doi.org/10.1136/gut.2004.042168.CrossRefPubMedPubMedCentral
74.
Zurück zum Zitat Wang T, Meng X, Qian M, Jin S, Bao R, Zhu L, et al. Helicobacter hepaticus CdtB triggers colonic mucosal barrier disruption in mice via epithelial tight junction impairment mediated by MLCK/pMLC2 signaling pathway. Vet Sci. 2025;12:174. https://doi.org/10.3390/vetsci12020174.CrossRefPubMedPubMedCentral
75.
Zurück zum Zitat Pratt JS, Sachen KL, Wood HD, Eaton KA, Young VB. Modulation of host immune responses by the cytolethal distending toxin of Helicobacter hepaticus. Infect Immun. 2006;74:496–504. https://doi.org/10.1128/IAI.00503-06.CrossRef
76.
Zurück zum Zitat Sato T, Koseki T, Yamato K, Saiki K, Konishi K, Yoshikawa M, et al. p53-independent expression of p21(CIP1/WAF1) in plasmacytic cells during G (2) cell cycle arrest induced by Actinobacillus actinomycetemcomitans cytolethal distending toxin. Infect Immun. 2002;70:528–34. https://doi.org/10.1128/IAI.70.2.528-534.2002.CrossRefPubMedPubMedCentral
77.
Zurück zum Zitat Ohara M, Hayashi T, Kusunoki Y, Miyauchi M, Takata T, Sugai M. Caspase-2 and caspase-7 are involved in cytolethal distending toxin-induced apoptosis in Jurkat and MOLT-4 T-cell lines. Infect Immun. 2004;72:871–9. https://doi.org/10.1128/IAI.72.2.871-879.2004.CrossRefPubMedPubMedCentral

Kompaktes Leitlinien-Wissen Innere Medizin (Link öffnet in neuem Fenster)

Mit medbee Pocketcards schnell und sicher entscheiden.
Leitlinien-Wissen kostenlos und immer griffbereit auf ihrem Desktop, Handy oder Tablet.

Neu im Fachgebiet Innere Medizin

Lipoprotein(a) erhöht bei Statintherapie: Wie steht es um das kardiovaskuläre Risiko?

Wann ist das Lipoprotein(a) zu hoch? Diese Frage stellte sich ein deutsches Forschungsteam – und analysierte die Risiken durch Lp(a) bei Patienten, die bereits Statine einnehmen.

Adipositas und Vorhofflimmern: Wie hängen sie zusammen?

Adipositas begünstigt die Entstehung von Vorhofflimmern. Die Frage ist, inwieweit dabei direkte oder indirekte, über Begleiterkrankungen vermittelte Effekte im Spiel sind. In einer beim DGK-Kongress vorgestellten Studie wurde versucht, das zu klären.

Mehr als eine Hydrozele

Starke Schmerzen im rechten Hoden führen einen 37-jährigen Mann in die urologische Praxis. An ein Trauma kann sich der Fitnesstrainer nicht erinnern. Es gibt auch keine Hinweise auf eine Harnwegsinfektion, Harnsteine oder eine sexuell übertragbare Erkrankung. Was ist Ihre Verdachtsdiagnose?

Podcast

Warum wir mehr Peritonealdialysen durchführen sollten

Die Peritonealdialyse wird in Deutschland noch selten genutzt, bietet aber unterschätzte Vorteile: mehr Selbstbestimmung, mehr Lebensqualität, schonender für den Kreislauf. Warum wird sie trotzdem so wenig eingesetzt? Expertin Dr. Grit Esser erklärt, was hinter der Bauchfelldialyse steckt, wie Betroffene informierte Entscheidungen treffen können und worauf Hausärztinnen und Hausärzte achten sollten.

Zeitschrift für Allgemeinmedizin, DEGAM

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

Bildnachweise
Die Leitlinien für Ärztinnen und Ärzte, Ärztin misst Blutdruck bei adipöser Frau/© DG PhotoStock / stock.adobe.com (Symbolbild mit Fotomodellen), Hoden an einem Schaubild /© Mathias Ernert/ Urologische Klinik/ Universitätsklinikum Mannheim (Symbolbild mit Fotomodellen), ZFA TALKS - Peritonealdialyse/© (M) Jakovo / Getty Images / iStock (Symbolbild mit Fotomodell) Logo: Springer Medizin Verlag GmbH