Circular RNA_LARP4 inhibits cell proliferation and invasion of gastric cancer by sponging miR-424-5p and regulating LATS1 expression

The clinical and pathological data of 387 cases of GC patients and 41 adjacent normal tissues as well as the relative expression levels of LATS1 and miRNAs (has-miR-16-5p, has-miR-15a-5p, has-miR-15b-5p, has-miR-590-3p and has-miR-424-5p) were downloaded from The Cancer Genome Atlas 2015 RNA sequencing database (http://​xena.​ucsc.​edu/​getting-started/​). The human tissue microarray of 80 paired GC patients (Cat No. STC1602) was purchased from the shanghai Superbiotek Pharmaceutical Technology Co., Ltd. (Shanghai, PR, China). The protocols used in our study were approved by the Ethics Committee of Shanghai Jiao Tong University Affiliated Sixth People’s Hospital. The GC patients’ specimens were classified according to the 2004 WHO criteria and TNM staging system, and clinicopathological characteristics of GC patients from TCGA and tissue microarray were shown in Additional file 1: Table S1–2.

We identified the miRNAs that target LATS1 gene in cancer by using the StarBase v2.0 (http://​starbase.​sysu.​edu.​cn) and the strict screening conditions including two prediction algorithms (Pctar and miRanda), very high stringency (>5) and being expressed in at least three cancer types were limited to predict the miRNAs targeting LATS1 gene.

Normal human gastric epithelial cell line GES-1 and GC cell lines (SGC-7901, MKN-45, MKN-28, HGC-27, MGC-803, AGS, BGC-823) were from Digestive Disease Laboratory of Shanghai Sixth People’s Hospital. Cells were cultured in Dulbecco’s Modified Eagle medium (DMEM) medium supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/ml of penicillin, and 100 μg/ml of streptomycin (HyClone). Cells in this medium were placed in a humidified atmosphere containing 5% CO₂ at 37 °C. All cells were used for study within 6 months.

Total RNA was extracted using TRIzol and reverse transcription was performed using M-MLV and cDNA amplification using the SYBR Green Master Mix kit (Takara, Otsu, Japan). In addition, total RNA was isolated using a High Pure miRNA isolation kit (Roche) and RT-PCR using a TaqMan MicroRNA Reverse Transcription kit (Life Technologies). The nuclear and cytoplasmic fractions were isolated using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific). The primers were listed in Additional file 1: Table S3.

HGC-27 and MKN-28 cells were harvested and extracted using lysis buffer (100 mM Tris-HCl, 2% SDS, 1 mM Mercaptoethanol, 25% Glycerol). Cell extracts were boiled in loading buffer and equal amount of cell extracts were separated on 15% SDS-PAGE gels. Separated protein bands were transferred into polyvinylidene fluoride (PVDF) membranes. The primary antibodies-anti-LATS1 (ab70561, Rabbit polyclonal antibody, Abcam, Cambridge, MA, USA), anti-YAP (ab52771, Rabbit monoclonal antibody, Abcam, Cambridge, MA, USA), anti-p-YAP (S127) (ab76252, Rabbit monoclonal antibody, Abcam, Cambridge, MA, USA) and anti-GAPDH (ab153802, Rabbit polyclonal antibody, Abcam, Cambridge, MA, USA) were diluted at a ratio of 1:1000 according to the instructions and incubated overnight at 4 °C. Horseradish peroxidase-linked secondary antibodies were added at a dilution ratio of 1:10,000, and incubated at room temperature for 1 h. The membranes were washed with PBS for three times and the immunoreactive bands were visualized using ECL-PLUS/Kit (GE Healthcare, Piscataway, NJ, USA) according to the kit’s instruction.

HGC-27 and MKN-28 cells were seeded into 96-well plates and were co-transfected with a mixture of 60 ng of firefly luciferase reporter, 6 ng of pRL-CMV Renilla luciferase reporter, and miR-424 mimic or inhibitor. After 48 h of incubation, the firefly and Renilla luciferase activities were measured with a dual-luciferase reporter assay (Promega, Madison, WI, USA).

Plasmid mediated LATS1 or circLARP4 overexpression vector, siRNA targeting LATS1 or circLARP4 vector, miR-424 mimic and inhibitor were purchased from Genechem (Shanghai, PR, China) and an empty vector used as a control. The siRNA sequences were shown as below, si-LATS1: ATCCTCGACGAGAGCAGA and si-circLARP4: GGGCAGGCTCCCTTTCCCAAT. HGC-27 and MKN-28 cells were planted in 6-well plates 24 h prior to si-LATS1, si-circLARP4, miR-424 mimic or inhibitor transfection with 50–60% confluence, and then were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacture instructions.

Cell viability and Transwell assays were performed as previously described [11].

HGC-27 and MKN-28 cells were trypsinized, and 1 × 10³ cells were plated in 6-well plates and incubated at 37 °C for 7 days. Colonies were dyed with dyeing solution containing 0.1% crystal violet and 20% methanol. Cell colonies were then counted and analyzed.

Total RNA from three GC and adjacent normal tissues was quantified using the NanoDrop ND-1000. The sample preparation and microarray hybridization were performed based on the Arraystar’s standard protocols. Briefly, total RNAs were digested with RNase R to eliminate linear RNAs and enrich circular RNAs. Then, the enriched circular RNAs were amplified and transcribed into fluorescent cRNA utilizing a random priming method (Arraystar Super RNA Labeling Kit; Arraystar). The labeled cRNAs were hybridized onto the Arraystar Human circRNA Array (8x15K, Arraystar). After having washed the slides, the arrays were scanned by the Agilent Scanner G2505C.

Transcription was prevented by the addition of 2 mg/ml Actinomycin D or DMSO (Sigma-Aldrich, St. Louis, MO, USA) as the negative control. Total RNA (2 μg) was incubated for 30 min at 37 °Cwith 3 U/μg of RNase R (Epicentre Technologies, Madison, WI, USA). After treatment with Actinomycin D and RNase R, the RNA expression levels of LARP4 and circLARP4 were detected by qRT-PCR.

The EdU assay was carried out with a Cell-Light EdU DNA Cell Proliferation Kit (RiboBio, Shanghai, PR, China). 1 × 10⁴ cells were seeded in 96-well plate. After incubation with 50 mM EdU for 2 h, the cells were fixed in 4% paraformaldehyde and stained with Apollo Dye Solution. Hoechst-33,342 was used to stain the nucleic acid within the cells. Images were acquired with an Olympus FSX100 microscope (Olympus, Tokyo, Japan), and the percentage of EdU-positive cells was calculated.

RIP assay was carried out by using a Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) according to the manufacturer’s instructions. Antibodies for RIP assays against AGO2 and IgG were purchased from Abcam (ab5072, Rabbit polyclonal antibody, Cambridge, MA, USA).

Oligonucleotide modified probe sequence for human circLARP4 (CCATTGGGAAAGGGAGCCTGCCCTACCATAGTCC) was applied for FISH. First, the probe of circLARP4 was marked with DIG-UTP (Roche, 11,209,256,910) for RNA labeling. The cell suspension was pipetted onto autoclaved glass slides, which were washed with PBS and fixed in 4% paraformaldehyde. After dehydration with 70, 95 and 100% ethanol, hybridization was carried out at 37 °C overnight in a dark moist chamber. After hybridization, slides were washed three times in 50% 60 ml formamide/2X SSC for 5 min, and was incubated with anti-DIG-HRP(PerkinElmer, NEF832001EA)at 4 °C overnight, After being washed for 3 times for 10 min at room temperature, the slides were incubated with TSA fluorescent signal reaction solution(PerkinElmer, NEL701001KT, TSA Fluorescein system)for 30 min and was sealed with tablets containing DAPI. The images were acquired using a fluorescence microscopy (Leica, SP8 laser confocal microscopy). The analysis software Image-pro plus 6.0 (Media Cybernetics, Inc., Rockville, MD, USA) was applied to acquire the Immunofluorescence Accumulation Optical Density (IOD) for evaluating the expression level of circLARP4 in GC tissues.

Statistical analyses were carried out by using SPSS 20.0 (IBM, SPSS, Chicago, IL, USA) and GraphPad Prism. Student’s t-test or Chi-square test was used to assess the statistical significance for comparisons of two groups. The Pearson’s correlation coefficient analysis was used to analyze the correlations. Overall survival (OS) was defined as the interval between the dates of surgery and death and OS and disease-free survival (DFS or recurrence) curves were analyzed with the Kaplane-Meier method and log-rank test. Univariate analysis and multivariate models were performed by using a Cox proportional hazards regression model. Receiver operating characteristic (ROC) curves were obtained using cutoff finder online software (http://​molpath.​charite. de/cutoff/load.jsp). P < 0.05 was considered statistically significant.

Our previous studies showed that LATS1 is downregulated in GC compared with the pair-matched normal tissues [11]. We further validated a decreased expression of LAST1 in human gastric adenocarcinoma (GAC) tissues (n = 387) and adjacent normal tissues (n = 41) as well as in paired GAC tissues (n = 41) by using The Cancer Genome Atlas (TCGA) sequencing data (Fig. 1a). To dissect the molecular mechanism of LATS1 downregulation in GC, we first assessed the genetic or epigenetic dysregulation of LATS1 in GC. But, we discovered little evidence regarding the dysregulation of LATS1 at the genetic (Additional file 2: Figure S1a and b) and methylation levels (Additional file 2: Figure S1c), suggesting that genetic alterations (amplification, deletion, mutation and copy number deletion) and methylation modification were not the main cause of the downregulation of LATS1 in GC. Numerous studies show that miRNAs exhibit a pivotal role in GC development by repressing the expression of their target genes [14], indicating that LATS1 might be regulated by miRNAs in GC. Then, we utilized the StarBase v2.0, Pictar and miRanda software to forecast the potential miRNAs that target LATS1 gene 3′ UTR, and identified 5 miRNAs that could bind to LATS1 gene 3′ UTR with very high stringency (Fig. 1b). Furthermore, we investigated the expression levels of these miRNAs in GAC, which were highly expressed in GAC (n = 387) compared with adjacent normal tissues (n = 41) as well as in paired GAC (n = 41) (Fig. 1c1–5). The correlation analysis showed that, except for the has-miR-15b-5p (Additional file 2: Figure S1d), the other miRNAs displayed the negative correlation with LATS1 expression, of which miR-424-5p (miR-424) had the strongest correlation with LATS1 expression (r = −0.2598, P < 0.0001) and was selected for further observation.

To evaluate whether the expression levels of LATS1 and miR-424 were associated with clinical and pathological characteristics and prognosis of GC patients, as shown in Fig. 2a, based on the cutoff values of LATS1 and miR-424, which were obtained according to their expression levels, OS time and OS status in GAC tissues, the 315 GAC patients were divided into two groups: LATS1 high expression and LATS1 low expression or miR-424 high expression and miR-424 low expression. Receiver operating characteristic (ROC) curve and area under curve (AUC) were determined to assess the sensitivity and specificity of the survival prediction. The sensitivity, specificity and AUC of LATS1 were 37.1%, 75.7% and 0.54 and those of miR-424 were 25.7%, 90.2% and 0.52, indicating that LATS1 and miR-424 might be the potential biomarkers for OS of GAC patients.

As indicated in Additional file 1: Table S4, LATS1 low expression or miR-424 high expression was positively correlated with pathological stage (P = 0.004; P = 0.036), but harbored no association with other clinical parameters (P > 0.05). Kaplan Meier analysis illustrated that GAC patients with LATS1 low expression or miR-424 high expression developed more frequent recurrence (Fig. 2b and c), but had no significant difference in OS compared with the patients with LATS1 high expression or miR-424 low expression (Additional file 3: Figure S2a and b). According to the pathological stage, the patients of early stage (stage I + II) or late stage (stage III + IV) with miR-424 high expression possessed the higher recurrence rate compared with those with miR-424 low expression (Fig. 2d), but the patients of early stage (stage I + II) or late stage (stage III + IV) with LATS1 low expression had no obvious difference in tumor recurrence compared with those with LATS1 high expression (Additional file 3: Figure S2c). To define whether LATS1 or miR-424 expression was independent of other risk factors related to the recurrence of GAC, multivariate analyses were performed by using a Cox proportional hazard model. As shown in Additional file 1: Table S5, 6, in the univariate analysis, gender, LATS1 low expression and miR-424 expression were associated with recurrence of GC patients, but in the final multivariate Cox regression model, it was miR-424 not LATS1 expression that represented an independent prognostic factor for recurrence of GAC.

Furthermore, by using the online bioinformatics tool Kaplan-Meier plotter [28], we found that GC patients with LATS1 low expression developed poorer survival (Fig. 2e) and more frequent recurrence (Fig. 2g). In addition, the patients of stage I or stage III with LATS1 low expression had poorer survival (Fig. 2f) and those of stage I or stage IV harbored higher recurrence (Fig. 2h) compared with those with LATS1 high expression, but the patients with LATS1 low expression had no significant difference in OS for stage II or stage IV (Additional file 3: Figure S2d) and in recurrence for stage II or stage III (Additional file 3: Figure S2e) compared with those with LATS1 high expression.

Having confirmed the negative correlation of miR-424 with LATS1 expression in GC tissues, we were curious about whether LATS1 was a target gene of miR-424 in GC cells. We first utilized the mirPath v.3 software to verify whether miR-424 was related with LATS1 signaling pathway. Consequently, KEGG enrichment analysis demonstrated that miR-424 was principally enriched by Hippo signaling pathway in which LATS1 was a nuclear member (Fig. 3a). Then, we examined the expression levels of miR-424 and LATS1 in GC cell lines by qRT-PCR, which demonstrated that LATS1 had lower expression, while miR-424 exhibited higher expression and negative correlation with LATS1 expression in all GC cell lines compared with the GES-1, of which MKN-28 cell line had the relatively higher miR-424 expression level but HGC-27 cell line had the relatively lower miR-424 expression level (Fig. 3b). Thus, miR-424 mimic (60 μM) and miR-424 inhibitor (80 μM) were respectively transfected into HGC-27 cells with miR-424 low expression and MKN-28 cells with miR-424 high expression. After transfection for 48 h, qRT-PCR and western blot analysis displayed substantially increased expression of miR-424 and decreased expression of LATS1 in miR-424 mimic group in HGC-27 cells (Fig. 3c), and indicated noticeably decreased expression of miR-424 and increased expression of LATS1 in miR-424 inhibitor group in MKN-28 cells (Fig. 3d). Luciferase reporter vectors containing the wild type or mutant LATS1 3’UTR (Fig. 3e) and miR-424 mimic or inhibitor were co-transfected into HGC-27 or MKN-28 cells. Intriguingly, the luciferase activity of wild type LATS1 3’UTR evidently decreased in miR-424 mimic group in HGC-27 cells (Fig. 3f), but increased in miR-424 inhibitor group in MKN-28 cells compared with the NC group (Fig. 3g). However, the luciferase activity of mutant LATS1 3’UTR had no difference between miR-424 mimic or inhibitor group and NC group.

To further observe the effects of miR-424 on LATS1 expression in GC cells, we performed the functional experiments such as MTT, cell colony formation and Transwell assays. First, the expression level of LATS1 was examined after transfection with miR-424 mimic and (or) LATS1 in HGC-27 cells, and miR-424 inhibitor and (or) sh-LATS1 in MKN-28 cells indicated by qRT-PCR (Additional file 4: Figure S3a). Then, the promoting effects of miR-424 mimic on cell proliferation (Fig. 4a), colony formation (Fig. 4c) and invasive potential (Fig. 4e) were reversed by co-transfection of LATS1 overexpression vector in HGC-27 cells, but the inhibitory effects of miR-424 inhibitor on cell proliferation (Fig. 4b), colony formation (Fig. 4d) and invasive potential (Fig. 4f) were rescued by co-transfection of LATS1 shRNA vector in MKN-28 cells. These results suggested that miR-424 might promote GC growth and invasion by targeting LATS1 gene.

Mounting evidence shows that circRNAs as a novel type of ncRNAs sponge miRNAs, regulate gene transcription and interact with RBPs involved in tumorigenesis [20, 21]. To identify the circRNAs that sponge miR-424 in GC, we applied the circRNA expression profile and circBase and microRNA.​org software to screen out 30 circRNAs that could sponge and bind to the miR-424 (Fig. 5a, Additional file 1: Table S7). Given the upregulation of miR-424 in GC, 15 circRNAs that were downregulated in GC were selected for further analysis (Fig. 5a, Additional file 1: Table S7). According to the restrictive conditions (P < 0.001, Fold change > 2), among 15 circRNAs, only has_circ_101057 conformed to this requirement (Additional file 1: Table S7). We noted that circ_101057 (chr12:50,848,096–50,855,130, Fig. 5b) is derived from exon 9, 10 regions within La ribonucleoprotein domain family member 4 (LARP4) locus, which is located on chromosome 12q13.12. We termed circ_101057 as circLARP4, whose genomic sequence is 7034 nt and spliced mature sequence length is 317 nt. The genomic position reveals that the ninth and tenth exons from the LARP4 gene are intermediated by long introns (Fig. 5b). According to the qRT-PCR analysis, compared with the linear LARP4, circLARP4 gave rise to resistance to digestion induced by RNase R exonuclease, indicating that circLARP4 harbors a loop structure (Fig. 5c). We next observed the stability and localization of circLARP4. After treatment with Actinomycin D, an inhibitor of transcription at the indicated time points, total RNA was separated from HGC-27 and MKN-28 cells. As a result, qRT-PCR analysis showed that the transcript half-life of circLRP4 exceeded 24 h, while that of linear LARP4 displayed about 6 h in HGC-27 and MKN-28 cells (Fig. 5d), indicating that circLARP4 is highly stable in GC cells.

Cytoplasmic and nuclear RNA analysis by qRT-PCR showed that circLARP4 was preferentially localized in the cytoplasm in HGC-27 and MKN-28 cells (Fig. 5e). Furthermore, we utilized FISH to assess circLARP4 expression level and localization in GC tissue cells, and found that circLARP4 had low expression in GC tissues compared with the adjacent normal (Fig. 5f) and the green fluorescent distribution position indicated that circLARP4 was mainly localized in the cytoplasm of both GC and normal tissue cells (Fig. 5g). Collectively, these results suggest that circLARP4 is a highly stable and cytoplasmic circRNA derived from the LARP4 gene locus.

The special characteristics of circLARP4 spurred our interest in assessing the biological functions of circLARP4 in GC cells. We first detected the expression level of circLARP4 in GC cell lines by qRT-PCR and found circLARP4 was downregulated in GC cell lines compared with GES-1 cells but had no correlation with the expression of miR-424 and LATS1 in GC cells (Additional file 4: Figure S3b). Then, we designed the circLARP4 overexpression and interference sequences against the back-splicing sequence of circLARP4 (Fig. 6a). After circLARP4 overexpression or siRNA vector was respectively transfected into HGC-27 and MKN-28 cells for 48 h, their transfection efficiency was determined as shown in Fig. 6b. Subsequent cell proliferation and colony formation assays revealed that ectopic expression of circLARP4 inhibited cell growth and colony-forming capacity of GC cells, while knockdown of circLARP4 reversed these effects (Additional file 4: Figure S3c, d). EdU incorporation assay showed that the proliferation of HGC-27 cells was impaired by transfection with circLARP4 overexpression vector, but was strengthened by knockdown of circLARP4 (Fig. 6c). Transwell invasion assay demonstrated that cell invasive potential was weakened by circLARP4 overexpression, but was enhanced by knockdown of circLARP4 (Fig. 6d). Taken together, these results imply that that circLARP4 may be a tumor suppressive factor in GC cells.

Given that circRNAs can act as miRNAs sponge and circLARP4 is stable in the cytoplasm, we first applied the ComiR prediction tool as well as the circLARP4 genomic sequence to predict 5 miRNAs that have the potential to bind to circLARP4 (Fig. 7a and Additional file 5: Figure S4a). We constructed a circLARP4 fragment and incorporated it into downstream of the luciferase reporter gene, and hypothesized that circLARP4 related 5 miRNAs could reduce the luciferase activity of circLARP4. We then carried out a luciferase assay using these 5 miRNAs. The luciferase reporter vector for pMIR-Luc-circLARP4 was co-transfected with each miRNA mimic into HEK-293 T cells. Compared with the negative control (NC), miR-424 lowered the luciferase reporter activity by approximately 75% (Fig. 7b), indicating that miR-424 might have the greater potential to bind to circLARP4 compared with other 4 miRNAs. Afterwards, we examined the mutual regulation between circLARP4 and miR-424 by qRT-PCR analysis, which showed that circLARP4 overexpression reduced the expression level of miR-424 in HCG-27 cells, while circLARP4 knockdown increased the expression level of miR-424 in MKN-28 cells (Fig. 7c1), but miR-424 mimic or inhibitor had no influence on the expression of circLARP4 (Additional file 5: Figure S4b). Luciferase reporter vectors containing the wild type or mutant circLARP4 (Additional file 5: Figure S4c) and miR-424 mimic were co-transfected into HGC-27 and MKN-28 cells. Interestingly, the luciferase activity of wild type circLARP4 significantly decreased in miR-424 mimic group in HGC-27 cells and increased in miR-424 inhibitor group in MKN-28 cells, compared with their NC group (Fig. 7c2). However, the luciferase activity of mutant circLARP4 had no difference between miR-424 group and NC group in these two cell lines. Moreover, the luciferase activity of wild type LATS1 3’UTR was decreased by miR-424 mimic but increased by co-transfection with miR-424 mimic and circLARP4 in HGC-27 cells (Additional file 5: Figure S4e), while the luciferase activity of wild type LATS1 3’UTR was increased by miR-424 inhibitor but decreased by co-transfection with miR-424 inhibitor and si-circLARP4 in MKN-28 cells (Additional file 5: Figure S4f). However, the luciferase activity of mutant LATS1 had no difference between NC, miR-424 and co-transfection groups (Additional file 5: Figure S4e, f).

Furthermore, we used the online circular RNA interactome to reveal a high degree of AGO2 occupancy in the region of circLARP4 (Additional file 1: Table S8). To confirm this result, we performed RNA immunoprecipitation (RIP) for AGO2 in HGC-27 and MKN-28 cells and investigated the expression level of endogenous circLARP4 and miR-424 pulled-down from AGO2-expressed cells by qRT-PCR analysis. The results indicated that Ago2 antibody precipitated the AGO2 protein from the cell lysates (Fig. 7d, up panel), and circLARP4 and miR-424 were highly expressed in the AGO2 pellet compared with those in the input control (Fig. 7d, down panel). We also observed the expression of LATS1, a target of miR-424 and its downstream gene YAP after co-transfection with circLARP4 and miR-424 mimic or si-circLARP4 and miR-424 inhibitor by qRT-PCR (Additional file 5: Figure S4d) and western blot analysis (Fig. 7e), indicating that circLARP4 revived LATS1 and p-YAP expression and decreased YAP expression and counteracted the effects of miR-424 on their expression in HGC-27 cells. Reversely, knockdown of circLARP4 reduced LATS1 and p-YAP expression and increased YAP expression and reversed the effect of miR-424 inhibitor on their expression in MKN-28 cells. Moreover, ectopic expression of circLARP4 attenuated the proliferative effect caused by miR-424 in HGC-27 cells, and knockdown of circLARP4 weakened the anti-proliferative effect induced by miR-424 inhibitor in MKN-28 cells (Fig. 7f). Altogether, these results inferred that circLARP4 could sponge miR-424 and inhibit its activity in GC cells.

FISH analysis showed that the expression level of circLARP4 was markedly downregulated in GC tissues compared with the pair-matched normal tissues (Fig. 8a). In addition, we also found that circLARP4 expression level was decreased in GC patients with tumor size (TS) > 3 cm or stage N2 + N3 compared with those with TS ≤ 3 cm or stage N0 + N1 (Fig. 8b). We further analysed the correlation of circLARP4 expression level with various clinicopathological characteristics of 80 GC patients, who were divided into two groups-circLARP4 high expression and circLARP4 low expression according to the cut-off value (Additional file 6: Figure S5a). High expression of circLARP4 was found negatively associated with the tumor size and lymphatic metastasis, but had no correlation with other clinical and pathological parameters (Additional file 1: Table S9). Therefore, circLARP4 expression might be related with early stages of this disease. Kaplan-Meier analysis showed that GC patients or early stage patients (stageI + II) (log-rank test, Fig. 8c) rather than late stage ones (stage II + III or stage III) (log-rank test, Additional file 6: Figure S5b) with circLARP4 high expression had a significantly longer OS than those with circLARP4 low expression.

We then analysed the associations between circLARP4 expression level and the therapeutic outcomes in 72 GC patients treated with adjuvant chemotherapy of oxaliplatin and 5-Fu. These patients or early stage ones (Fig. 8d) rather than late stage ones (stage II + III or stage III) (Additional file 6: Figure S5c) with circLARP4 high expression had more favorable therapeutic outcome than those with circLARP4 low expression. As for the patients without chemotherapy, circLARP4 high or low expression had no impact on the survival of these patients (Additional file 6: Figure S5d).

To define whether the ability of circLARP4 to predict survival was independent of other clinicopathological factors of GC patients, univariate and multivariate Cox proportional hazards analyses revealed that circLARP4 level and lymphatic metastasis were independent prognostic factors for OS of GC patients (Additional file 1: Tables S10).