Background
Colon cancer is the second leading cause of cancer deaths worldwide accounting for over 1.4 million new cases each year [
1,
2]. Colon cancers are rising at an alarming rate in countries where very few treatment options are available. It is projected that from 2015 to 2030 the incidence of the disease in developing countries will increase by as much as 60 % [
3] and will present great challenges to the management of the cancer. It has been shown that there are close associations between molecular signaling, energy generation, and proliferation of tumors [
4,
5]. Since these molecular mechanisms can promote tumor cell proliferation, they are usually the targets of cancer chemotherapies [
6].
Cancer chemotherapeutic agents are screened and selected based on their potentials to induce apoptosis [
7]. Apoptosis is an integral cell death program characterized by DNA fragmentation as well as loss of mitochondrial membrane integrity [
8]. This mode of cell death is driven by caspases and proceeds via the extrinsic or intrinsic pathways. The intrinsic pathway of apoptosis is tightly coordinated by the mitochondria via the activation of caspase 9 [
9,
10]. Because of the integral role it plays, caspase 9 is often referred to as gatekeeper of the mitochondrial pathway [
11]. Upon activation, caspase 9 activates caspase 3, whose action leads to the execution of apoptosis. Apoptotic strategies to destroy tumor cells may involve direct stimulation of pro-apoptotic molecules, modulation of anti-apoptotic proteins or induction of tumor suppressor function [
12]. The functions of caspase 9 gene and promoter help to drive apoptosis to ensure that abnormal and senescent cells are removed from the body [
13]. A comparison between the normal and tumor cells of colorectal cancer patients had shown decreased expression of caspase 9 in tumors [
14]. In situations where tumors arise due to altered gene expression, treatments can be targeted towards improving the expression of the gene because the activation or inhibition of certain genes could stimulate apoptosis and alter the kinetics of tumor growth [
15].
Clausenidin (Fig.
1) is a natural pyranocoumarin from
Clausenidin excavata Burm
. f., a wild shrub of the
Rutaceae family predominantly used in Asian folk medicine [
16,
17]. The plant has been used locally to treat cold, dermatopathy, snake bite, malaria, HIV and abdominal pains [
18,
19]. In Thailand, it has been reported that
Clausena excavata is traditionally used in the treatment of cancers [
17]. In a recent study, Su et al. [
20] isolated four pyranocoumarins from
C. excavata and screened their cytotoxic potentials in cancer cells. The study revealed that the pyranocoumarins are good modulators of tumor cell death. In another study dentatin isolated from
C. excavata was shown to increase the expression of caspase 9 in MCF-7 cells [
21]. In our laboratory we observed that the expression of caspase 9 increases in clausenidin-treated hepG2 cells (Unpublished report). However, the underlying mechanisms by which clausenidin induces apoptosis has not been fully resolved. The current study describes for the first time, some molecular mechanisms involved in clausenidin-induced cell death in a colon cancer cell line. The study also provides insights on caspase-dependent apoptosis triggered by clausenidin in colon cancers.
Methods
Extraction and isolation of compound
Fresh roots of
Clausena excavata Burm.
f. were collected from the Agricultural Park, Institute of Bioscience, University Putra Malaysia. The identification of the plant material was done by Dr Shamsul Khamis of the Institute and a voucher specimen was deposited in the herbarium (2991/16). The roots (2 kg) were air-dried for 2 weeks, ground to fine powder and used for the extraction process. The extraction of clausenidin was performed by soaking the fine powder in 1 L chloroform for 3 days followed by filtration through 0.45 μm filter paper (Sigma Aldrich, US) to collect the extract. The extract was subjected to glass column chromatography through silica gel, as described by Arbab et al. [
21], to obtain pure clausenidin crystals (524 mg). The clausenidin crystals were subjected to mass spectrometry (Shidmadzu GCMS-QP5050A) while the melting point was determined using a Barnstead melting point apparatus [
16,
18].
Cell viability assay
Human colon cancer (HT-29) cells were obtained from American Type Culture Collection (ATCC, Va, USA) and doxorubicin from EMD Millipore, US. The cells were maintained in DMEM medium supplemented with 10 % Fetal Bovine Serum (FBS). About 5000 cells were seeded into each well of a 96 well plate and incubated for 24 h. Treatment was done with increasing concentrations of clausenidin and doxorubicin (positive control). Negative control cells were treated with 0.1 % (v/v) DMSO. After 72 h, MTT (5 mg/mL) was added for the viability assay as described previously by Syam [
22]. Results obtained were expressed as percentage cytotoxicity after 72 h exposure to test agents.
Morphological assessment of apoptotic cells by acridine orange (AO) and propidium iodide (PI) double staining
Clausenidin induced cell death in HT-29 cells was monitored using acridine orange (AO) and propidium iodide (PI) double-staining according to standard procedures. Cells were seeded in a 6 well plate (105cells/well) and incubated overnight. The cells were treated for 24 h with increasing concentrations of clausenidin after which the cells were harvested and washed with PBS. The cells were centrifuged at 1000 g for 5 min and the supernatant was discarded. The washing procedure was repeated twice to remove traces of media from the cells. Ten microliters (10 μl) of fluorescent dyes containing AO (10 mg/mL and PI (10 mg/mL) were added into the cellular pellet at equal volumes. Freshly stained cell suspension was dropped on a glass slide and covered with a cover slip. Slides were observed under fluorescent microscope within 30 min before the fluorescence fades.
Transmission electron microscopy
To prepare the cells for transmission electron microscopy (TEM), HT-29 cells were seeded at a density of 10
6cells/T-25 ml flask and incubated overnight. The cells were then treated with the IC
50 of clausenidin (13.8 μg/mL) in a time dependent manner while the negative control cells were treated with 0.1 % (v/v) DMSO. After treatment, cells were harvested and washed with PBS before successive fixing with 4 % glutaraldehyde for 24 h and 1 % osmium tetraoxide at 4 °C for 2 h. After each fixing, washing was done three times with 0.1 M sodium cacodylate buffer. Dehydration of the cells was carried out with increasing concentrations of acetone (30 – 99.9 %). Further processing of cut sections was done using the method described by Tan et al. [
23]. The sections were stained with uranyl acetate and viewed under the Hitachi H-7100 electron microscope.
ROS assay
The ROS assay was performed to measure the intracellular ROS production from the mitochondria of clausenidin-treated HT-29 cells. Briefly, cells were seeded at a density of 2 × 105 cells/well in a 6 well plate and incubated overnight. The cells were then treated with clausenidin (13.8 μg/mL) at increasing time period and harvested for the ROS assay, which was performed using the Total ROS assay kit (ebioscience Inc, Affymetrix) according to manufacturer’s protocol. The assay results were analyzed on a flow cytometer (BD FACS, Calibur).
DNA fragmentation analysis
The HT-29 cells were seeded at a density of 106cells/ml in culture flask and incubated overnight. The cells were then treated with clausenidin (13.8 μg/mL) for 12 h and 24 h respectively after which the cells were harvested and DNA was extracted using the suicide-track™ DNA Ladder Isolation kit (Calbiochem, USA) according to the manufacturer’s protocol. The principle involves detection of the cytoplasmic histone-associated DNA fragments (mononucleosome and oligo- nucleosomes) formed during apoptosis. After extraction, the concentration and purity of the DNA was confirmed on a nanodrop spectrophotometer. The extracted DNA samples were run on a 1.5 % agarose gel in Tris–acetic acid–EDTA buffer and gel image was captured on GelDoc (Biorad, USA). HL-60 cells induced to undergo apoptosis with Actinomycin D, supplied with the assay kit was used as positive control.
Cell cycle analysis by flow cytometry
The HT29 cells were seeded at a concentration of 106cells/T-25 ml flask in RPMI media and incubated overnight. The cells were then treated with clausenidin (13.8 μg/mL) at an increasing time period while the negative control cells were treated with 0.1 % (v/v) DMSO. After treatment, cells were harvested and washed with PBS. The cell cycle assay was performed using BD cell cycle reagent (CycleTest™ Plus DNA reagent kit, Becton Dickinson, Belgium) according to manufacturer’s protocol and the result was analyzed on a flow cytometer (BD FACS, Calibur) using the BD cell quest pro software.
Annexin V assay
HT-29 cells were seeded at a concentration of 2 × 105cells/T-25 flask in RPMI media and incubated overnight. The cells were then treated with increasing concentrations of clausenidin while the negative control was treated with 0.1 % (v/v) DMSO. Cells were harvested after treatment and washed with PBS. Annexin V assay was then carried out using FITC annexin V assay kit (BD Pharmingen, USA) following the manufacturer’s protocol and the result was analyzed on a flow cytometer.
Mitochondrial membrane potential (MMP) assay
Mitochondrial membrane potential assay was performed to determine the polarization/depolarization of the mitochondrial membrane using the JC-1 dye. HT29 cells were seeded at a density of 5 × 105cells/well in a 6 well plate, incubated overnight and then treated with increasing concentrations of clausenidin for a period of 24 h. The negative control cells were treated with 0.1 % (v/v) DMSO. The assay was performed using the BD™ Mitoscreen kit (BDbiosciences, US) according to manufacturer’s instruction. The results were analyzed on a flow cytometer (BD FACS, Calibur) using the BD cell quest pro software.
Caspases 3 and 9 assays
Caspases 3 and 9 activity were determined using the colorimetric method (Genescript Colorimetric Assay kit, USA). Cells were initially seeded in a 6 well plate at a density of 106 cells/well overnight. The cells were treated for 24 h with increasing concentrations of clausenidin and then cleaved Caspases 3 and 9 assays were performed respectively according manufacturer’s protocol. Negative control cells were treated with 0.1 % (v/v) DMSO. After the completion of reaction, the plates were read on microplate reader at 405 nm.
RNA isolation
RNA extraction was basically done to study the expression of the genes and get possible insights into the mechanism of apoptosis induced by clausenidin. After treatment of cells with clausenidin and 0.1 % DMSO (for negative control) in a 6 well plate (106cells/well), the cells were harvested with trypsin and washed with PBS. The RNA was extracted using the Total RNA extraction kit (GF-1 TRE kit, Vivantis technologies) according to the manufacturer’s protocol. The extracted RNA was quantified using a nanodrop spectrophotometer at 260 nm.
RT-qPCR
The reverse transcriptase quantitative PCR (RT-qPCR) was carried out according to the GenomeLab GeXP Kit (Beckman Coulter, USA) protocol, in an XP Thermal Cycler (Bioer Technology, Germany). PCR products were finally analyzed on the GeXP genetic analysis system and the results normalized on express Profiler software based on the manufacturer’s instructions. The primers for the genes of interest and housekeeping gene (Table
1) were designed on NCBI website and purchased from Biosune (Shanghai, China), while the internal control (Kanr) was supplied by Beckman Coulter (USA).
Table 1
Gene name and sequences of primers used in the multiplex panel
Bax | AGGTGACACTATAGAATAGCAAACTGGTGCTCAA | GTACGACTCACTATAGGGAAACCACCCTGGTCTTG |
Bcl-2 | AGGTGACACTATAGAATACTGTGGATGACTGAGTACCT | GTACGACTCACTATAGGGATCAGAGACAGCCAGGAG |
Apaf-1 | AGGTGACACTATAGAATACATACTCTTTCACCAGATCA | GTACGACTCACTATAGGGAACAAGTTCTGTTTTTGCTTT |
Cyt c | AGGTGACACTATAGAATAGAGCGAGTTTGGTTGC | GTACGACTCACTATAGGGAAAATCTTCTTGCCTTTCTC |
Caspase 3 | AGGTGACACTATAGAATATGTAGAAGAGTTTCGTGAGT | GTACGACTCACTATAGGGAGAGTTTTCAGTGTTCTCCAT |
Caspase 9 | AGGTGACACTATAGAATAGCTGGTGGAAGAGCTG | GTACGACTCACTATAGGGACTCTAAGCAGGAGATGAACA |
β-actin | AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC | GTACGACTCACTATAGGGAAAAGCCATGCCAATCTCATC |
Statistical analysis
Data were presented as mean ± standard deviation. One way Analysis of Variance (ANOVA) on SPSS 22 software (SPSS Inc, Chicago IL, USA) was used to assess the level of significance between means at 95 % confidence interval (p < 0.05).
Discussion
There are few literatures on the isolation of clausenidin and its potential cytotoxic effects but none of the reports have clearly defined the mechanism of action of clausenidin in any cancer cell line. In this particular study, we investigated the cascade of reactions that triggers apoptosis in HT-29 cells treated with clausenidin from Clausena excavata. It was observed that apoptosis occurred in the clausenidin treated HT29 cells via caspase 9 mediated signaling.
The purified clausenidin induced cytotoxic effects in HT-29 cells in a dose dependent manner with an IC
50 of 13.8 ± 2.89 μg/mL. This could be a justification for the wide usage of
C excavata in Asian folk medicine. Apoptosis is programmed active cell death. A number of anticancer drugs have been screened and selected based on their abilities to initiate the physiological events that culminates in cell death [
7]. We observed the presence of membrane blebs, and chromatin condensation in the fluorescent micrographs of clausenidin treated HT-29 cells which represents features of incipient apoptosis [
27]. Similarly, the ultrastructural micrograph revealed morphological aberrations within the organelles in HT-29 cells associated with apoptosis. The apoptotic features observed includes appearance of lipid droplets (as a result of cell membrane damage), condensation of chromatin and nuclear fragmentation which further corroborated apoptosis in the clausenidin treated HT-29 cells.
DNA fragmentation and loss of mitochondrial membrane integrity precedes apoptosis [
8]. Clausenidin caused a nucleosomal DNA cleavage in HT-29 cells which led to the generation of DNA fragments as shown earlier in the gel image result. The generation of DNA fragments increased as the treatment time progressed suggesting the ability of clausenidin to sustain apoptosis in HT-29 cells. As a proof of the apoptosis-inducing effect of clausenidin, we observed a loss of MMP in the HT-29 cells which is a prerequisite for apoptosis to occur via the mitochondrial pathway. Also, apoptosis induced by some chemotherapeutic agents is controlled by the ratio of bax:bcl 2 expressions in the mitochondria [
28]. Increased expression of Bax is known to stimulate a collapse of MMP which terminates in apoptosis [
29]. Our gene expression study result shows a significant increase (
p < 0.05) in the bax level which could have triggered the MMP collapse in clausenidin treated HT-29 cells observed earlier. In addition, a significant increase (
p < 0.05) in cytochrome c and Apaf-1 genes expression were observed after treatment with clausenidin. Mitochondrial release of cytochrome c into the cytoplasm enables it to interact with dATP and Apaf-1 to form the apoptosome complex and subsequent activation of caspases [
26]. The mitochondria has been described as a major component of the intrinsic pathway because of its ability to activate the apoptosis program directly. Therefore, we suspect that the increased levels of the apoptotic genes as observed in this study could have been triggered by clausenidin induced mitochondrial signaling. In a recent study with dentatin isolated also from
C. excavata, it was observed that apoptosis occurred via mitochondrial pathway signaling in the dentatin-treated MCF-7 breast cancer cells [
21].
Moreover, the expressions of caspases 3 and 9 proteins increased significantly (
p < 0.05) after treating the HT-29 cells with clausenidin. Caspase 9 is a key regulator of mitochondrial apoptosis, because it functions as a gatekeeper of the intrinsic pathway [
11]. So therefore, an increase in the expression of caspase 9 protein and gene as observed in this study strongly suggests the involvement of the intrinsic pathway (mitochondrial pathway) in the induction of apoptosis in clausenidin-treated HT-29 cells. Impaired functions of the caspase 9 promoter or caspase 9 gene which leads to low activity of caspase 9 has been implicated as a cause of various cancers such as colon cancer [
30‐
33]. We observed that clausenidin treatment significantly increased (
p < 0.05) the expression of caspase 9 gene by over two (2) folds. It is no surprise that the caspase 3 expression also increased significantly since it depends on caspase 9 for activation [
11]. Caspase 3 executes apoptosis via selective destruction of subcellular structures, organelles or even the genome [
11]. Our earlier results of TEM and DNA fragmentation analysis confirms this process of subcellular destruction. An increased expression of caspases 3 and 9 have also been reported in breast cancer cells treated with dentatin isolated from
C. excavata [
21].
One of the mechanisms by which anticancer agents induce apoptosis is through the creation of oxidative imbalance, which is a consequence of increased intracellular ROS production beyond the capacity of antioxidant defense system [
34]. Previous studies have shown that there is a relationship between the mitochondrial derived ROS and the activation of caspases [
35,
36]. The increased production of ROS in the present study could have triggered the clausenidin induced apoptosis in HT-29 cells as shown by our TEM micrographs. ROS has been reported to cause DNA strand cleavage as well as cell membrane injury [
34] which we observed in the present study.
However, insensitivity to growth inhibitory signals has been proposed as one of the hallmarks of cancer survival strategy [
11]. This leads to an inability to regulate the cell cycle which culminates in the development of cancer [
37]. The cell cycle result shows that clausenidin induces a G0/G1 arrest in HT-29 cells. This finding could suggest another pathway through which clausenidin elicits signals that inhibits/controls the growth of tumor cells. Another vital observation in the cell cycle assay is the significant increase in the fractionated DNA of the clausenidin treated cells as represented by the sub G0/G1 fraction. This important finding and other results presented in this study lends credence to the occurrence of apoptosis in the clausenidin treated HT-29 cells.
Abbreviations
Apaf-1, Apoptotic protease activating factor-1; Bax, Bcl 2 associated x protein; Bcl 2, B cell lymphoma 2; Caspase, cysteine aspartic acid protease; Cyt c, Cytochrome complex; DMEM, Dulbecco’s Modified Eagle’s Medium; DMSO, Dimethyl sulfoxide; DNA, Deoxyribonucleic acid; HT-29 cells, Colon cancer cells; MTT, 3–(4,5-dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium bromide; qPCR, quantitative Polymerase Chain reaction; ROS, Reactive oxygen species; TEM, Transmission electron microscopy.
Acknowledgements
The authors’ wish to thank Prof Rosita Rosli the entire staff of Makna-Cancer research Laboratory, University Putra Malaysia for their support during the course of this project.