Background
Myelodysplastic syndromes (MDS) represent a diverse group of myeloid clonal disorders characterized by ineffective hematopoiesis, one or more cytopenias and potential progression to acute myeloid leukemia (AML). The precise mechanisms leading to the development of MDS are incompletely understood, however, the bone marrow (BM) niche may play an important role in the development, progression and response to treatment of MDS [
1,
2]. The BM niche is mainly composed of mesenchymal stromal cells (MSC), endothelial cells, immune cells and other non-cell component such as various cytokines and extracellular matrix (ECM) [
3].
Hyaluronan (HA), a major component of the ECM, is a member of the glycosaminoglycan polysaccharide family composed of repeating disaccharides of
N-acetylglucosamine and glucuronic acid. HA is not only a structurally important molecule, but also has the potential to modify many cellular behaviors such as adhesion, proliferation, differentiation and migration [
4,
5]. The effects of HA on cell behaviors are mediated by the HA receptors such as CD44, RHAMM, LYVE-1, layilin and HARE [
6,
7]. In particular, HA production is increased in many malignant tissues and elevated HA levels have been shown to enhance tumor cell invasion, migration and proliferation [
8,
9]. In addition, HA can be released by many cell types, both stromal cells and hematopoietic cells [
10]. HA is expressed on human BM sinusoidal endothelium and endosteum, the regions where MSC are also abundant [
11]. Recent research suggested that the HA could provide a protective niche for MSC, supporting the maintenance of their ‘stemness’ [
12]. Several other reports supported a critical role of HA in the physiopathology of hematological malignancies, such as multiple myeloma (MM) [
13,
14], AML [
15]. However, it is still unclear whether HA exerts any effects in MDS.
In the present study we analyzed BM serum levels of HA from MDS patients and normal controls by radioimmunoassay, and concluded that higher-risk MDS patients had high BM serum levels of HA. The patients with high BM serum HA levels were correlated with poor prognosis. The HA production and hyaluronan synthase 2 (HAS-2) gene expression were elevated in higher-risk MDS-MSC. Moreover, we demonstrated that HA could facilitated osteogenic differentiation of MSC. MDS with high BM serum HA levels had better osteogenic differentiation potential of MSC. Our findings supported an important regulatory role for HA in the pathophysiology of MDS.
Methods
Patients
A total of 82 patients with MDS and 28 healthy donors from our own center between Jun 2011 and March 2014 were investigated in this study. All patients were untreated when they were recruited into this study. MDS was diagnosed in accordance with the minimum diagnostic criteria established by the conference on MDS (Vienna, 2006) [
16].
Measurement of the HA levels
The bone marrow serum and cell culture medium samples were centrifuged at 8000 g for 10 min. The supernatant was used to determine the total HA concentration. The HA levels were determined via radioimmunoassay [
17].
Isolation and culture of MSC
Following the isolation by density centrifugation, the BM mononuclear cells (MNC) were seeded at a concentration of 1 × 10
6 cells/mL and cultured in Human Mesenchymal Stem Cell Growth Medium (Cyagen Biosciences Inc, Guangzhou, China) at 37 °C with 5% CO
2 in a humidified atmosphere as previously described [
18]. The supernatant containing non-adherent cells was removed and medium was changed every 3 days. MSC used in all experiments were derived from passages 2–4. To fulfill the criteria of the International Society for Cellular Therapy, MSC were evaluated by flow cytometry for the absence of CD34, CD45 antigens and the presence of CD73, CD90, CD105 and CD166 [
19].
Real-time quantitative polymerase chain reaction
RNA from MSC was purified using the RNeasy Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions. cDNA was prepared using the First Strand cDNA Synthesis Kit (Fermentas, Burlington, Canada) following the manufacturer’s protocol. PCR was performed on an ABI 7500 real-time PCR machine (Applied Biosystems). The primer sequences of runt related transcription factor 2 (RUNX-2), bone sialoprotein (BSP), alkaline phosphatase (ALP), Type1 collagen (COL-1), osteopontin (OPN), osteocalcin (OCN) and hyaluronan synthase 1/2/3 (HAS-1/2/3) are listed in Table
1. GAPDH served as reference control, and differences in mRNA expression levels were calculated as fold changes by the 2
−△△Ct method.
Table 1
The sequence of primers used for real time PCR
GAPDH | CCCACTCCTCCACCTTTGA | CCACCCTGTTGCTGTAGCC |
HAS-1 | GGAATAACCTCTTGCAGCAGTTTC | TTGGGACCGCTGAAGCC |
HAS-2 | TCGCAACACGTAACGCAAT | ACTTCTCTTTTTCCACCCCATTT |
HAS-3 | AACAAGTACGACTCATGGATTTCCT | GCCCGCTCCACGTTGA |
RUNX-2 | AGTGGACGAGGCAAGAGTTTC | CCTTCTGGGTTCCCGAGGT |
ALP | CCATTCCCACGTCTTCACATT | AAGGGCTTCTTGTCTGTGTCACT |
COL-1 | CACCAATCACCTGCGTACAGAA | CAGATCACGTCATCGCACAAC |
BSP | GACAGTTCAGAAGAGGAGGAG | AGCCCAGTGTTGTAGCAGA |
OCN | AGGGCAGCGAGGTAGTGAA | TCCTGAAAGCCGATGTGGT |
OPN | TTTACAACAAATACCCAGATGC | ATGGCTTTCGTTGGACTTACT |
Osteogenic differentiation assay
MSC were seeded at 3 × 104 cells/well in 6-well plate in Human Mesenchymal Stem Cell Osteogenic Differentiation Medium (Cyagen Biosciences Inc, Guangzhou, China), and the medium was replaced every 3 days. After 3 weeks differentiation, cells can be fixed and stained with Alizarin red, visualized using light microscopy. The bound staining was eluted with 10% (wt/vol) cetylpyridinium chloride (sigma), and alizarin red-S in samples was quantified by measuring absorbance at 572 nm.
Cell culture with HA treatment
HA solution was prepared by dissolving HA powder (Mw = 1010 − 1800 KDa; LifeCore, MN, U.S.) in double distilled water and adjusted to working concentration before use. After the HA solution was applied to a 6-well plate surface, the coated substratum was kept to dried at 45 °C for 30 min. We used HA coated surfaces at a concentration of 30 μg/cm2.
Statistical analysis
All statistical analyses were performed using the GraphPad Prism 5.01. The statistical differences between groups were determined by the two-tailed unpaired Student’s t test. Kaplan–Meier curves were used for analysis of overall survival (OS) and time to AML progression. The data were presented as mean ± SEM, p < 0.05 was considered statistically significant.
Discussion
There is increasing evidence that HA production is elevated in tumors and may play an important role in tumor progression [
9,
22,
23]. However, the clinical implication of HA levels in MDS remains unclear. HA has been always detected in various body fluids, such as serum, lymph, urine, and pleural fluid [
24]. To better understand the effect of HA in the BM niche of MDS, we examined the HA levels in bone marrow serum of MDS patients in this study. The main finding was that higher-risk MDS patients showed significantly elevated BM serum HA levels, as compared to normal controls. Earlier study evaluated the HA distribution in AML/MDS by histochemical stain,and showed that AML patients exhibited stronger HA staining, four of 8 MDS patients showed higher HA staining compared to normal controls [
15]. An interesting observation in the present study is that an inverse correlation between OS and BM serum HA levels. However, BM serum HA levels were not associated with time to AML progression. In addition, the cell surface receptor, CD44 has been shown to be important in malignant cell adhesion, survival, migration, and invasion. Serum CD44 was reported slightly increased in MDS patients [
25]. Another study also demonstrated that elevated serum CD44 levels were associated with shorter survival in MDS patients [
26]. These results indicate that HA-CD44 signals are activated in MDS, suggesting their critical role in the pathogenesis of MDS.
Elevated BM serum HA levels which may be caused by increased HA production by the malignant cells themselves or surrounding stromal cells. Moreover, HA biosynthesis is regulated by three transmembrane glycosyltransferase isoenzymes: HAS-1, HAS-2 and HAS-3 [
27]. Therefore, we characterized HA production and HAS-1/2/3 gene expression in MNC and MSC. We examined HA levels in culture medium supernatants from MSC,we have shown that the levels of HA secreted by MSC was increased in MDS, especially in higher-risk MDS, up-regulated mRNA expression of HAS-2 in higher-risk MDS-MSC might explain the overproduction of HA. In addition, we also found the HA could secret by MNC, although the MDS-MNC exhibited significant higher mRNA expression of HAS-1/2,this did not affect the HA production in MNC from MDS patients. All these data indicate that MSC play a prominent role in the augmentation of HA levels in the BM serum of higher-risk MDS.
It is well known that lower-risk MDS and higher-risk MDS possess different biological characteristics, lower-risk MDS present a trend to BM failure, while higher-risk MDS are more likely to convert into leukemia. In this study we found the obvious differences in the BM serum levels of HA between lower-risk and higher-risk MDS. Our previous study also showed the differences in osteogenic state between lower-risk and higher-risk MDS-MSC, the osteogenic differentiation potential of lower-risk MDS-MSC were impaired,but those of higher-risk MDS-MSC were relatively normal [
18]. Thus we speculate that the distinct HA levels in lower-risk and higher-risk MDS may participate in these processes. We then separately analyzed osteogenic differentiation potential of MSC from patients with high and low BM serum HA levels. Interestingly, MDS with high HA levels exhibited better osteogenic differentiation potential of MSC. These results indicate that HA may assotiated with pro-osteogenic differentiation potential of MSC in MDS. Osteoblasts, as major stromal cells derived from MSC in the endosteal niche, support hematopoietic progenitors and cause secretion of several cytokines. High osteoblast activity in MDS BM niche may facilitate the growth of malignant cells [
28]. Therefore, it may be that perturbations of osteoblast activity drive MDS pathogenesis.
Futhermore, in order to confirm the effects of HA on MSC osteogenic differentiation, we performed osteogenic induction culture of MSC on surface with and without HA-coating. The results showed that HA could enhance the osteogenic differentiation function of MSC. The mechanism by which HA exerts its pro-osteogenic effect on MSC is still poorly defined. Several studies demonstrated that HA presented pro-osteogenic differentiation via stimulated expression of specific target genes such as ALP, osterix, RUNX-2, COL-1 or enhanced cell adhesion functions [
29‐
31]. In addition, HA may act as a reservoir for the growth factors which reported to be important in osteogenesis, such as platelet-derived growth factor (PDGF), different bone morphogenetic proteins (BMPs) and transforming growth factor-β (TGF-β) [
32,
33]. These are possible mechanisms that may account for its osteogenesis regulatory properties. However, Chang et al. [
34] also demonstrated that HA could inhibit osteogenic differentiation through TLR4 by interfering with M-CSF. The discrepancies between the reports may be attributed to the different molecular weight and concentration of HA investigated.
Authors’ contributions
CKC and CMF conceived the idea, developed the methodology, designed the experiments and analysed the experiments. CMF, JG, YSZ, SDZ, QQZ, LS performed the experiments. CKC and XL supervised the manuscript. All authors read and approved the final manuscript.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.