Background
Lung cancer is a major cause of death associated with cancer, and its rate continues to increase [
1,
2]. Non-small cell lung cancer (NSCLC) accounts for 80% of all lung cancer cases. Subgroups of NSCLC include lung adenocarcinoma, lung squamous cell carcinoma (LUSC), and lung large cell carcinoma. According to recent studies, most patients are diagnosed at an advanced stage, which leads to low cure rates. Only a minority of patients can be treated by surgery [
1,
3]. Some patients are treated with chemotherapy, radiation therapy, and targeted therapy, but the 5-year survival rate remains low and many patients are at risk of recurrence [
2‐
6]. The cure rate of lung cancer can be improved by early confirmation. At present, the diagnosis of lung cancer mainly depends on the pathological biopsy. Therefore, it is significant to explore the molecular mechanism of lung cancer and to improve its diagnosis and treatment [
7].
MicroRNAs (miRNAs) are a type of endogenous non-coding RNA consisting of 19 to 24 nucleotides with regulatory functions [
8‐
11]. miRNAs play important roles in biological processes. For example, miRNAs regulate the degradation of target mRNAs and deter their translation [
8,
12]. Recent reports have shown that miRNAs are involved in the formation, development, and transformation of lung cancer [
13‐
17]. Therefore, we can use miRNAs to detect, diagnose, and cure cancer [
9,
13,
18‐
20].
MiR-182-5p, as a member of miRNAs family, can be detected in many cancers, for example, lung cancer, and the expression of miR-182-5p is upregulated [
6,
21]. Several studies indicated that miR-182-5p acts as an onco-miR to enhance tumor cell proliferation [
21‐
23]. However, previous studies have focused on particular aspects of miR-182-5p in LUSC and thus lacked a comprehensive description. The expression value of miR-182-5p was not shown in previous articles, which have often displayed
p values of a statistical test. Therefore, data cannot be obtained. In this study, we analyzed 388 LUSC samples from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) database to verify the clinical value of miR-182-5p in LUSC. Next, 23 clinical LUSC samples were used to further prove the clinical value of miR-182-5p. The PubMed, Wiley Online Library, EBSCO, Cochrane Central Register of Controlled Trials, Web of Science, Google Scholar, Ovid, EMBASE, and LILACS were also searched to obtain document sources. Furthermore, we used miRBase (
http://www.mirbase.org/) to discern the target genes of miR-182-5p and investigated the enrichment pathways and target genes by KEGG pathway and GO enrichment analyses and protein-protein interaction (PPI) networks. On the basis of the previous literature, we combined more samples and using various methods to reduce the difference between the existing literatures. We hope this study provides comprehensive information on miR-182-5p for the occurrence and progression of LUSC.
Methods
MiR-182 expression in LUSC samples from TCGA database
TCGA database provides comprehensive cancer genomic datasets for researchers where data are available to search, download, and analyze. In this study, we searched TCGA database (
https://cancergenome.nih.gov/) to examine miR-182 expression in LUSC tissues. We obtained the miRNA profiles of 338 LUSC tissues and 45 non-cancerous tissues together with the clinical info. Afterward, miR-182 expression was examined from the miRNA profiles. The extracted data were normalized and processed by log2 transformation. Subsequently, statistical analyses were performed to evaluate the miR-182 expression in LUSC tissues and the correlation between miR-182 expression and relevant clinical data. Additionally, to further analyze the overall survival of LUSC, a Kaplan-Meier curve was constructed using the median miR-182 expression value.
MiR-182-5p expression in LUSC tissues from the GEO database
We mined the GEO database (
http://www.ncbi.nlm.nih.gov/geo/) to obtain microarray profiles from LUSC samples using the following search terms: (cancer OR carcinoma OR adenocarcinoma OR tumour OR tumor OR malignanc* OR neoplas*) AND (lung OR pulmonary OR respiratory OR respiration OR aspiration OR bronchi OR bronchioles OR alveoli OR pneumocytes OR “air way”). The search results were then specified using the following filters: Series[Entry type],
Homo sapiens[Organism]. The microarrays were selected according to the inclusion criteria as follows: miR-182 expression was examined in LUSC tissues and non-cancerous tissues. Microarrays were considered ineligible according to the following exclusion criteria: (1) microarrays did not meet the inclusion criteria; (2) the microarray profile did not include miR-182 expression; (3) the microarray only provided LUSC tissues without a control group; (4) an insufficient number of LUSC samples for analysis; and (5) microarrays used cell line samples. A total of seven datasets were obtained, namely, GSE16025, GSE25508, GSE29248, GSE47525, GSE19945, GSE51853, and GSE74190.
Clinical samples
In our study, 23 formalin-fixed, paraffin-embedded LUSC tissues and their adjacent normal tissues were collected from the Pathology Department of the First Affiliated Hospital of Guangxi Medical University between January 2012 and February 2014. All samples were pathologically confirmed as LUSC by two independent pathologists (Z.-y.L. and G.C.). The study was approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University, and the clinical parameters of 23 patients were shown in Table
1.
Table 1
Clinical parameters of 23 LUSC patients
Tissue | LUSC | 23 |
Non-cancer | 23 |
Gender | Male | 18 |
Female | 5 |
Age (years) | < 60 | 15 |
≥ 60 | 8 |
Smoke | No | 12 |
Yes | 11 |
Tumor size | ≤ 3 cm | 7 |
> 3 cm | 16 |
Vascular invasion | No | 20 |
Yes | 3 |
TNM | I-II | 10 |
III-IV | 13 |
Lymph node metastasis | No | 11 |
Yes | 12 |
Pathological grading | II | 16 |
III | 7 |
RT-qPCR
To detect the expression of miR-182 in 23 pairs of samples, RT-qPCR was carried out on an Applied Biosystems PCR 7900 system. Total RNA was extracted and normalized as previously reported [
24‐
28]. The expression levels of miR-182 were evaluated with a mirVana RT-qPCR miRNA Detection Kit (Ambion Inc., Austin, TX, USA). The combination of miR-103 and miR-191 was considered an endogenous control and served as a reference in our previous study [
29]. TaqMan MicroRNA Assays from Applied Biosystems were used in the PCR system, and the sequences were as follows: miR-182 (Cat. No. 4427975-002334): UUUGGCAAUGGUAGAACUCACACU; miR-103 (Cat. No. 4427975-000439): AGCAGCAUUGUACAGGGCUAUGA; and miR-191 (Cat. No. 4427975-000490): CAACGGAAUCCCAAAAGCAGCU. The expression of miR-182 in the FFPE experiments was computed with the formula 2
-Δcq.
Literature
The keywords were used to search the literature of miR-182-5p in LUSC from PubMed, Wiley Online Library, EBSCO, Cochrane Central Register of Controlled Trials, Web of Science, Google Scholar, Ovid, EMBASE, and LILACS, until 5 October 2017, and the keywords were as follows: (cancer OR carcinoma OR adenocarcinoma OR tumour OR tumor OR malignanc* OR neoplas*) AND (Lung OR pulmonary OR respiratory OR respiration OR aspiration OR bronchi OR bronchioles OR alveoli OR pneumocytes OR “air way”) AND (miR-182 OR miRNA-182 OR microRNA-182 OR miR182 OR miRNA182 OR microRNA182 OR “miR 182” OR “miRNA 182” OR “microRNA 182”OR miR-182-5p OR miRNA-182-5p OR microRNA-182-5p). The studies which were included need to meet the following criteria: (1) the expression of miR-182-5p in LUSC must be detected by Homo sapiens, and (2) the data of the expression of miR-182-5p can be extracted in the studies.
A comprehensive meta-analysis was performed using Stata 14.0 software by combining the four sources (RT-qPCR data, TCGA data, GEO datasets, and the literature) reporting miR-182 expression in LUSC. The respective meta-analysis for RT-qPCR data, TCGA data, and GEO datasets was also performed. Pooled data in the meta-analysis were assessed by the standard mean difference (SMD) with a 95% confidential interval (CI). Heterogeneity among the eligible microarrays was evaluated by the chi-squared and
I-squared tests. The effect model was then determined according to the heterogeneity. Specifically, a fixed effects model was conducted for the meta-analysis when the heterogeneity was low (
I2 ≤ 50% and
p > 0.05) and a random effects model was selected if apparent heterogeneity existed (
I2 > 50% or
p ≤ 0.05) [
30]. A summary receiver operating characteristic (sROC) curve was constructed to describe the diagnostic ability of miR-182-5p in LUSC.
MiR-182-5p predicted target genes
MiR-182 target genes were projected in silico with 12 databases (miRWalk, Microt4, miRanda, mirbridge, miRDB, miRMap, miRNAMap, Pictar2, PITA, RNAhybrid, Targetscan, and RNA22). Genes present in at least five databases were further regarded as predicted target genes of miR-182. Two databases (Tarbase and miRTarbase) were employed to gather miR-182 target genes with “strong evidence.” All miR-182 target genes verified by western blot, qPCR, or luciferase reporter assays were selected as validated genes. Moreover, we identified weakly expressed genes in LUSC from TCGA database. Finally, target genes of miR-182 were achieved from the three analyses (predicted genes, validated genes, and genes from TCGA database), which were utilized for further gene pathway analysis, GO analysis, statistical analysis, and generating ROC curves. A correlation analysis between hub genes and miR-182 was also conducted. For all analyses described above, a p-value < 0.05 was regarded to present a significant difference.
Functional enrichment analysis via bioinformatics
Predicted target genes were subjected to GO analysis in the DAVID database [
31]. The BINGO plugin of Cytoscape was applied to visualize the GO network. The PPI networks were constructed using STRING 10.0 [
32]. We also mapped genes to the KEGG database to identify significant signaling pathways. A
p value < 0.001 was regarded to show statistical significance.
Statistical analysis
All statistical analyses were conducted using GraphPad 5.0 software. Student’s t test was used to detect a significant difference in the miR-182 expression between two groups, and one-way analysis of variance was used to study the miR-182 level among three or more groups. Furthermore, ROC curves were constructed, and the area under the curve (AUC) was calculated to assess the diagnostic role of miR-182 in LUSC. The diagnostic efficacy for LUSC was evaluated as low, moderate, or high depending on the AUC—0.5–0.7 (low), 0.7–0.9 (moderate), and 0.9–1.0 (high). A statistical alteration was considered to occur when p < 0.05.
Discussion
At present, LUSC is one of the most common cancers and is the chief cause of cancer deaths [
1,
40]. Misdiagnosis or metastasis can increase the mortality rate. Therefore, miRs including miR-182-5p are regarded as a new tool used to diagnose LUSC [
41].
In our study, we gathered a large amount of data on miR-182-5p expression in LUSC from TCGA and GEO databases and analyzed data from 23 paired clinical LUSC tissues. Herein, a meta-analysis was performed to explore the clinical value of miR-182-5p in LUSC.
There were 338 LUSC cases and 45 adjacent non-cancer cases in TCGA database. The data from TCGA database showed that the miR-182-5p expression in LUSC tissues was higher than in adjacent normal tissues, which indicated that miR-182-5p expression was associated with LUSC. We also included seven microarrays (GSE16025, GSE25508, GSE29248, GSE47525, GSE19945, GSE51853, and GSE74190) in the GEO database. In addition to GSE47525, other microarrays showed an increasing trend in miR-182-5p expression in LUSC compared to non-cancerous tissues. Among them, four microarrays (GSE16025, GSE19945, GSE51853, and GSE74190) showed statistical significance. However, in GSE47525, the result was opposite. MiR-182-5p expression was lower in LUSC tissue than in non-cancerous tissue. The result of GSE47525 may be caused by the small number of patient samples. According to RT-qPCR, miR-182-5p expression was correlated with tumor size. The expression of miR-182-5p tended to be higher when the tumor size was greater than 3 cm. As the tumor is growing, the expression of miR-182-5p was also increasing. The result revealed that the miR-182-5p was important in the progress of LUSC, and miR-182-5p could indicate the deterioration of LUSC. On the basis of the result, miR-182-5p can provide a biomarker to detect the occurrence and development of LUSC. The meta-analysis, which included data from TCGA database, the GEO database, RT-qPCR, and the literature, was the highlight of our study. The meta-analysis rendered the most comprehensive data on miR-182-5p. The pooled SMD of miR-182-5p was 1.44 (95% CI 0.83 to 2.05) by the random effects model, which showed that the high miR-182-5p expression in LUSC was consistent with the literature [
8,
13,
14,
35,
39]. Therefore, we conclude that miR-182-5p is markedly over-expressed in LUSC, consistent with the existing research. And the results showed an obvious relationship between the miR-182-5p expression and LUSC.
We also predicted miR-182-5p target genes using 12 prediction platforms and performed a bioinformatics analysis by GO enrichment, KEGG pathway, and PPI network analyses. The GO enrichment and KEGG pathway analyses included 97 items. In GO-BP, the pathway of apoptotic process included the target genes PRKCE, NR3C1, and RHOB. However, the pathway of apoptotic process in LUSC is still unclear. In GO-CC, the cytosol and cytoplasm were enriched in four hub genes. But there was no study of the relationship between the pathway and LUSC. As for GO-MF, EPSA1, PRKCE, NE3C1, and RHOB were all involved in SH3 domain binding. Shim et al. found that SH3 domain-binding protein 1 could suppress the growth of LUSC [
42]. Through the thinking, we can slow down the progress of LUSC by SH3 domain binding pathway. Additionally, the KEGG pathway analysis revealed that PRKCE is involved in the pathway of MicroRNAs in cancer, the cGMP-PKG signaling pathway, and pathway of vascular smooth muscle contraction. The function of these pathways in LUSC remains to be studied.
According to our bioinformatics analysis, four genes (EPAS1, PRKCE, NR3C1, and RHOB) were regarded as hub genes in LUSC. EPAS1, which is also known as hypoxia-inducible factor-2α (HIF-2α), belongs to the family of hypoxia-inducible factors (HIFs) [
43]. In our study, the expression of EPAS1 was negatively correlated with the expression of miR-182-5p in LUSC. In LUSC, EPAS1 plays the role of a HIF [
44]. According to recent studies, the high level of EPAS1 expression could lead to a poor prognosis by increasing the tumor size and angiogenesis [
43,
45,
46]. These findings are consistent with the conclusions of our current study.
PRKCE, which consists of 32 exons, is a member of the protein kinase C (PKC) family and regulates the formation of protein kinase C epsilon type (PKCε) [
47]. According to our statistical analysis, the high miR-182-5p expression in LUSC is accompanied by the low expression of PRKCE. As an enzyme, PKCε influences many cellular functions, such as growth, division, and transcription factor regulation [
48‐
50]. Wang et al. [
51] discovered that PKCε is oncogenic and associated with the occurrence of lung cancer. They also found that PRKCE increases PKCε expression in LUSC.
NR3C1 is also known as GR or GCR and encodes a glucocorticoid receptor to participate in inflammation, cell proliferation, and differentiation [
52]. NR3C1 plays an anti-inflammatory role in the development and metastasis of LUSC [
53,
54]. Therefore, NR3C1 is important for inhibiting tumor progression.
RHOB belongs to the Ras homolog gene family. RHOB plays a role in cell proliferation and survival [
55]. RHOB also inhibits tumor growth. If RHOB is lacking, the tumor frequency increases [
56]. A recent study found that the lack of RHOB often occurs in LUSC [
57]. According to our study, the expression of RHOB is downregulated in LUSC, consistent with the report by Mazières et al. [
56].
According to the present study, miR-182-5p is upregulated in LUSC and plays a pivotal role in the process of LUSC. Through our research, miR-182-5p is found that it is involved in several biological processes to inhibit LUSC progression and improve the cure rate, and it can offer a new idea of LUSC diagnosis and therapy in molecular mechanism to us.
Acknowledgements
We expressed sincere thanks to the patients included in this study, the research group members(Wei-luan Cen, Xiang Gao, Peng Chen, Li Gao, Zu-cheng Xie), the target gene prediction tools (miRWalk, Microt4, miRanda, mirbridge, miRDB, miRMap, miRNAMap, Pictar2, PITA, RNA22, RNAhybrid, Targetscan and mirTarbase), and the TCGA, GEO, DAVID, and STRING databases.