Skip to main content
Erschienen in: Virology Journal 1/2017

Open Access 01.12.2017 | Research

Co-infection of two reoviruses increases both viruses accumulation in rice by up-regulating of viroplasm components and movement proteins bilaterally and RNA silencing suppressor unilaterally

verfasst von: Shu Li, Tong Zhang, Yingzhi Zhu, Guohui Zhou

Erschienen in: Virology Journal | Ausgabe 1/2017

Abstract

Background

Synergism between southern rice black-streaked dwarf virus (SRBSDV) and rice ragged stunt virus (RRSV) not only aggravates disease symptoms but also enhances their vector acquisition efficiencies by increasing both viruses’ titers in co-infected rice plants, which may exacerbate the epidemic of both viruses and cause significant damage to rice production. The molecular mechanism of viral synergism of these two viruses remains unexplored.

Methods

Single and double infection of SRBSDV and RRSV were obtained with the viruliferous white-backed planthopper and brown planthopper inoculation on four-leaf stage rice seedlings, respectively, under experimental condition. The second upper leaf from each inoculated rice plants were collected at 9, 15, and 20 days post inoculation (dpi) and used for relative quantification of 13 SRBSDV genes and 11 RRSV genes by the reverse-transcription quantitative PCR. Viral gene expression levels were compared between singly and doubly infected samples at the same stage.

Results

The movement protein and viroplasm matrix-related genes as well as the structural (capsid) protein genes of both viruses were remarkably up-regulated at different time points in the co-infected rice plants compared with the samples singly infected with SRBSDV or RRSV, however, the RNA silencing suppressor (P6) of only RRSV, but not of both the viruses, was up-regulated.

Conclusions

The SRBSDV-RRSV synergism promoted replication and movement of both viruses and inhibited the host immunity by enhancing the gene suppressing effect exerted by one of them (RRSV).
Begleitmaterial
Additional file 1: Figure S1. The expression levels of structural protein genes of SRBSDV (P1 to P4, P8 and P10) at 9, 15 and 20 dpi in SRBSDV-infected and co-infected rice. Besides P10, which was significantly up-regulated (Fig. 4), the remaining genes were slightly up-regulated at 9, 15 and 20 dpi in co-infected plants. Vertical bars correspond to error bars indicating standard deviation (Bonferroni’s honestly significant difference test, P = 0.05). (JPEG 300 kb)
Additional file 2: Figure S2. The expression levels of structural protein genes of RRSV (P1 to P5, P8 and P9) at 9, 15 and 20 dpi in RRSV-infected and co-infected rice. Besides P3 at 15 and 20 dpi (Fig. 2), and P8 at 9, 15 and 20 dpi (Fig. 4), which were significantly up-regulated, the remaining genes were slightly up-regulated at 9, 15 and 20 dpi in co-infected plants. Vertical bars correspond to error bars indicating standard deviation (Bonferroni’s honestly significant difference test, P = 0.05). (JPEG 309 kb)
Additional file 3: Figure S3. The expression levels of non-structural protein genes of SRBSDV (P5-1, P5-2, P7-1, P7-2, P9-1 and P9-2) at 9, 15 and 20 dpi in SRBSDV-infected and co-infected rice. Besides P5-1 at 15 dpi (Fig. 1), P7-1 at 15 and 20 dpi (Fig. 3) and P9-1 at 9, 15 and 20 dpi (Fig. 1), which were significantly up-regulated, the remaining genes were slightly up-regulated at 9, 15 and 20 dpi in co-infected plants. Vertical bars correspond to error bars indicating standard deviation (Bonferroni’s honestly significant difference test, P = 0.05). (JPEG 225 kb)
Additional file 4: Figure S4. The expression levels of non-structural protein genes of RRSV (P6, P7 and P10) at 9, 15 and 20 dpi in RRSV-infected and co-infected rice. P7 was slightly up-regulated at 9, 15 and 20 dpi, while P6 at 9, 15 and 20 dpi, and P10 at 15 dpi (Fig. 2) were significantly up-regulated in co-infected plants. Vertical bars correspond to error bars indicating standard deviation (Bonferroni’s honestly significant difference test, P = 0.05). (JPEG 203 kb)
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12985-017-0819-0) contains supplementary material, which is available to authorized users.
Abkürzungen
BPH
Brown planthopper
CP
Capsid protein
Dpi
Days post inoculation
dsRNA
double stranded RNA
MP
Movement protein
ORF
Open reading frame
RdRp
RNA-dependent RNA polymerase
RRSV
Rice ragged stunt virus
RSS
RNA silencing suppressor
RT-qPCR
Reverse transcription-quantitative PCR
SRBSDV
Southern rice black-streaked dwarf virus
WBPH
White-backed planthopper

Background

Southern rice black-streaked dwarf virus (SRBSDV) and Rice ragged stunt virus (RRSV) are members of Reoviridae family. SRBSDV is a novel species in genus Fijivirus and transmitted by the white-backed plant hopper (WBPH, Sogatella furcifera), while RRSV belongs to the genus Oryzavirus and is vectored by the brown plant hopper (BPH, Nilaparvata lugens); both vectors, the two major long-distance migratory rice pests in south and southeast Asia, transmit these viruses in a persistent, circulative-propagative manner [1, 2]. SRBSDV was first discovered in China in 2001 and was identified in 2008 [3], and has become one of most important disease in southern china, northern Vietnam and Japan in recent years [4, 5]. RRSV was first described in Indonesia in 1977 [1] and reported in China in 1978 with only scattered distribution and occasional outbreaks [6]. However, RRSV occurrence became prominent recently with the co-infection of SRBSDV, probably due to elevated vector acquisition efficiency induced by the synergism of these two viruses [7].
The SRBSDV genome has ten linear double-stranded RNA (dsRNA) segments containing 13 open reading frames (ORFs), which putatively encode six structural proteins (P1 to P4, P8 and P10) and seven non-structural proteins (P5-1, P5-2, P6, P7-1, P7-2, P9-1 and P9-2). Based on the results analyzed by bioinformatics, the P1 is an RNA-dependent RNA polymerase (RdRP), P2 is a major core structural protein, P3 is an outer shell B-spike protein, P4 is a capping protein, P8 is a minor core protein and P10 is a major outer-capsid protein [8]. P6 was identified as a viral RNA silencing suppressor (RSS) [9] and might participate in viroplasm formation with P5-1 and P9-1 [10, 11]. P7-1 is the major component of the tubules and probably a viral movement protein (MP) [12]. The functions of P5-2, P7-2 and P9-2 remain unknown.
The RRSV genome contains ten dsRNA segments with 11 ORFs putatively encoding eight structural proteins (P1 to P3, P4a, P5, P8 and P9) and three non-structural proteins (P6, P7 and P10). Among the structural proteins, P1 is a major core structural protein and P2 has been reported to be a putative guanylyl transferase [13]. P3 is a capsid shell protein and P4a putatively functions as an RdRp [14]. P5 appears to be a guanyltransferase associated with 5′-capping in the processes of viral replication and transcription [15]. P8 has been identified as a major outer-capsid protein [16, 17]. P9 contributes as a spike protein refer to transmission by the insect vector [18]. Among the non-structural proteins of RRSV, P6 functions as a viral RSS and a MP [19], P7 is a NTP-binding protein [20] and P10 is a component of viroplasm [21]. The in vivo production and possible function of P4b is yet to be determined.
Our previous report found that synergism between SRBSDV and RRSV increased both virus titers in co-infected rice plants [7]. However, the molecular mechanism of viral synergism of the two viruses remains unexplored. In this study, we compared the expression levels of the viral genes between the rice plants singly infected with SRBSDV or RRSV and those with co-infection of both viruses at different disease stages using the reverse-transcription quantitative polymerase chain reaction (RT-qPCR). We found that compared with rice plants infected by SRBSDV or RRSV individually, the expression levels of some genes involved in SRBSDV and RRSV viroplasm formation were significantly up-regulated, and yet, of the RSSs of the two viruses, only P6 of RRSV was up-regulated, while some of the structural genes of both viruses were up-regulated. These findings suggest that synergism of SRBSDV and RRSV stimulates replication and movement of both viruses and weakens the host immunity through the RSS function of one of them, which result in an increase in both viruses’ titers in doubly infected rice plants.

Methods

Test plants, viruses, and insects

The seeds of a rice cultivar ‘Qiuyou-998’ used in this research were maintained in our laboratory. The seeds were germinated by soaking in warm water, then sown in a plastic box sized 50 cm long, 25 cm wide and 8 cm high. The seedlings with uniform growth were individually transplanted into a culture tube half-filled with the nutrient solution culture (pH 4.5 ~ 5.0) when they were in the four-leaf stage [22]. The seedlings were allowed to grow in an incubator under the conditions of 28 °C and 16 h light/8 h dark.
The isolates of SRBSDV and RRSV were collected from diseased field in Guangzhou, Guangdong Province, China. Both isolates were transmitted to a number of Qiuyou-998 rice plants by WBPH and BPH, and grown in insect-proof greenhouses.
Five fourth-stage nymphs of WBPH or BPH, which breed on SRBSDV or RRSV infected rice plants for two or three generations, were collected and then moved to each rice seedling at four-leaf stage. SRBSDV or RRSV singly infected rice plants were derived from rice seedlings inoculated with viruliferous WBPHs or BPHs, respectively, SRBSDV and RRSV co-infected rice plants were derived from rice seedlings inoculated with both viruliferous insects. At least 30 rice seedlings were used in each inoculation. All the insects were removed manually after a 24-h exposure. Second upper leaf from each inoculated rice plants were collected at 9, 15, and 20 days after the 24-h insect exposure (days post inoculation, dpi), enclosed with aluminium foil paper, and put in a refrigerator of −70 °C after liquid nitrogen freezing. SRBSDV or/and RRSV were detected in all inoculated rice plants at 20 dpi by RT-PCR using a One Step RNA PCR kit (AMV) (TaKaRa, Dalian, China) and specific primers for SRBSDV and RRSV according to Wang et al. [23]. Rice plants postitive for SRBSDV or RRSV and both viruses were defined as singly and co-infected rice plants. In total, 12 plants from each infection treatment were used for viral gene expression experiments.

RT- qPCR detection

Trizol RNAiso Plus (Invitrogen, Boston, MA) were used for total RNA extraction from frozen leaves from SRBSDV or RRSV singly or co-infected rice plants, and then treated with DNase I (TaKaRa). Spectrophotometry was used to determine the concentration and purity of the total RNA. Total RNA samples with A260/A280 and A260/A230 of 1.9 to 2.1 and greater than 2.0, respectively, can be used as templates for RT-qPCR.
Primer Express (version 3.0; Applied Biosystems, Foster City, CA) was used to design the RT-qPCR primers (Table 1) based on 13 and 11 genes of SRBSDV and RRSV, respectively. The U6 small nuclear RNA gene of rice was used as a housekeeper or control genes for RT-qPCR (Table 1).
Table 1
Reverse-transcription quantitative polymerase chain reaction primers used for quantification of southern rice black-streaked dwarf virus (SRBSDV) and rice ragged stunt virus (RRSV)
Purpose
Gene name
Target gene (GenBank accession no.)
Primer for RT-qPCR(5′-3′)
Size of expected amplicon (bp)
RRSV
RRSV P1
HM125559
AGGATCTCTTCTCAATGCAAGC
70
AACTTCCACCTGGCAACGTC
RRSV P2
HM125560
GGCGTTCGATCTCGTGTTTAA
69
GCGGGAAAATCATTGGCGTG
RRSV P3
AF020336
TCAAAGCTAGTGATGAGCGTCTGT
70
CTGGCATAAAAACGAAGAGTCTGA
RRSV P4A
HM125562
GGCGTCAGTGTGTAGCAGCAT
66
ATTGGGTAGAGTTGTTGTTTTGGAT
RRSV P4B
HM125562
CGCCATCCACAAAGCTATCA
63
AACACTCTCGTAGCCTGCCAAT
RRSV P5
HM125562
CGCCATCCACAAAGCTATCA
59
AACACTCTCGTAGCCTGCCAAT
RRSV S5
HM125543
GGCGGCATCGGGTTGT
59
CACCTCTATCAAACGCAGTAACCA
RRSV S6
HM125554
GCTTTCGCGGTGCTCAA
59
CTCCCAATTACGCACCGAAT
RRSV P7
HM125555
TGACGATTACGCCGAGACAAG
62
CGGACGACTGGCCAATG
RRSV P8
HM125546
GGCTGAGCGTGCGGTTA
66
TCAGCCTTGATATCGTTGTAGCA
RRSV P9
L79969
GGTGTGGCTCTACAACAAATGG
67
ACGCCTCTTTCTCTGCTCCTCTA
RRSV P10
HM125568
CCGAGCCGCCATCATAGTA
63
ACCTCAAAAACTCCAGACAGCATA
SRBSDV
SRBSDV P1
JQ692572
TGTGATTTGAACTCAGAGACAGCTTTA
80
TGACGTTGATAAGTTGATTGTTGAGA
SRBSDV P2
HM585278
GCGAACGGCTTTCTGCTTT
71
GAATGTGCGAGTGATTTCATGAA
SRBSDVP3
HM585277
TCCCGGTGTTCGAGAAGTTC
64
CAGCATTTTCCATCCAACCAT
SRBSDV P4
HM585276
TCAACGCTCGACAACCAAAA
72
TTATCGTGATATCTGCTACGAATACCA
SRBSDV P5-1
HM585275
ATCAGATGATAACCTCAATCGTACCA
94
TGAGCCAGTGAAGGTAATCATCATTA
SRBSDV P5-2
CGCTTAACAATTGTCGTGATATGAA
75
GCGTGCTTCCGAAAAGTAAAGTT
SRBSDV P6
HM585274
AAGCAACAAACATCAACGTCAAA
69
AACTACGTCGGCCCATGAAC
SRBSDV P7-1
HM58527
CCTAATGAAAACCCATCTACCTGTAAC
70
CACGAATAAACATCAGCGACAAA
SRBSDV P7-2
CAAATATTTAGTAGAAGCAGAACGCAAGT
61
ACATCTTTTTCGTCTTTCTCATACTCTTAA
SRBSDV P8
HM585272
GATTGTCTCCTTTGGATGATGTTG
72
CCTGTCCTTCTTGAAATACACGTAAC
SRBSDV P9-1
HM585271
TGAAAGCGAATCCTCAACTAAAGA
68
TTGAATCAGTGGAGGTGGGTTT
SRBSDV P9-2
CGAGATGAGCGATTCTGGTTT
70
TTCGTGAATGATGTTGTTAACCTTTT
SRBSDV P10
EU784840
TCATCATTAGCGCGACTAGTTCA
64
CGTCACTCGGCGTCGATAA
Reference
U6
S83742
CGATAAAATTGGAACGATACAGA
72
ATTTGGACCATTTCTCGATTTGT
A PrimeScript RT reagent kit (TaKaRa) was used to reverse-transcribed the total RNA into cDNA. cDNA were synthesized using 2 μL of 5× RT buffer, 0.5 μL of RT Enzyme Mix I, 0.5 μL of oligo dT, 6 μL of RNase-free double-distilled (ddH2O), and 2 μg total RNA, the reaction was conducted at 42 °C for 15 min followed by 95 °C for 2 min. The qPCR was performed on a Cycler Dice Real Time System TP800 (TaKaRa) using 2 ng of cDNA, 0.5 μL each of the forward and reverse primers (10 μM), 12.5 μL of SYBR Premix Ex Taq II, and 9.5 of RNase-free ddH2O. The reactions were run for 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. No-template reaction that replacing cDNA with RNase-free ddH2O was used as negative control and the U6 small nuclear RNA gene of rice was used as a housekeeper or control genes for all detections. A 10-fold gradient dilution of cDNA was used to construct a dissolution curve and a relative standard curve for determining the specificity and amplification efficiency of each primer. All primers had a single peak for dissolution curve and exhibited 90% to 110% amplification efficiency in all reactions. Analysis of relative genes expression data using 2 − ΔΔCt method. At least six rice plants were used for each treatment, and each reaction was run in triplicate.

Statistical analysis

The statistical software package SPSS 19.0 (IBM, Armonk, NY) was used to analyze the experimental data. A t-test with Bonferroni correction was used to compare gene relative expression levels in different treatment at the same stage.

Results

The expression levels of genes involved in the formation of viroplasms of both viruses were significantly up-regulated in SRBSDV and RRSV co-infected rice

The expression levels of three genes involved in the formation of SRBSDV viroplasms (P5-1, P6 and P9-1) were compared between SRBSDV singly infected and co-infected rice plants. No significant difference in the expression levels of P5-1 at 9 dpi was found between SRBSDV-infected rice plants and those co-infected with RRSV, but P5-1 was up-regulated 1.44 times at 15 dpi (F = 3.442, df = 6, P = 0.583) and 1.15 times at 20 dpi (F = 1.229, df = 6, P = 0.064) in co-infected plants. The expression of P9-1 was significantly up-regulated at all three tested disease progression time points; 1.62 times at 9 dpi (F = 2.307, df = 10, P = 0.003), 1.32 times at 15 dpi (F = 1.628, df = 8, P = 0.002) and 1.23 times at 20 dpi (F = 0.905, df = 10, P = 0.006). The expression levels of P6 showed no significant changes at any of the tested time points (Fig. 1).
The expression levels of three genes involved in viroplasm formation of RRSV (P3, P6 and P10) were compared in RRSV-infected and co-infected rice plants. The expression of P3 was up-regulated 1.29 times at 9 dpi (F = 0.342, df = 10, P = 0.592), 1.53 times at 15 dpi (F = 2.286, df = 8, P = 0.020) and 1.34 times at 20 dpi (F = 0.132, df = 8, P = 0.050). The expression of P6 was significantly up-regulated at all three tested disease progression time points; 1.43 times at 9 dpi (F = 0.456, df = 10, P = 0.018), 1.7 times at 15 dpi (F = 0.407, df = 10, P = 0.001), and 1.29 times at 20 dpi (F = 0.132, df = 10, P < 0.001). The expression level of P10 was also up-regulated at all three time points, 1.16 times at 9 dpi (F = 0.314, df = 10, P = 0.114), 1.25 times at 15 dpi (F = 1.026, df = 10, P < 0.000), and 1.19 times at 20 dpi (F = 0.004, df = 10, P = 0.098), in co-infected plants (Fig. 2).

The expression level of viral RSS gene of RRSV was unilaterally up-regulated in SRBSDV and RRSV co-infected rice

The P6 proteins of SRBSDV and RRSV have been identified as the RSSs of these two viruses [12, 19]. No significant difference in the expression levels of SRBSDV P6 was found between SRBSDV-infected plants and those co-infected with RRSV at any of the tested disease progression time points (Fig. 1). However, the expression level of RRSV P6 was significantly up-regulated at 9, 15 and 20 dpi (Fig. 1).

The expression levels of viral MP genes of both SRBSDV and RRSV were up-regulated in SRBSDV and RRSV co-infected rice

P7-1 of SRBSDV was previously determined to be a viral MP [12]. It was up-regulated at all three tested time points in SRBSDV and RRSV co-infected plants. At 9 dpi, it was slightly up-regulated (F = 4.738, df = 10, P = 0.126), but at 15 dpi and 20 dpi, it was significantly up-regulated by 1.92 times (F = 1.937, df = 10, P = 0.010) and 1.23 times (F = 8.571, df = 10, P < 0.001), respectively, in co-infected rice compared with SRBSDV singly infected rice (Fig. 3). P6 of RRSV was also indentified as a viral MP [19], and it was significantly up-regulated at 9, 15 and 20 dpi in co-infected rice (Fig. 2).

The expression levels of viral CPs of both SRBSDV and RRSV were unilaterally up-regulated in SRBSDV and RRSV co-infected rice

Compared with SRBSDV or RRSV single infection, the expression levels of all structural protein genes of both SRBSDV and RRSV were up-regulated to various degrees in co-infected plants (Additional file 1: Figure S1 and Additional file 2: Figure S2). Among them, changes in the expression levels of SRBSDV P10 and RRSV P8 reached statistically significant level (Fig. 4). SRBSDV P10 was slightly up-regulated at 9 dpi (F = 0.420, df = 10, P = 0.085) and significantly up-regulated 2.06 times at 15 dpi (F = 1.116, df = 10, P = 0.029) and 1.43 times at 20 dpi (F = 13.658, df = 10, P = 0.004) in co-infected plants. RRSV P8 was significantly up-regulated at all three tested disease progression time points, 1.44 times at 9 dpi (F = 0.005, df = 16, P = 0.040), 1.76 times at 15 dpi (F = 2.442, df = 26, P < 0.001), and 1.41 times at 20 dpi (F = 0.132, df = 8, P = 0.050), in co-infected plants (Fig. 4).

Discussion

SRBSDV and RRSV, which are both in the family Reoviridae, have for the past few years caused serious rice disease in eastern and southeastern Asia. Our prior studies have shown that there is a synergistic interaction between SRBSDV and RRSV [7]. Rice plants co-infected with both viruses display aggravated symptoms, while the titers of both viruses and the acquisition efficiencies of both vectors are increased, which is of great epidemiological importance. However, there has not been sufficient research on the mechanism of synergistic interaction between plant viruses in the same family. Hence, we studied the expression levels of all genes of SRBSDV and RRSV at three representative stages of the disease course (9, 15 and 20 dpi), in order to expand our knowledge of the synergistic interaction between two viruses in the same family.
On the basis of previous research, SRBSDV is a dsRNA virus, 3′ end of the genome lacks poly-A tail [3]. In this research, the single-stranded cDNA templates of 13 genes of SRBSDV and 11 genes of RRSV were simultaneously synthesized using oligo-dT anchor primers according to He et al. [24], to avoid confusion between the virus genomes and transcripts.
The expression levels of P5-1, P7-1, P9-1 and P10 of SRBSDV and P3, P6, P8 and P10 of RRSV were significantly up-regulated in co-infected rice. These up-regulated genes include some genes associated with the formation of the viral factory (viroplasm) matrix (P5-1 and P9-1 of SRBSDV and P3, P6 and P10 of RRSV) [10, 11, 14, 19, 21], viral MPs (P7-1 of SRBSDV and P6 of RRSV) [12, 19] and viral CPs (P10 of SRBSDV and P8 of RRSV) [3, 17]. These up-regulated genes may play crucial roles in the synergism between SRBSDV and RRSV, and their upregulation also shows that co-infection increased both virus titers and facilitated the replication and movement of both viruses, which is consistent with our previous research [7].
RNA silencing functions as an antiviral defense response to virus genome expression, replication, and movement in plants, likewise, plant virus generally encode RSS to suppress host silencing that enable virus establish systemic infection in plants [25, 26]. Some research have shown that the function of viral RSSs often involved in synergism of plant virus [2529]. Interestingly, the P6 proteins of SRBSDV and RRSV have been identified as the RSSs of these two viruses [9, 19], but only the expression level of protein P6 of RRSV was significantly up-regulated in co-infected plants. This unilateral influence mechanism is related to different silencing effects of the two viruses RSSs or effects in different nodes of the RNAi pathway. Thus, whether P6 of RRSV mediates the synergism between SRBSDV and RRSV and its possible mechanism deserve further study.
Compared with SRBSDV or RRSV single infection, most of the genes involved in viroplasm formation of SRBSDV and RRSV were significantly up-regulated in co-infected plants. Previous studies have shown that P6 of SRBSDV can interact with itself and P5-1, and might format the viroplasm by recruiting P9-1 [10, 11]. For RRSV, P10 is essential for viroplasm formation and virus replication; it can recruit P6 into viroplasm-like structures when these two proteins are co-expressed in Sf9 cells [21]. This study showed that the genes involved in viroplasm formation were up-regulated in co-infected plants; from another perspective, it proves that the replication levels of both viruses were enhanced. Importantly, however, the upregulation pattern of viroplasm-related genes varied in timing. At 9 dpi, only P9-1 of SRBSDV and P6 of RRSV were significantly up-regulated in co-infected plants, suggesting that these two genes might be the main limiting factors at the initial stage of viroplasm formation; viroplasms began to form only if the expression of these two genes reached a critical level. The expression of the other genes was significantly up-regulated at 15 or 20 dpi, suggesting that different genes become important at different stages of the formation and expansion of the viroplasm. In addition, the genes up-regulated at different times are likely to improve the interaction between the viroplasm-related genes, thereby enhancing the replication efficiency of the two viruses in co-infected plants.
Increasing amounts of experimental evidence show that, although MPs of different plant virus share lower sequence homology, they are functional commonalities. Consequently, the viral MPs of distinct species, and even distinct genus, can complement movement deficiency of each other and mediate the systemic movement and synergism of heterologous viruses [3032]. P7-1 of SRBSDV and P6 of RRSV are recognized as viral MPs [12, 19]. These genes were significantly up-regulated at 9, 15 and 20 dpi in co-infected plants, which may facilitate the movement and spread of the two viruses, thereby exacerbating the symptoms of co-infected rice plants.
In this study, we found that the expression of viroplasm-related genes, the MP and CP genes were significantly up-regulated in the co-infected rice plants, but the expression levels of the other viral genes were not significantly affected by co-infection (Additional file 1: Figure S1, Additional file 2: Figure S2, Additional file 3: Figure S3 and Additional file 4: Figure. S4). It may indicate that the enhanced virion replication happens at low expression levels of these other genes.

Conclusions

Compared with the samples singly infected with SRBSDV or RRSV, the viral movement protein and viroplasm matrix-related genes as well as the structural (capsid) protein genes of the two viruses were remarkably up-regulated bilaterally at different time points in the co-infected rice plants, while the RNA silencing suppressor (P6) of only RRSV, but not of both the viruses, was up-regulated. We therefore proposed that the SRBSDV-RRSV synergism promoted replication and movement of both the viruses and inhibited the host immunity by enhancing the gene suppressing effect exerted by one of them (RRSV), leading to an increase of both viruses’ titers in the co-infected rice plants.

Acknowledgements

We thank Jingxian Xue for her excellent work in growth chamber and lab maintenance.

Funding

This research was supported by the National Natural Science Foundation of China (31272012) and the Special Fund for Agroscientific Research in the Public Interest of China (201303021).

Availability of data and materials

Not applicable.
Not applicable.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Anhänge

Additional files

Additional file 1: Figure S1. The expression levels of structural protein genes of SRBSDV (P1 to P4, P8 and P10) at 9, 15 and 20 dpi in SRBSDV-infected and co-infected rice. Besides P10, which was significantly up-regulated (Fig. 4), the remaining genes were slightly up-regulated at 9, 15 and 20 dpi in co-infected plants. Vertical bars correspond to error bars indicating standard deviation (Bonferroni’s honestly significant difference test, P = 0.05). (JPEG 300 kb)
Additional file 2: Figure S2. The expression levels of structural protein genes of RRSV (P1 to P5, P8 and P9) at 9, 15 and 20 dpi in RRSV-infected and co-infected rice. Besides P3 at 15 and 20 dpi (Fig. 2), and P8 at 9, 15 and 20 dpi (Fig. 4), which were significantly up-regulated, the remaining genes were slightly up-regulated at 9, 15 and 20 dpi in co-infected plants. Vertical bars correspond to error bars indicating standard deviation (Bonferroni’s honestly significant difference test, P = 0.05). (JPEG 309 kb)
Additional file 3: Figure S3. The expression levels of non-structural protein genes of SRBSDV (P5-1, P5-2, P7-1, P7-2, P9-1 and P9-2) at 9, 15 and 20 dpi in SRBSDV-infected and co-infected rice. Besides P5-1 at 15 dpi (Fig. 1), P7-1 at 15 and 20 dpi (Fig. 3) and P9-1 at 9, 15 and 20 dpi (Fig. 1), which were significantly up-regulated, the remaining genes were slightly up-regulated at 9, 15 and 20 dpi in co-infected plants. Vertical bars correspond to error bars indicating standard deviation (Bonferroni’s honestly significant difference test, P = 0.05). (JPEG 225 kb)
Additional file 4: Figure S4. The expression levels of non-structural protein genes of RRSV (P6, P7 and P10) at 9, 15 and 20 dpi in RRSV-infected and co-infected rice. P7 was slightly up-regulated at 9, 15 and 20 dpi, while P6 at 9, 15 and 20 dpi, and P10 at 15 dpi (Fig. 2) were significantly up-regulated in co-infected plants. Vertical bars correspond to error bars indicating standard deviation (Bonferroni’s honestly significant difference test, P = 0.05). (JPEG 203 kb)
Literatur
1.
Zurück zum Zitat Hibino H, Roechan M, Sudarisman S, Tantera DM. A virus disease of rice (Kerdil hampa) transmitted by brown planthopper, Nilaparvata lugens Stal in Indonesia. Contr Centr Res Inst Agric. 1977;35:1–15. Hibino H, Roechan M, Sudarisman S, Tantera DM. A virus disease of rice (Kerdil hampa) transmitted by brown planthopper, Nilaparvata lugens Stal in Indonesia. Contr Centr Res Inst Agric. 1977;35:1–15.
2.
Zurück zum Zitat Pu LL, Xie GH, Ji CY, Ling B, Zhang MX, Xu DL, Zhou GH. Transmission characters of Southern rice black-streaked dwarf virus by rice planthoppers. Crop Prot. 2012;41:71–6.CrossRef Pu LL, Xie GH, Ji CY, Ling B, Zhang MX, Xu DL, Zhou GH. Transmission characters of Southern rice black-streaked dwarf virus by rice planthoppers. Crop Prot. 2012;41:71–6.CrossRef
3.
Zurück zum Zitat Zhou GH, Wen JJ, Cai DJ, Li P, Xu DL, Zhang SG. Southern rice black-streaked dwarf virus: a new proposed Fijivirus species in the family Reoviridae. Chin Sci Bull. 2008;53:3677–85.CrossRef Zhou GH, Wen JJ, Cai DJ, Li P, Xu DL, Zhang SG. Southern rice black-streaked dwarf virus: a new proposed Fijivirus species in the family Reoviridae. Chin Sci Bull. 2008;53:3677–85.CrossRef
5.
Zurück zum Zitat Matsukura K, Towata T, Sakai J, Onuki M, Okuda M, Matsumura M. Dynamics of Southern rice black-streaked dwarf virus in rice and implication or virus acquisition. Phytopathology. 2013;103:509–12.CrossRefPubMed Matsukura K, Towata T, Sakai J, Onuki M, Okuda M, Matsumura M. Dynamics of Southern rice black-streaked dwarf virus in rice and implication or virus acquisition. Phytopathology. 2013;103:509–12.CrossRefPubMed
6.
Zurück zum Zitat Zhou LG, Du JY, Li XR, Cao L. Research on the Rice ragged dwarf virus in Guangdong. J Guangdong Agric Sci. 1982;3:31–4. Zhou LG, Du JY, Li XR, Cao L. Research on the Rice ragged dwarf virus in Guangdong. J Guangdong Agric Sci. 1982;3:31–4.
7.
Zurück zum Zitat Li S, Wang H, Zhou GH. Synergism between Southern rice black-streaked dwarf virus and Rice ragged stunt virus enhances their insect vector acquisition. Phytopathology. 2014;104:794–9.CrossRefPubMed Li S, Wang H, Zhou GH. Synergism between Southern rice black-streaked dwarf virus and Rice ragged stunt virus enhances their insect vector acquisition. Phytopathology. 2014;104:794–9.CrossRefPubMed
8.
Zurück zum Zitat Wang Q, Yang J, Zhou GH, Zhang HM, Chen JP, Adams MJ. The complete genome sequence of two isolates of Southern rice black-streaked dwarf virus, a new fijivirus. J Phytopathol. 2010;158:733–7.CrossRef Wang Q, Yang J, Zhou GH, Zhang HM, Chen JP, Adams MJ. The complete genome sequence of two isolates of Southern rice black-streaked dwarf virus, a new fijivirus. J Phytopathol. 2010;158:733–7.CrossRef
9.
Zurück zum Zitat Lu YH, Zhang JF, Xiong RY, Xu QF, Zhou YJ. Identification of an RNA silencing suppressor encoded by Southern rice black- streaked dwarf virus S6. Sci Agric Sin. 2011;44:2909–17. Lu YH, Zhang JF, Xiong RY, Xu QF, Zhou YJ. Identification of an RNA silencing suppressor encoded by Southern rice black- streaked dwarf virus S6. Sci Agric Sin. 2011;44:2909–17.
10.
Zurück zum Zitat Li J, Xue J, Zhang HM, Yang J, Lv MF, Xie L. Interactions between the P6 and P5- 1 proteins of southern rice black- streaked dwarf fijivirus in yeast and plant cells. Arch Virol. 2013;158:1649–59.CrossRefPubMed Li J, Xue J, Zhang HM, Yang J, Lv MF, Xie L. Interactions between the P6 and P5- 1 proteins of southern rice black- streaked dwarf fijivirus in yeast and plant cells. Arch Virol. 2013;158:1649–59.CrossRefPubMed
11.
Zurück zum Zitat Mao Q, Zheng S, Han Q, Chen H, Ma Y, Jia D, Chen Q, Wei T. New model for the genesis and maturation of viroplasms induced by fijiviruses in insect vector cells. J Virol. 2013;87:6819–28.CrossRefPubMedPubMedCentral Mao Q, Zheng S, Han Q, Chen H, Ma Y, Jia D, Chen Q, Wei T. New model for the genesis and maturation of viroplasms induced by fijiviruses in insect vector cells. J Virol. 2013;87:6819–28.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Liu Y, Jia D, Chen H, Chen Q, Xie L, Wu Z, Wei T. The P7-1 protein of Southern rice black-streaked dwarf virus, a fijivirus, induces the formation of tubular structures in insect cells. Arch Virol. 2011;156:1729–36.CrossRefPubMed Liu Y, Jia D, Chen H, Chen Q, Xie L, Wu Z, Wei T. The P7-1 protein of Southern rice black-streaked dwarf virus, a fijivirus, induces the formation of tubular structures in insect cells. Arch Virol. 2011;156:1729–36.CrossRefPubMed
13.
Zurück zum Zitat Supyani S, Hillman BI, Suzuki N. Baculovirus expression of the 11 mycoreovirus-1 genome segments and identification of the guanylyltransferase-encoding segment. J Gen Virol. 2007;88:342–50.CrossRefPubMed Supyani S, Hillman BI, Suzuki N. Baculovirus expression of the 11 mycoreovirus-1 genome segments and identification of the guanylyltransferase-encoding segment. J Gen Virol. 2007;88:342–50.CrossRefPubMed
14.
Zurück zum Zitat Upadhyaya NM, Ramm K, Gellatly JA, Li Z, Kositratana W, Waterhouse PM. Rice ragged stunt oryzavirus genome segment S4 could encode an RNA dependent RNA polymerase and a second protein of unknown function. Arch Virol. 1998;143:1815–22.CrossRefPubMed Upadhyaya NM, Ramm K, Gellatly JA, Li Z, Kositratana W, Waterhouse PM. Rice ragged stunt oryzavirus genome segment S4 could encode an RNA dependent RNA polymerase and a second protein of unknown function. Arch Virol. 1998;143:1815–22.CrossRefPubMed
15.
Zurück zum Zitat Li Z, Upadhyaya NM, Kositratana W, Gibbs AJ, Waterhouse PM. Genome segment 5 of rice ragged stunt virus encodes a virion protein. J Gen Virol. 1996;77:3155–60.CrossRefPubMed Li Z, Upadhyaya NM, Kositratana W, Gibbs AJ, Waterhouse PM. Genome segment 5 of rice ragged stunt virus encodes a virion protein. J Gen Virol. 1996;77:3155–60.CrossRefPubMed
16.
Zurück zum Zitat Hagiwara K, Minobe Y, Nozu Y, Hibino H, Kimura I, Omura T. Component proteins and structures of rice ragged stunt virus. J Gen Virol. 1986;67:1711–5.CrossRef Hagiwara K, Minobe Y, Nozu Y, Hibino H, Kimura I, Omura T. Component proteins and structures of rice ragged stunt virus. J Gen Virol. 1986;67:1711–5.CrossRef
17.
Zurück zum Zitat Upadhyaya NM, Zinkowsky E, Li Z, Kositratana W, Waterhouse PM. The Mr 43K major capsid protein of rice ragged stunt oryzavirus is a post-translationally processed product of a Mr 67,348 polypeptide encoded by genome segment 8. Arch Virol. 1996;141:1689–701.CrossRefPubMed Upadhyaya NM, Zinkowsky E, Li Z, Kositratana W, Waterhouse PM. The Mr 43K major capsid protein of rice ragged stunt oryzavirus is a post-translationally processed product of a Mr 67,348 polypeptide encoded by genome segment 8. Arch Virol. 1996;141:1689–701.CrossRefPubMed
18.
Zurück zum Zitat Zhou GY, Lu XB, Lu HJ, Lei JL, Chen SX, Gong ZX. Rice ragged stunt oryzavirus: role of the viral spike protein in transmission by the insect vector. Ann Appl Biol. 1999;135:573–8.CrossRef Zhou GY, Lu XB, Lu HJ, Lei JL, Chen SX, Gong ZX. Rice ragged stunt oryzavirus: role of the viral spike protein in transmission by the insect vector. Ann Appl Biol. 1999;135:573–8.CrossRef
19.
Zurück zum Zitat Wu J, Du Z, Wang C, Cai L, Hu M, Lin Q, Wu Z, Li Y, Xie L. Identification of Pns6, a putative movement protein of RRSV, as a silencing suppressor. Virol J. 2010;7:1–6.CrossRef Wu J, Du Z, Wang C, Cai L, Hu M, Lin Q, Wu Z, Li Y, Xie L. Identification of Pns6, a putative movement protein of RRSV, as a silencing suppressor. Virol J. 2010;7:1–6.CrossRef
20.
Zurück zum Zitat Upadhyaya NM, Ramm K, Gellatly JA, Li Z, Kositratana W, Waterhouse PM. Rice ragged stunt oryzavirus genome segments S7 and S10 encode non-structural proteins of Mr 68,025 (Pns7) and Mr 32,364 (Pns10). Arch Virol. 1997;142:1719–26.CrossRefPubMed Upadhyaya NM, Ramm K, Gellatly JA, Li Z, Kositratana W, Waterhouse PM. Rice ragged stunt oryzavirus genome segments S7 and S10 encode non-structural proteins of Mr 68,025 (Pns7) and Mr 32,364 (Pns10). Arch Virol. 1997;142:1719–26.CrossRefPubMed
21.
Zurück zum Zitat Jia DS, Guo NM, Chen HY, Akita F, Xie LH, Omura T, Wei TY. Assembly of the viroplasm by viral non-structural protein Pns10 is essential for persistent infection of rice ragged stunt virus in its insect vector. J Gen Virol. 2012;93:2299–309.CrossRefPubMed Jia DS, Guo NM, Chen HY, Akita F, Xie LH, Omura T, Wei TY. Assembly of the viroplasm by viral non-structural protein Pns10 is essential for persistent infection of rice ragged stunt virus in its insect vector. J Gen Virol. 2012;93:2299–309.CrossRefPubMed
22.
Zurück zum Zitat Yoshida S, Forno DA, Gomez KA. Laboratory manual for physiological studies of rice. 3rd ed. Manila, Philippines: International Rice Research Institute; 1976. p. 61–4. Yoshida S, Forno DA, Gomez KA. Laboratory manual for physiological studies of rice. 3rd ed. Manila, Philippines: International Rice Research Institute; 1976. p. 61–4.
23.
Zurück zum Zitat Wang H, Xu DL, Pu LL, Zhou GH. Southern rice black-streaked dwarf virus alters insect vectors’ host orientation preferences to enhance spread and increase Rice ragged stunt virus coinfection. Phytopathology. 2014;104:196–201.CrossRefPubMed Wang H, Xu DL, Pu LL, Zhou GH. Southern rice black-streaked dwarf virus alters insect vectors’ host orientation preferences to enhance spread and increase Rice ragged stunt virus coinfection. Phytopathology. 2014;104:196–201.CrossRefPubMed
24.
Zurück zum Zitat He P, Liu JJ, He M, Wang ZC, Chen Z, Guo R, Correll JC, Yang S, Song BA. Quantitative detection of relative expression levels of the whole genome of Southern rice black-streaked dwarfvirus and its replication in different hosts. Virol J. 2013;10:136. doi:10.1186/1743-442X-10-136.CrossRefPubMedPubMedCentral He P, Liu JJ, He M, Wang ZC, Chen Z, Guo R, Correll JC, Yang S, Song BA. Quantitative detection of relative expression levels of the whole genome of Southern rice black-streaked dwarfvirus and its replication in different hosts. Virol J. 2013;10:136. doi:10.​1186/​1743-442X-10-136.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Alvarado V, Scholthof HB. Plant responses against invasive nucleic acids: RNA silencing and its suppression by plant viral pathogens. Semin Cell Dev Biol. 2009;20:1032–40.CrossRefPubMedPubMedCentral Alvarado V, Scholthof HB. Plant responses against invasive nucleic acids: RNA silencing and its suppression by plant viral pathogens. Semin Cell Dev Biol. 2009;20:1032–40.CrossRefPubMedPubMedCentral
26.
Zurück zum Zitat Dunoyer P, Voinnet O. The complex interplay between plant viruses and host RNA-silencing pathways. Curr Opin Plant Biol. 2005;8:415–23.CrossRefPubMed Dunoyer P, Voinnet O. The complex interplay between plant viruses and host RNA-silencing pathways. Curr Opin Plant Biol. 2005;8:415–23.CrossRefPubMed
27.
Zurück zum Zitat Pruss G, Ge X, Shi XM, Carrington JC, Vance VB. Plant viral synergism: the potyviral genome encodes a broad-range pathogenicity enhancer that transactivates replication of heterologous viruses. Plant Cell. 1997;9:859–68.CrossRefPubMedPubMedCentral Pruss G, Ge X, Shi XM, Carrington JC, Vance VB. Plant viral synergism: the potyviral genome encodes a broad-range pathogenicity enhancer that transactivates replication of heterologous viruses. Plant Cell. 1997;9:859–68.CrossRefPubMedPubMedCentral
28.
Zurück zum Zitat Srinivasan R, Alvarez JM. Effect of mixed viral infections (Potato virus Y-Potato leaf roll virus) on biology and preference of vectors Myzus persicae and Macrosiphum euphorbiae (Hemiptera: Aphididae). J Econ Entomol. 2007;100:646–55.CrossRefPubMed Srinivasan R, Alvarez JM. Effect of mixed viral infections (Potato virus Y-Potato leaf roll virus) on biology and preference of vectors Myzus persicae and Macrosiphum euphorbiae (Hemiptera: Aphididae). J Econ Entomol. 2007;100:646–55.CrossRefPubMed
29.
Zurück zum Zitat Takeshita M, Koizumi M, Noguchi M, Sueda K, Shimura H, Ishikawa N, Matsuura H, Ohshima K, Natsuaki T, Kuwata S, Furuya N, Tsuchiya K, Masuta C. Infection dynamics in viral spread and interference under the synergism between Cucumber mosaic virus and Turnip mosaic virus. Mol Plant-Microbe Interact. 2011;25:18–27.CrossRef Takeshita M, Koizumi M, Noguchi M, Sueda K, Shimura H, Ishikawa N, Matsuura H, Ohshima K, Natsuaki T, Kuwata S, Furuya N, Tsuchiya K, Masuta C. Infection dynamics in viral spread and interference under the synergism between Cucumber mosaic virus and Turnip mosaic virus. Mol Plant-Microbe Interact. 2011;25:18–27.CrossRef
30.
Zurück zum Zitat Atabekov JG, Taliansky ME. Expression of a plant virus-coded transport function by different viral genomes. Adv Virus Res. 1990;38:201–48.CrossRefPubMed Atabekov JG, Taliansky ME. Expression of a plant virus-coded transport function by different viral genomes. Adv Virus Res. 1990;38:201–48.CrossRefPubMed
31.
Zurück zum Zitat Ryabov EV, Robinson DJ, Taliansky ME. A plant virus-encoded protein facilitates long-distance movement of heterlogous RNA. Proc Natl Acad Sci U S A. 1999;96:1212–7.CrossRefPubMedPubMedCentral Ryabov EV, Robinson DJ, Taliansky ME. A plant virus-encoded protein facilitates long-distance movement of heterlogous RNA. Proc Natl Acad Sci U S A. 1999;96:1212–7.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Tomenius K. Function and localisation of movement proteins of Tobacco mosaic virus and Red clover mottle virus. NATO ASI series H: Cell biology; 1990. p. 249–59. Tomenius K. Function and localisation of movement proteins of Tobacco mosaic virus and Red clover mottle virus. NATO ASI series H: Cell biology; 1990. p. 249–59.
Metadaten
Titel
Co-infection of two reoviruses increases both viruses accumulation in rice by up-regulating of viroplasm components and movement proteins bilaterally and RNA silencing suppressor unilaterally
verfasst von
Shu Li
Tong Zhang
Yingzhi Zhu
Guohui Zhou
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2017
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/s12985-017-0819-0

Weitere Artikel der Ausgabe 1/2017

Virology Journal 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.