Background
Melanoma is a most aggressive and lethal form of skin cancer. The incidence of melanoma continues to increase and is always accompanied with poor survival worldwide [
1,
2]. The treatment of malignant melanoma, especially advanced and metastasized melanoma, remains high challenging due to its extensive metastasis, fast progression and limited effective drugs [
3]. There has been no indicated treatment to affect the disease’s outcome until now. Although adoptive cancer immunotherapy with transgenic T cell receptor engineered anti-tumor T cells has produced encouraging results, the efficacy of these approaches has to be improved [
4]. Thus, it is very urgent to develop an effective treatment for inhibiting melanoma metastasis. Recent studies have evidenced the reasonability of drug combinations as a promising strategy for melanoma treatment in preliminary [
5,
6].
Elevated expression of COX-2 is a common characteristic of many human carcinomas. COX-2 plays an important role in tumorigenesis as mediating the progression and metastasis of tumors, such as nasopharyngeal carcinoma [
7], hepatocellular carcinoma [
8], lung cancer [
9] and melanoma [
10]. The differential expression of COX-2 highly correlates to the progression of malignant melanoma [
11] and severely impairs the survival of patients [
12]. As previous reports, COX-2 regulates membrane permeability of B16-F10 cells via cPLA2 [
13] and COX-2 related signaling pathways have been confirmed involved in melanoma metastasis [
10,
14]. Celecoxib, as a highly selective COX-2 inhibitor, has been tested in many clinical trials, including pancreatic cancer [
15], nonmelanoma skin cancer [
16] and colorectal cancer [
17]. Celecoxib exhibits significant antitumor effects in COX-2 expressing and non-expressing melanoma cell lines through inducing apoptosis or inhibiting migration [
18]. The combination of Celecoxib with other drugs represents a new standard for melanoma treatment [
5]. For example, Celecoxib could enhance the inhibition of melanoma growth and metastasis by dacarbazine [
19]; Celecoxib and plumbagin shows synergistic inhibitory effects on melanoma tumor growth [
20]. In recent studies, targeted therapy with BRAF inhibitors displayed modest antitumor activity and amplified the pro-apoptotic activity of MEK inhibitors by inducing ER stress in NRAS-mutant melanoma [
21]. However, BRAF inhibitors were reperted to accelerated skin tumors and soft agar colonies in DMBA/TPA tumor induction. Celecoxib significantly delayed tumor acceleration by the BRAF inhibitor PLX7420 or vemurafenib. MEK inhibitor, trametinib, also reduced vemurafenib-induced PDV soft agar colonies, but less efficiently than celecoxib [
22].
In our previous studies, PKCζ, an atypical protein kinase C, functioned as a crucial mediator in chemotaxis of macrophages [
23] and various cancer cells, such as human breast cancer cells [
24,
25], glioblastoma cells [
26] and lung cancer cells [
27]. Briefly, PKCζ is required for EGF-induced chemotaxis and regulates actin polymerization and cell adhesion via involved in PI3K/Akt pathway and affecting phosphorylation of LIMK and Cofilin. The expression of PKCζ is commonly elevated in human and murine melanoma cells than melanocytes [
28], especially in interferon-resistant cells [
29]. The elevated activated PKCζ is mainly involved in metastasis associated signaling pathways in melanoma cells [
30]. Besides regulating actin polymerization and cell adhesion as in other carcinoma cells, PKCζ could also regulate melanoma cells invasion via affecting the expression and activities of matrix metallprotease-1, −2, −9 and MT1-MMP [
31]. In addition, Collagen induced nuclear translocation of NF-κB is dependent on PKCζ pathway, which is essential for migration [
32]. Some small inhibitors specific for PKCζ screened by our group have exhibited great capability in inhibiting breast cancer metastasis [
33,
34], among which J-4 is a highly selective inhibitor of PKCζ with inhibitory IC
50 at approximately 10 μM [
35]. J-4 severely impairs cell migration without affecting proliferation, probably because of PKCζ not involved in cell survival dependent signal pathways. Due to its prominent inhibition on metastasis and low toxicity, J-4 has been tested in preclinical studies by the Pharmaceutical Research Center of Tianjin Cancer Institute and Hospital. Therefore, we hypothesized that combined inhibition of PKCζ and COX-2 by J-4 and Celecoxib would synergistically block melanoma metastasis both in vitro and in vivo.
Methods
Reagents and antibodies
J-4 was acquired from
Maybridge Chemical (Cambrige, CBS, UK). Celecoxib was purchased from Meilun Biological Technology (Dalian, China). Antibodies against Vimentin (AF7013), COX-2 (AF7003) and β-actin (T0022) were purchased from Affinity Biosciences (Shanghai, China). Antibodies against E-Cadherin (#14472), phospho-Cofilin (#3311), Cofilin (#3312), phospho-PKCζ (#9378) and PKCζ (#9372) were obtained from Cell Signaling Technology (Cambridge, MA, USA). Antibodies against MMP-2 (sc-53,630) and MMP-9 (sc-21,733) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA.). Phosphatase inhibitor Cocktail tablets were purchased from Roche Molecular Biochemicals (Indianapolis, IN, USA). Z’-LYTE™ KINASE ASSAY KIT-SER/THR 7 PEPTIDE kit (Cat. No. PV3180) and PKCζ (Cat. No.2273) were purchased from Invitrogen (Carlsbad, CA, USA). Methylthiazolyldiphenyl-tetrazolium bromide (MTT) was purchased from Sigma-Aldrich (USA). DMEM medium, fetal bovine serum (FBS) and penicillin/streptomycin were all obtained from Gibco (Thermo Fisher Scientific Inc., USA).
Cell lines and cell culture
Mouse melanoma cell line B16-F10 was purchased from the Cell Culture Center of Chinese Academy of Medical Sciences (Beijing, China) and cultured according to the instructions. Human melanoma cell line A375 was characterized by Genetic Testing Biotechnology Corporation (Suzhou, China) using short tandem repeat (STR) markers. The cells were cultured in DMEM medium containing 10% FBS and penicillin/streptomycin at 37 °C in an atmosphere containing 5% CO2.
Z’-LYTE™ assay
The Z’-LYTE™ assay was carried out according to the manufacturer’s instruction. Briefly, 20 μL/well reactions were set up in 384-well plates containing kinase buffer, 5 μM ATP, 4 μM ZMTP, 4 Ser/Thr peptide substrate, 50 ng/μL PKCζ and J4 with different concentrations (0, 5, 10, 25, 50, 100 μM). After 1-h incubation, the development buffer was added to each well and further reacted for 1 h, and followed by reaction stopping. The fluorescence signal ratio of coumarin at 445 nm and fluorescin at 520 nm was then calculated to evaluate the kinase inhibitory activity of J4 in the reaction.
MTT assay
MTT assay was used to evaluate the effect of J-4 and Celecoxib on cell proliferation. B16-F10 or A375cells were seeded into 96-well plates at 4000/well, incubated at 37 °C in 5% CO2. Then cells were treated with J-4 at various doses, Celecoxib (25 μM) or their combination, respectively, for 24 h. MTT reagent was added to each well for further 4 h incubation. The medium was then discarded, and 150 μl of DMSO was added to each well. Subsequently, the plates were shaken for 30 s and the absorbance of each well was measured at 490 nm using a microplate reader (BioTek Epoch, Winooski, VT, USA).
Wound-healing assay
Cell motility was measured using the Wound-healing assay according to protocol described previously [
35]. Typically, B16-F10 or A375 cells were seeded into 60 mm dishes at a density of 8 × 10
5cells/well and incubated for 12 h to grow a monolayer. After that, the culture media were replaced with the fresh culture media containing J4 (25 μM) and/or Celecoxib (25 μM), and the cells were further incubated for 24 h. Next, a linear scratch wound was created across the middle of the well surface using a pipette tip. The cells were then incubated in serum-free medium at 37 °C in 5% CO
2. At predetermined time points (0, 3, 6, 9, 12 and 24 h), the wound widths were quantified and photomicrographs were taken with an IX50 inverted microscope (Olympus, Tokyo, Japan). The experiment was carried out in double blind to eliminate the deviation induced by subjective factors.
Cell invasion assay
Cell invasion in vitro were evaluated by Transwell assays. B16-F10 or A375 cells were pretreated with J-4 and/or Celecoxib at various doses and then seeded into the upper chamber coated with Matrigel matrix (BD Biosciences, MA, USA) at a density of 3.5 × 104 cells/well in serum-free media containing or not containing various doses of J-4 and/or Celecoxib. The lower chambers were filled with media containing 10% FBS. The cells were allowed to migrate for 24 h incubated at 37 °C in 5% CO2. The cells that migrated through the polycarbonate membrane were stained and counted visually in 5 random fields using the computer-based microcopy imaging system. The dose-effect curve and combination index (CI) was calculated by the CalcuSyn software 2.1. The experiment was carried out in double blind to eliminate the deviation induced by subjective factors.
Adhesion assay
Adhesion assay was performed as described previously [
34]. Briefly, B16-F10 or A375 cells were treated with J4 (25 μM) and/or Celecoxib (25 μM) for 6 h, trypsinized, and re-suspended in serum-free media at a density of 3 × 10
5 cells/mL. After incubation for additional 30 min, 1.5 mL of cell suspension was placed in 35 mm dishes containing glass cover slips that were coated with 10 ng/mL fibronectin. After further incubations for 5, 15 and 30 min, the cells were washed, fixed and counted in five separate fields under a light microscope. The experiment was carried out in double blind to eliminate the deviation induced by subjective factors.
Western blotting assay
Western blotting assay was used for assessment of expressions of COX-2, p-PKCζ and p-Cofilin in B16-F10 and A375 cells. The cells were treated with J4 (25 μM) and/or Celecoxib (25 μM) in serum-containing and serum-free media separately for 12 h, and then stimulated by 20 ng/mL EGF for 10 min before lysed on ice for 30 min. Subsequently, 15 μg of protein per sample were separated by 10% SDS-PAGE systems and transferred onto PVDF membranes. After blocking in 5% fat-free milk for 1 h, the membranes were probed with diluted primary antibodies overnight at 4 °C. The antibodies and dilution factors were as follows: COX-2 (1:500), β-actin (1:3000), p-PKCζ (1:1000), PKCζ (1:3000), p-Cofilin (1:500), Cofilin (1:1000), E-Cadherin (1:1000), Vimentin (1:1000), MMP-2 (1:800) and MMP-9 (1:800). Secondary antibodies conjugated with HRP were incubated for further 1 h at room temperature. A G-BOX (Gene Company Ltd., Beijing, China) was used to photograph and analyze bands using ImageJ software.
F-actin content assay
F-actin was quantified by methanol extraction of Oregon Green 568/phalloidin–stained cells as described previously [
24]. Briefly, B16-F10 or A375 cells were plated and cultured for 18 h in complete medium followed by further culturing in serum free medium for 3 h. Cells were then treated with the indicated inhibitors or DMSO for 2 h and stimulated by 50 ng/mL EGF at 37 °C. Cells were fixed, permeabilized, and stained in the dark with Oregon Green 568 phalloidin diluted in F-buffer (10 mM HEPES, 20 mM KH
2PO
4, 5 mM EGTA, 2 mM MgCl
2, PBS, pH 6.8) at room temperature for 60 min. After five washes, bound phalloidin was extracted with methanol at 4 °C and subjected to fluorescence analysis at 578 nm excitation and 600 nm emission. At the same time, an aliquot of cells were analyzed by a bicinchoninic acid assay (Pierce, Thermo Fisher Scientific Inc., USA) to determine total protein in the sample. Fluorescence signals were normalized against total protein. Results were expressed as relative F-actin content, where.
F-actin Δt / F-actin 0 = (fluorescence Δt / mg/mL) / (fluorescence 0 / mg/mL).
For observation of F-actin filaments, the cells were fixed and stained with rhodamine phalloidin (14 μM; Cytoskeleton, Denver, USA) in the dark for 30 min and finally imaged using a laser scanning confocal microscope (LSCM) (FV1000; Olympus, Tokyo, Japan).
Real time PCR (RT-PCR)
Total RNA from cells pretreated with J-4 and/or Celecoxib was extracted by using Trizol. Then, RNA was transcribed by using a FastQuant RT kit (TIANGEN, China). The amplification reaction was carried out for 35 cycles. Each cycle consisted of denaturation for 1 min at 95 °C, annealing for 45 s and an extension for 1 min at 72 °C. A final extension step at 72 °C for 5 min terminated the amplification. The primer sequences as previous reports [
23,
36,
37], the predicted amplicon sizes, and the annealing temperatures are depicted in Table
1.
Table 1
Primer Sequences and Reaction Properties
Human | | | | |
PKCζ | forward | CTGAGGAGCACGCCAGGTT | 625 | 58.1 |
reverse | ACGGGCTCGCTGGTGAACT |
COX-2 | forward | TCTGCAGAGTTGGAAGCA-CTCTA | 216 | 58.4 |
reverse | GCCGAGGCTTTTCTACCAGAA |
β-actin | forward | CTGGCACCCAGCACAATG | 458 | 54.1 |
reverse | GCCGATCCACACGGAGTACT |
Mouse | | | | |
PKCζ | forward | ACGGACAACCCTGACATGAAC | 361 | 57.1 |
reverse | ATTCGGACTGGTCGATCCTCT |
COX-2 | forward | TCAGGTCATTGGTGGAGAGG | 96 | 54 |
reverse | GCAAACTGCAGGTTCTCAGG |
β-actin | forward | ATGGAGCCACCGATCCACA | 426 | 56.2 |
reverse | CATCCGTAAAGACCTCTATGCCAAC |
In vivo study in B16-F10/C57BL mouse melanoma lung metastasis model
C57BL/6 mice, 5–6 weeks old, were purchased from the Food and Drug Verification Institute (Beijing, China). All animal experiments were approved by the Animal Ethics Committee of Tianjin Medical University and complied with its regulations. A mouse model of melanoma lung metastasis was constructed by injection of B16-F10 cells into mice (5 × 10
4cells/mouse) via tail vein. Compound treatment started the next day after melanoma cells injection. The mice were intravenously injected with normal saline, J-4 (20 mg/kg), Celecoxib (20 mg/kg), or their combination every three days, respectively. Mice were sacrificed after 3-week treatment, and the lungs were separated to examine the number of lung metastasis nodules. Then the lungs were homogenized and incubated in 1 M NaOH containing 10% DMSO at 80 °C for 2 h to measure the melanin content [
38]. Then the homogenate were centrifuged and the absorbance of supernate was read at 490 nm. The relative melanin content was calculated as follows:
Relative melanin = Absorbance (treatment) / Absorbance (Ctrl) × 100%.
Animal activity and body weight were monitored during the entire experiment period to assess acute toxicity. The liver and lung of each mouse were fixed by formalin and examined by hematoxylin-eosin (HE) staining.
Statistical analysis
Each experiment was repeated at least three times and the data were presented as mean ± standard deviation (SD). Statistical analyses were performed with SPSS software (version 17.0, SPSS Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) was used to determine statistical differences between multiple groups. P < 0.05 was considered to be statistically significant.
Discussion
The advanced and metastasized melanoma always indicates poor survival and lacks effective drugs in clinic [
3]. Cancer metastasis is a complicated event that involves multiple sequential and interlinked steps including detachment, migration, invasion and adhesion. Thus, drug combination is reasonably raised as a promising strategy for melanoma metastasis [
5]. The activity of PKCζ and expression of COX-2 are two essential elements for melanoma metastasis, since cell chemotaxis is mediated by PKCζ and COX-2 dependent signaling pathways. In this study, the inhibitory capability of combined inhibition of PKCζ and COX-2 by their inhibitors J-4 and Celecoxib, respectively, was evaluated both in vitro and in vivo. J-4 is a small-molecule inhibitor specific for PKCζ screened by our group with IC50 at approximately 10 μM and Celecoxib is a highly selective inhibitor of COX-2 which has been widely tested in clinical trials for treatment of many types of cancer. Co-treatment with J-4 and Celecoxib in A375 and B16 cells did not significantly affect cell proliferation, but severely impaired cell migration, invasion and adhesion which were all required for melanoma cells motility. The results are consistent with the phenotype induced by PKCζ or COX-2 inhibition in previous reports [
19,
35], which means cell motility inhibition but not cell death [
44]. The CI value is a widely accepted indicator of synergistic effect [
39]. The CI calculated by
CalcuSyn software 2.1 signifies that J-4 combined with Celecoxib is synergistic rather than additive effect.
PKCζ and COX-2 related pathways play an important role in EGF induced cell chemotaxis [
24]. The phosphorylation of PKCζ and Cofilin serve as main indicators of PKCζ activity [
23] and the function of COX-2 depends on its expression [
11]. J-4 severely decreased the phosphorylation of PKCζ and Cofilin under EGF stimulation without affecting their expressions and COX-2, while Celecoxib reduced the expression of COX-2 both at protein and mRNA levels without affecting the activity of PKCζ. However, co-treatment with J-4 and Celecoxib induced more significant decrease than mono-treatments, further supporting the combination is synergistic effect. The results also indicate J-4 combined with Celecoxib suppresses cell motility via impairing the activity of PKCζ and the expression of COX-2. Cell migration depends on F-actin aggregation at the cell leading edges and further induced formation of lamellipodia [
24]. After co-treatment with J-4 and Celecoxib, EGF induced F-actin aggregation disappeared, which correlated to the dephosphorylation of Cofilin and suggested the inactivation of PKCζ related pathways. In addition, the combination of J-4 and Celecoxib could induce MET and decrease the expression of MMP-2/MMP-9 in melanoma cells, which in turn inhibit the migration and invasion of melanoma cells.
Melanoma is highly metastatic, and lung is one of the major target organs for metastasis. B16-F10/C57BL mouse melanoma lung metastasis model is widely used to screen drugs for cancer metastasis in preclinical trials [
42,
43] and B16-F10 is a highly lung metastatic cell line screened from B16 cells [
45]. In this study, co-treatment with J-4 and Celecoxib almost blocked the lung metastasis of the intravenously injected B16-F10 cells. Furthermore, no notable variation of animal activities and body weights were observed during the entire experiment period, indicating low toxicity of the therapy, which was further confirmed by HE staining results.