Background
Global amphibian populations have declined considerably in recent years, in part due to habitat fragmentation, pollution, and the chytrid fungus
Batrachochytrium dendrobatidis[
1,
2]. More recently, certain members of the family
Iridoviridae have also been associated with amphibian decline. The family
Iridoviridae is comprised of large, cytoplasmic, double stranded DNA viruses with icosahedral capsids [
3], and is divided into five genera:
Iridovirus,
Chloriridovirus,
Lymphocystivirus,
Megalocytivirus, and
Ranavirus[
4]. Specifically linked to amphibian mortality in this family are infectious diseases caused by members of the genus
Ranavirus. In past research, ranaviruses received little attention as most infections were deemed subclinical; however, recent ranavirus infections have resulted in considerable morbidity and mortality in a range of wild and cultivated amphibian species in the Americas, Europe, and Asia [
5‐
8]. It has been reported that 43% of known amphibian die-offs in the USA from 2000 to 2005 were due to ranaviruses [
9], and that from 1996–2001 ranaviruses were isolated from most of the amphibian mortality events in North America [
10]. Detection of these outbreaks could be due to better surveillance, increased environmental awareness, the mutation of viral species creating highly pathogenic strains, or environmental changes resulting in host immune suppression [
11]. Ranaviruses have become a significant cause of death and disease in amphibians, and thus investigation into these viruses is warranted from a virological, commercial, and ecological standpoint [
11].
Frog virus 3 (FV3) is the type species of the genus
Ranavirus[
4]. FV3′s genome is 105,903 base pairs (bp) comprised of 98 open reading frames (ORFs) [
12]. Depending on factors such as strain virulence and host immune response, infection with FV3 may or may not lead to mortality. However, in susceptible amphibians, FV3′s necrotic and apoptotic effects cause systemic, chronic cell death in multiple internal organs, resulting in death of the host within a few days to several weeks [
2,
13,
14]. FV3 infection is also marked by cutaneous signs, including ulceration of the skin, and erythema and swelling of the limbs and body. In fatal cases, intracoelomic lesions are often present, including haemorrhages of the kidneys and reproductive organs, and pale, swollen livers [
15]. While our understanding of ranavirus pathogenicity has improved over the last decade, there is still a need for the research community to more fully describe the determinants of virulence variation. Elucidation of this area will likely heavily rely on the genetic analysis and comparison of ranaviruses that differ in host range and virulence.
Genetic comparison of related DNA viruses has proven to be an important tool in classifying viral strains and understanding the epidemiology and evolution of different genotypes [
16]. By analyzing genetic differences, researchers can link clinically significant alterations with molecular changes, and better understand viral origins and evolution. Increasingly, new viral strains are being identified based on the systematic analysis of sequence data, including short amino acid insertions, translational stop codons, and single amino acid deletions [
17]. Analysis of viral isolates has led to the discovery of new viral genotypes, as well as better understanding of the functional genetic differences among strains [
17]. For instance, the entire genome of a virulent strain of duck entiritis virus was recently sequenced and compared to the genomes of an attenuated strain and another virulent strain [
18]. The results indicated several nucleotide insertions/deletions and frame-shift mutations effecting ORF initiation or termination [
18]. These findings allowed the researchers to identify possible virulence factors and provided information on ORFs that are changed during serial passage.
In addition to nucleotide insertions/deletions, variation between viral genomes may occur at repeat regions. Eaton et al. [
19] identified repetitive sequences in the genomes of various ranaviruses with high copy number variation. Repetitive sequences are commonly classified into one of three groups: macro, mini, or micro satellites [
20]. The repeats that we will examine in this study contain less than 400 bp comprised of 9-19 bp repeating units. Thus, we suggest that these repeats are some variation between micro and mini satellites, and for the purposes of our analysis, will be referred to as short tandem repeats (STRs). A selection of these repeat regions will be used to analyze FV3 isolates in order to further investigate the fine scale, genetic differences present in variable regions.
Past studies on the genetic variation between DNA viral strains have allowed for the detection of minute genetic changes that would otherwise have gone unnoticed. These kinds of changes have proved useful in explaining phenotypic differences and evolutionary histories. The purpose of the present investigation is to narrow our focus even further by comparing the genomes of closely related FV3 isolates, including those with varying levels of virulence. This will be done in an attempt to explore the genetic diversity present in strains of FV3, with the ultimate goal of further elucidating the possible genetic basis behind FV3′s unpredictable infectious behaviour.
Discussion
Our analysis of related ranaviruses presents a novel approach to genomic comparison that differs from other studies. We analyzed the genomes of closely related isolates of FV3 through 454 GS-FLX technology and STR comparison. The scale (fully sequenced genomes), and the nature of comparison (using viral isolates of FV3), set our investigation apart from past studies. We found that the 3 strains we examined displayed slightly different levels of virulence during in vivo studies. By sequencing the one genome yet to be sequenced, we were able to highlight areas that may be important in generating infectious phenotypes of FV3. This kind of analysis has never been done for FV3 or related ranaviruses: thus, it provides greater insight into the genetic variation among these closely related DNA viruses and the possible genetic basis of ranaviral virulence.
Our results demonstrate that genetic variation is present between closely related FV3 isolates in both coding and non-coding regions. The SSME genome was sequenced and compared to the published wt-FV3 genome, along with related ranaviral genomes RGV, SSTIV, and TFV. Comparisons revealed that SSME was divergent from wt-FV3, and aza-C
r. This variation could be due to the fact that SSME was isolated from a spotted salamander rather than anurans, and so the strain may have evolved in order for it to better adapt to its novel host, as is seen during serial passage [
27]. For example, the pathogenicity of Dengue virus was altered by serial passaging Dengue virus 27 times which resulted in 25 nucleotide changes between 2 strains [
27]. This finding is interesting given the fact that our results also showed that SSME was the least virulent of our 3 strains during an
in vivo study in anurans (Figure
1). Thus, genetic mutations observed in SSME, such as deletions in ORFs 65L, 66L and 49/50L, could have had an effect on strain virulence in anuran hosts. Also, past sequencing results [
12] as well as our own genomic sequencing of wt-FV3 and aza-C
r genomes revealed only 13 nucleotide differences (data not shown) between the strains, supporting our
in vivo finding that the two strains cause essentially the same amount of tadpole mortality (97% and 96% respectively).
One of the most significant genetic variations found in SSME was a 757 bp deletion that deleted all of the 65L coding region and most of the 66L coding region (Figure
2). Among other ranaviruses, the functions of these genes have not been determined. Further sequencing of ranaviruses has shown that 65L is present in both RGV and SSTIV as 69L and 68L respectively [
23,
28], while this form of 66L appears to be unique to FV3, as other ranaviruses have a 139 nucleotide insertion in their related 66L regions (Figure
2). Another genetic variation specific to SSME was a 13 amino acid deletion in ORF 50L (Figure
3). Interestingly, a second variation was found in this area in the form of single nucleotide deletion. This deletion lead to the merger of ORFs 49L and 50L in all examined ranaviruses other than TFV and wt-FV3 (Figure
3). In terms of function, 49L has multiple SAP motifs, which are DNA/RNA binding domains predicted to be involved in chromosomal organization and DNA replication [
29]. Thus, this new 49/50L ORF may function in viral replication.
Single nucleotide deletions were found in multiple ranaviruses within the 43R genes (Figure
4) and 46L (Tables
1 and
2) genes. In 43R, the deletion was present in all ranaviruses analyzed other than wt-FV3, and resulted in a frameshift mutation (Figure
4). In 46L, the original stop codon was lost, leading to the extension of the ORF by 319 bps (Tables
1 and
2). This was found in all genomes other than TFV and wt-FV3. Supposedly, 46L encodes for a neurofilament triplet H1-like protein [
12]. However, the extended version of 46L that we discovered has a putative conserved domain known as a microneme/rhoptry antigen in the area previously thought to be non-coding. Micronemes and rhoptries are organelles possessed by Apicomplexa protozoans that secrete proteins involved in parasite entry into a host cell, specifically possessing protein-binding motifs that recognize ligands on the host cell surface [
30]. Although usually associated with protozoan parasites, these microneme/rhoptry antigens found in 46L could give further indication as to 46L’s function.
The changes present in 43R, 46L, 49/50L, 65L, and 66L represent the main variable regions amongst the related ranaviral isolates we analyzed. This suggests that these are changeable areas across ranaviruses, and could be used in the future to help explain variable infectious phenotype. Moreover, multiple amino acid deletions present in 65L, 66L, and 49/50L, were limited to the SSME strain, which displayed the lowest level of virulence during tadpole infection. Thus, changes that are unique to SSME may present areas of the genome that are particularly effective in viral attenuation, specifically in an alternative host. As FV3 mortality and morbidity continues to worsen and fluctuate across environmental regions, examination of these genomic areas may prove useful as an initial way to investigate the genetic basis behind infective changes [
6]. Further research could be used to explain variations in the virulence of different FV3-like isolates.
As we had already identified variation in the coding regions of closely related FV3 isolates, we decided to further our understanding of variation within highly variable sites by investigating 3 recently identified STR regions [
19]. These are known to be variable areas: for instance, although FV3 and SSTIV share 99% genome sequence identity, they share only approximately 50% of repeats in common [
19]. Thus, we predicted that these repeat regions would have greater inter-strain variability that would provide useful information when trying to understand overall genetic variability between ranaviral isolates. In order to test this prediction, we analyzed our sequenced SSME genome and reference ranaviral genomes, along with 6 environmental samples isolated from the same waterway. We also sequenced wt-FV3 and aza-C
r to check for repeat number stability across their past viral passages. Analysis revealed that repeat copy number was variable between isolates, even between those from the same geographic location, but that there was some conservation (Figure
5). Specifically, wt-FV3 and aza-C
r were identical, and samples F4, E5, and E3 were also identical at all three regions (Figure
5); this finding was not surprising given that aza-C
r is the result of the wt-FV3 strain treated with azacytidine and does not necessarily represent a strain with a separate evolutionary history [
22]. It also implies stability in the repeat regions, as these regions have not changed between the two strains since their initial separation. However, the finding that viral isolates from the same geographical area have variability may limit the use of STRs as a geographic marker. This STR analysis allowed us to better quantify the small scale genetic variation that is present in highly variable genetic sites amongst FV3 isolates, thus furthering our understanding of genetic variation beyond coding regions.
The STR analysis we performed in our study has the potential to contribute to our understanding of FV3 tracking and strain designation. Surveillance and phylogeographical analysis of FV3 are pivotal in understanding how the pathogen varies between different habitat sites and amphibian species, as well as for revealing possible sources of a disease outbreak [
31]. It can also have direct effects on conservation by aiding in strategy development to minimize die-offs in high-risk areas, and in creating vaccines through knowledge of the FV3 genome itself [
14,
31]. However, exact taxonomic identification of viruses in amphibian populations has been difficult given the lack of detailed molecular data on FV3 and other ranaviruses. The methodology used to classify these viruses in the past has been through comparing the major capsid protein (MCP) of different viral isolates [
3]. However, the use of the MCP as a tool to distinguish between different ranaviruses, as well as between different strains of the same virus, has been called under scrutiny [
24,
32,
33]. Thus, there is a need to develop new methods of strain tracking for ranaviral isolates.
The use of STRs for ranavirus strain identification has precedence in other virus studies. In one such study, 12 isolates of human cytomegalovirus (HCMV) were isolated from various individuals infected with the virus. The isolates were then tested for variable repeats in 24 polymorphic regions, and based on this analysis, each viral isolate was designated as an individual strain of HCMV [
34]. Many of the HCMV repeats used in this study were found in non-coding regions of the genome, similarly to the ones used in our study. The study suggested that these changes in repeats are evolutionarily neutral and so appropriate for strain identification, not only in HCMV, but in other similar, large genome DNA viruses [
34].
Other studies have used coding instead of non-coding repeat regions to identify viral strains [
35,
36]. In our study, Region 1 is found in the 19R ORF, unlike the non-coding areas of Regions 2 and 3. There are many examples of functional microsatellites that are known to affect viral characteristics based on copy number, including hepatitis C virus and vesicular stomatitis virus [
35,
36]. Therefore, in addition to being potentially useful in viral tracking, STRs from the Region 1 coding region may have functional significance in FV3.
Material and methods
Reagents, viruses
FV3 isolate SSME, wt-FV3, and aza-C
r, were analyzed in this study and were provided by Professor Gregory Chinchar from the University of Mississipi Medical Center (Jackson, MS, USA). SSME was isolated from a wild, spotted salamander population in Maine, USA, while aza-C
r was derived from the laboratory wt-FV3 strain through selection with azacytidine [
22]. Both wt-FV3 and aza-C
r have been previously sequenced and found to be identical, with wt-FV3′s nucleotide sequence deposited into GenBank [
12]. Amphibian renal cells (A6 cells) were supplied by Niels Bols of the University of Waterloo and maintained in Leibovitz’s L-15 media (Invitrogen, Burlington, ON) supplemented with 10% fetal bovine serum (FBS; Invitrogen, Burlington, ON), penicillin (100 U/ml), and streptomycin (100 μg/ml).
Infection of tadpoles with FV3
In order to monitor survival of FV3 infected tadpoles, we obtained
Lithiobates pipiens tadpoles, approximately Gosner stage 25 [
37], from the Environment Canada Atlantic Laboratory for Environmental Testing in Moncton, NB., courtesy of Paula Jackman. The animals were received two weeks prior the beginning of the experiment and were kept in 20 L tanks filled with 10 L of aged clean dechlorinated water. Each treatment group was done as 2 replicates of 25 tadpoles per treatment. Groups tadpoles were placed in dechlorinated water, with the host density (number of tadpoles per volume of water) adjusted to 1 tadpole per 250 mL to avoid any effect of density on tadpole development [
38]. To infect, 25 tadpoles were placed in 50 mL of infected water containing 10,000 pfu/mL of a FV3 strain (SSME, wt-FV3, and aza-C
r)
. According to past experiments, such concentration is known to induce sublethal effects in these laboratory conditions [
38]. Control individuals were placed within 50 ml of FV3-free water. The tadpoles were left within the infected solution overnight (12 hours) tadpoles were then transferred together with the contaminated water in 2 L plastic containers filled with 1 L of dechlorinated water (aged for three days) for the rest of the experiment. Containers were held in a climatic chamber (Thermo Incubator Model 3740) where the temperature was set to remain at 22°C with a 12 h:12 h dark:light cycle. Tadpoles were fed on a weekly basis after the water was changed with standard tadpole food (Carolina Biological Supply Company, Burlington, NC) at 30 mg/tadpole for week 1, 60 mg/tadpole for week 2, and 120 mg/tadpole for week 3 until the end of the experiment [
38]. Starting on week 3 the water in each tank was replaced once a week with clean dechlorinated aged (24 h) water. As a result, exposed tadpoles were held in virus-containing water for 3 weeks, a period which is long enough for tadpoles to be in close proximity with residual infection [
38]. Tanks were monitored on a daily basis. Dead tadpoles were removed to prevent any scavenging, and stored at −25°C in individual plastic vials with ethanol for subsequent analyses.. The experiment terminated when all the individuals died or reached metamorphosis. The procedures used in this experiment follow protocol #2010-04-02 approved by the Laurentian University Animal Care Committee.
Screening of tadpoles for FV3
In order to check for ranavirus infection, all animals (including euthanized ones) were dissected to remove the liver that was then crushed into a 1.5 ml Eppendorf tube. The resulting tissue mixture was used for DNA extraction. DNA was extracted using QIAmp DNeasy Kit following the standard protocol (Qiagen). After extraction, a double blind PCR was performed using a primer set known to successfully amplify a portion of the major capsid protein within the FV3 genome: MCP-ranavirus-F (5′-GACTTGGCCACTTATGAC-3′) and MCP-ranavirus-R (5′- GTCTCTGGAGAAGAAGAA), following the PCR conditions listed in Mao et al. [
33], using 1.5 μl of template DNA and cycled 40 times. Individuals showing two positive amplifications for both PCRs were considered infected. We analyzed host survival using a survival analysis and failure time analysis following the Kaplan & Meier product limit method associated with Chi square and Gehan’s Wilcoxon tests (multiple and two sample comparisons respectively) [
39]. Individuals surviving to the end of the experiment were censored to account for our lack of information about their true time of death [
40].
Viral DNA isolation
The SSME viral isolate was propagated on a confluent monolayer of A6 cells, and grown in a 75 cm2 flask, with cells infected at a multiplicity of infection (MOI) of 1 PFU/cell. The cells were harvested 5 days post infection (once cytopathic effect appeared), and viral DNA was extracted using the Purelink Viral RNA/DNA Mini Kit according to manufacturer’s protocol (Invitrogen, Burlington, ON).
Viral genome sequencing
Standard kits and protocols developed by the manufacturer were used to sequence the SSME sample on a 454 GS-FLX platform (Roche Diagnostics Corporation). Briefly, a Rapid Library Preparation Kit (Roche, Mississauga, ON) was used to mechanically shear 500 ng of template DNA into short fragments. A universal sequencing primer that included a short DNA sequence unique to the sample (MID tag) was then annealed to both ends of each DNA fragment. A GS Junior Titanium Emulsion PCR Kit (Roche, Mississauga, ON) was used to amplify the sample library, which was sequenced using a GS Junior Titanium Sequencing Kit (Roche, Mississauga, ON). In order to assemble a full genomic sequence, the short sequences produced by 454 sequencing were aligned with the reference FV3 genome, wt-FV3, using GS Reference Mapper (Roche, Mississauga, ON). Any gaps in the assembled genome were then sequenced using custom PCR primers specific to each gap, with sequencing performed by the Robarts Sequencing Facility (London, ON). The final genomic sequence was deposited in GenBank accession number KJ175144.
FV3 sample collection
FV3 environmental samples were collected from frogs caught by hand at various sites along a lakeshore in Manitoulin, Kagawong, ON, Canada (Latitude: 45.86418, Longitude: −82.27150). The frogs were caught using disposable gloves which were changed between each animal inspection. This method is preferred to the ‘net-catching method’ as it has been suggested that cross contamination can occur via the net. Each individual was toe clipped following the protocol #2009-03-04 approved by the Laurentian University Animal Care Committee for tissue sample collection. DNA was then isolated from toe clippings using the DNeasy Blood & Tissue Kit according to the manufacturer’s protocol for total DNA extraction from animal tissues (Qiagen, Mississauga, ON). Samples then underwent PCR with primers designed to amplify specific repeat regions identified in Eaton et al. [
19]. Primers used included: Region 1-F: CGTGGTCAGACTGGTCCTCG; Region 1-R: CACCTCTGTCTCTGAATCGG; Region 2-F: GAGTTTACTTGGTGGCCATG; Region 2-R: TCCTGTCAAGAGATCCCCTC; Region 3-F: CTTGCTGCTGCCGTTCAGGC; and Region 3-R: AGAGTGAAAAAGGTAAAGGC.
Sequencing repeats and confirming 454 sequence reads
In a PCR reaction tube the following reactants were combined: 10X PCR buffer (Invitrogen, Burlington, ON), 50 mM MgCl2 solution (Invitrogen, Burlington, ON), 5X TAQ DNA polymerase (Invitrogen, Burlington, ON), 10 mM deoxyribonucleotide triphosphates (dNTPs), 0.1 mM primer, 2.5 ng DNA, and water to a final volume of 50 μl. The reactions were then placed in a thermocycler under the following conditions: 94°C for 3 minutes, 94°C for 30 seconds, 56°C for 1 minute, and 72°C for 1 minute for 30 cycles. Sequences of PCR products were determined by Robarts Research Institute DNA Sequencing Facility in London, ON, and were analyzed using BioEdit v7.0.5.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
EAM participated in the design of the study, isolated viral strains in vitro, carried out the molecular genetic studies, participated in 454 GS-FLX sequence alignment, and drafted the manuscript. SG participated in 454 GS-FLX sequence alignment. PE collected viral isolates from the field, carried out the immunoassays, and participated in the design of the study. DL participated in the design of the immunoassays. CJK oversaw the 454 GS-FLX sequencing. CRB conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors have read and approved the final manuscript.