Background
Acute coronary syndrome (ACS) is the severe form of coronary artery disease (CAD), which remains the leading cause of morbidity and mortality worldwide [
1]. It has been well documented that atherosclerosis, the major cause of CAD, is a chronic inflammatory process involving a variety of innate and adaptive immune components [
2,
3]. T cells are prominent component in the atherosclerotic plaque, and typical signs of T cell activation were observed in the blood of patients with ACS [
4‐
6]. Evidence suggested that ACS patients had higher frequency and enhanced function of T cells compared to patients with stable angina (SA) [
7]. Therefore, T cells mediated adaptive immunity may play an important role in the pathological process of ACS.
Atherosclerosis which is featured by the formation of plaques containing immune cells, foam cells and others components is suggested as the most important pathogenic mechanism of ACS [
8]. Previous study has found that T cells accumulated in human atherosclerotic plaques, most of which were effector and memory T cells [
9]. Meanwhile, researchers have demonstrated the existence of T cells within the aortic adventitia of vessels [
10]. Accumulating evidences suggest that T cells play an important role in the immunological mechanisms of the ACS [
11,
12]. However, the clonotype feature of involved T cells remained unclarified.
T cell receptor (TCR) expressed on the surface of T cells recognizes the antigenic peptides presented by antigen presented cells (APC). Human TCRs are commonly composed of α and β chains [
13]. TCRα chains consist of variable (V), joining (J) and constant (C) regions, while TCRβ chains consist of V, J, C and diversity (D) regions. The diversity of TCR is generated by rearrangement of the V, D, J and C regions. Random insertions and deletions of nucleotides at the junctions increase the diversity [
14]. The alteration of TCR repertoire has been observed in many diseases, such as cancer, autoimmune disorders and infectious diseases [
15,
16]. Thus, TCR repertoire has great diagnosis value and clinical utility, as its diversity reflects the state of immune system [
17]. Researchers begin to explore the association between changes in TCR repertoire and diseases, on propose to identify novel biomarkers or prognostic factors [
18,
19].
In the present study, we aimed to characterize the TCR repertoire in peripheral blood samples from ACS patients using high-throughput sequencing. We analyzed the diversity of the TCR repertoire, V/J gene utilization and disease associated TCRβ clonotypes. The present study might contribute to the understanding of the roles of T cells in ACS development and provides a new way to explore the mechanisms of ACS.
Methods
Subjects
Patients were enrolled from Cardiology Department of Meizhou People’s Hospital (Huangtang Hospital), Meizhou Academy of Medical Sciences, Meizhou Hospital Affiliated to Sun Yat-sen University, Meizhou, China. Patients were diagnosed as UA if they had: (1) angina-like chest pain or ischemic equivalent; (2) electrocardiographic abnormalities compatible on at least two contiguous leads; (3) at least one major pericardial vessel with > 70% stenosis. Patients were diagnosed as AMI if met the above 3 criterions plus another one: (4) abnormalities above the upper normal limit for myocardial necrosis biomarkers (troponin and/or CKMB). Normal coronary artery (NCA) patients were defined as no stenosis in coronary arteries by quantitative coronary angiography and served as controls in this study. Patients were excluded if they had the following manifestations or diseases, i.e. left ventricular ejection fraction ≤45%, congestive heart failure, chronic kidney or hepatic disease and cancer. The diagnosis was made by two senior cardiologists. This study was approved by the Ethics Committee of the Meizhou People’s Hospital (Huangtang Hospital). Each patient had signed a written informed consent.
Sample collection
Peripheral venous blood samples were collected and placed in EDTA-coated tubes. The blood samples were processed within 30 min. PBMCs were isolated from fresh whole blood by density gradient centrifugation using Hypaque-Ficoll (GE Healthcare Bio-sciences AB, Sweden). The isolated PBMCs were lysed using TRIzol reagent (Invitrogen, USA) and stored at − 80 °C until used.
RNA extraction and cDNA synthesis
Total RNA was extracted from 1 × 10
6 PBMCs from each sample using RNeasy Mini Kit (QIAGEN, German) following the manufacture’s protocol. The concentrations and purity of RNA were measured by Nanodrop − 1000 spectrophotometer (Thermo FisherScientific Inc., USA).RNA integrity was analyzed by the Bioanalyzer 2100 system (Agilent Technologies, USA). cDNA libraries were prepared by 5′-rapid amplification of cDNA ends (RACE) using the SMARTer PCR cDNA synthesis kit (Clontech, USA) as described previously [
20]. Briefly, 1.5 μg of total RNA was mixed with the primer BC1R (CAGTATCTGGAGTCATTGA)(20 μM) in a sterile thin-walled reaction tube. The tube was placed on a thermal cycler and incubated for 3 min at 70 °C and then for 2 min at 42 °C to anneal synthesis primer. A reaction mix containing first strand buffer, 5′-template switch adapter and SMARTScribe reverse transcriptase was prepared and added to the tube. The tube was incubated at 42 °C for 60 min.
Library construction and sequencing
Libraries were prepared using two-round PCR with specific primers as reported previously [
20]. Briefly, in the first-run PCR amplification, the reaction system containing cDNA, Advantage 2 polymerase mix (Clontech, USA), universal primer smart 20 (CACTCTATCCGACAAGCAGTGGTATCAACGCAG), and TCRβ specific primer (TGCTTCTGATGGCTCAAACAC) was prepared. TCRβ was amplified using LightCycler 480 (Roche, USA) with the following program: 95 °C for 20 s, 65 °C for 20 s, 72 °C for 50 s, for a total of 18 cyclers. The products were purified using the QIAquick PCR purification kit (Qiagen, German).
In the second-run PCR, the reaction system was prepared containing the purified products, universal primers Step1(CACTCTATCCGACAAGCAGT), specific primer hum-bcj (ACACSTTKTTCAGGTCCTC). Amplification was carried out on LightCycler 480 with the following program: 95 °C for 20 s, 65 °C for 20 s, 72 °C for 50 s, for a total of 12 cycles. The products were purified as above. Libraries were amplified using Illumina sequencing primers with barcodes. Then, paired-end 150 bp sequencing was performed on the Illumina HiSeq2000 platform in ShenZhen Realomics Inc.
The sequencing quality of the library by Illumina Hiseq 2000 was evaluated by the Realomics system formula. Briefly, the adaptor reads and the low-quality reads were filtered to obtain clean data. Subsequently, the clean data was aligned to human IGH database and analyzed by miXCR [
21]. The high-quality reads were further assembled into clonotypes, correcting for PCR and sequencing errors using a heuristic multilayer clustering by VDJ tool [
22,
23].
Statistical analysis
The data were analyzed with IBM SPSS 20.0 software (Social Science Statistics Software Package). Continuous data were presented as means ± standard deviation (SD) and categorical variables were presented as number (%). Data were assessed for their normality using Kolmogorov–Smirnov test. One-way analysis of variance (ANOVA) was used for normally distributed data, and Wilcoxon rank-sum test was used for data did not follow a normal distribution. For the categorical variables, Chi-square test was performed. P < 0.05 was considered statistically significant.
Discussion
Although modern medical treatment has considerably improved the outcome of ACS, it is still the deadliest disease all around the world [
24]. In this study, we comprehensively analyzed the TCR CDR3β repertoire of patients with UA, AMI and NCA. The results suggested that: (1) diversity of T cell clones was reduced in patients with UA and AMI; (2) the Vβ and Jβ genes usage patterns differed in UA, AMI and NCA; (3) disease-associated TCR CDR3β clonotypes were identified.
T cell-mediated immune responses are principal component of cellular immune response and protected against many diseases and infections [
25,
26]. Previous studies have found a higher level of activated T-cells in ACS patients as compared with stable angina patients [
5,
6]. ApoE
−/− mice lacking CD4+ T cells were found less susceptible to atherosclerosis compared with wild-type mice, and transfer of CD4+ T cells to immunodeficient ApoE
−/− mice significantly promoted atherosclerosis. These findings suggested a proatherosclerotic role of CD4+ T cells. The function of CD4+ T cells was proved exerted by production of IFN-γ [
27,
28]. Another study focused on the TCR γδ T repertoire suggested that clonal expansion of γδ T cell and altered expression of IL-17A was associated with the clinical outcome of AMI [
29]. Regulatory T cell (Treg) has been shown to induce regression of atherosclerosis and to increase plaque stability in mice [
30]. Treg produced anti-inflammatory cytokines such as IL-10 and TGFβ, thus prevented disease progression of atherogenesis [
31]. Another study showed that the dysregulation of helper T cells impacted the immune response and impaired the stability of plaque in ACS patients [
7]. However, there are still many unsolved problems regarding the T cells in procession of ACS.
The CDR3 region represents the uniqueness of each TCR and thus used as TCR signature or barcode [
32]. Diversified TCRs were required for an intense adaptive immune responses, while pressures from both internal and external help shape the diversity of TCR [
33,
34]. The TCR repertoire of patients with atherosclerosis has been investigated and level of diversity was reduced in AS plaques [
35]. In the present study, we found that clonal diversity of the TCR CDR3 β decreased in ACS patients as compared to NCA. Meanwhile, a higher percentage of frequent clones (the top 200 TCRβ) were observed in ACS patients, especially in UA. Additionally, we found that the average overlap between ACS and NCA was significantly different. Collectively, these data reflected that clonal expansion of T cells occurred in ACS patients.
Many local autoantigens contribute to these immunoregulatory abnormalities, resulting in the clonal restriction of T cells [
36]. This restriction is associated with the plaque instability and inflammatory response [
37]. Researchers have found oxidative low density lipid (ox-LDL) specific T cells and oligoclonal T cells in atherosclerotic lesions [
38]. T cells expressing Vβ 6 were significantly proliferated in atherosclerotic plaques and responsible for ox-LDL recognition [
39]. In our study, we observed that frequencies of 11 V gene segments and 1 J gene segment were altered in ACS patients compared to NCA.
The numbers and types of T cell clones containing different TCR amino acid/nucleic acid sequences are extremely large. Many techniques used in most of the previous studies are difficult to accurately reveal the features of TCRβ CDR3 clonotypes [
40]. The immune repertoire sequencing technology used in our study is based on the multiplex PCR and next-generation sequencing, and much sensitive than previous method [
41]. Meanwhile, we characterized the receptor signatures of T cells from ACS patients without any in vitro manipulation, thus avoided bias and obtained a near in vivo result.
Conclusions
In summary, the present study investigated a comprehensive characterization of TCRβ CDR3 repertoire in patients with UA, AMI and NCA. Our data suggested T cell diversity was significantly altered in ACS compared with NCA, and we identified some shared TCRβ clonotypes which were disease-associated. These results facilitate to improve our understanding of ACS and provide a new sight to explore the mechanism of this disease.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.