nach oben

Medical Oncology

Erschienen in:

01.06.2019 | Correction

Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer

verfasst von: Zhifeng Lin, Liwen Xiong, Qiang Lin

Erschienen in: Medical Oncology | Ausgabe 6/2019

Einloggen, um Zugang zu erhalten

Excerpt

The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as "TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT". …

Titel: Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer
verfasst von: Zhifeng Lin
Liwen Xiong
Qiang Lin
Publikationsdatum: 01.06.2019
Verlag: Springer US
Erschienen in: Medical Oncology / Ausgabe 6/2019
Print ISSN: 1357-0560
Elektronische ISSN: 1559-131X
DOI: https://doi.org/10.1007/s12032-019-1276-y

Neu im Fachgebiet Onkologie

24.04.2024 | DGIM 2024 | Nachrichten

Bei Senioren mit Prostatakarzinom auf Anämie achten!

23.04.2024 | Medikamente in Schwangerschaft und Stillzeit | Nachrichten

ICI-Therapie in der Schwangerschaft wird gut toleriert

22.04.2024 | DGIM 2024 | Kongressbericht | Nachrichten

Krebspatienten impfen: Was? Wen? Und wann nicht?

22.04.2024 | DGIM 2024 | Kongressbericht | Nachrichten

Müde im Alter? Auch an die Nebenniere denken

weitere anzeigen

Springer Medizin

Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer

Excerpt

Neu im Fachgebiet Onkologie

Bei Senioren mit Prostatakarzinom auf Anämie achten!

ICI-Therapie in der Schwangerschaft wird gut toleriert

Krebspatienten impfen: Was? Wen? Und wann nicht?

Müde im Alter? Auch an die Nebenniere denken

Update Onkologie

Springer Medizin

Excerpt

Bitte loggen Sie sich ein, um Zugang zu diesem Inhalt zu erhalten

Weitere Artikel der Ausgabe 6/2019

Intra- and inter-observer variability in breast tumour bed contouring and the controversial role of surgical clips

N-Glycosylation in progression of skin cancer

Multicenter open-label randomized phase II study of second-line panitumumab and irinotecan with or without fluoropyrimidines in patients with KRAS wild-type metastatic colorectal cancer (PACIFIC study)

Timing of treatment in small-cell lung cancer

Subgroup analysis of efficacy and safety of orantinib in combination with TACE in Japanese HCC patients in a randomized phase III trial (ORIENTAL)

Identification of candidate diagnostic and prognostic biomarkers for human prostate cancer: RPL22L1 and RPS21

Neu im Fachgebiet Onkologie

Bei Senioren mit Prostatakarzinom auf Anämie achten!

ICI-Therapie in der Schwangerschaft wird gut toleriert

Krebspatienten impfen: Was? Wen? Und wann nicht?

Müde im Alter? Auch an die Nebenniere denken

Update Onkologie