Skip to main content
Erschienen in: Gut Pathogens 1/2014

Open Access 01.09.2014 | Research

Correlation between the genomic o454-nlpD region polymorphisms, virulence gene equipment and phylogenetic group of extraintestinal Escherichia coli (ExPEC) enables pathotyping irrespective of host, disease and source of isolation

verfasst von: Christa Ewers, Flavia Dematheis, Haritha Devi Singamaneni, Nishant Nandanwar, Angelika Fruth, Ines Diehl, Torsten Semmler, Lothar H Wieler

Erschienen in: Gut Pathogens | Ausgabe 1/2014

Abstract

Background

The mutS-rpoS intergenic region in E. coli displays a mosaic structure which revealed pathotype specific patterns. To assess the importance of this region as a surrogate marker for the identification of highly virulent extraintestinal pathogenic E. coli (ExPEC) strains we aimed to: (i) characterize the genetic diversity of the mutS gene and the o454-nlpD genomic region among 510 E. coli strains from animals and humans; (ii) delineate associations between the polymorphism of this region and features such as phylogenetic background of E. coli, pathotype, host species, clinical condition, serogroup and virulence associated genes (VAG)s; and (iii) identify the most important VAGs for classification of the o454-nlpD region.

Methods

Size variation in the o454-nlpD region was investigated by PCR amplification and sequencing. Phylogenetic relationships were assessed by Ecor- and Multilocus sequence- typing (MLST), and a comparative analysis between mutS gene phylogenetic tree obtained with RAxML and the MLST grouping method was performed. Correlation between o454-nlpD patterns and the features described above were analysed. In addition, the importance of 47 PCR-amplified ExPEC-related VAGs for classification of o454-nlpD patterns was investigated by means of Random Forest algorithm.

Results

Four main structures (patterns I-IV) of the o454-nlpD region among ExPEC and commensal E. coli strains were identified. Statistical analysis showed a positive and exclusive association between pattern III and the ExPEC strains. A strong association between pattern III and either the Ecor group B2 or the sequence type complexes known to represent the phylogenetic background of highly virulent ExPEC strains (such as STC95, STC73 and STC131) was found as well. RF analyses determined five genes (csgA, malX, chuA, sit, and vat) to be suitable to predict pattern III strains.

Conclusion

The significant association between pattern III and group B2 strains suggested the o454-nlpD region to be of great value in identifying highly virulent strains among the mixed population of E. coli promising to be the basis of a future typing tool for ExPEC and their gut reservoir. Furthermore, top-ranked VAGs for classification and prediction of pattern III were identified. These data are most valuable for defining ExPEC pathotype in future in vivo assays.
Begleitmaterial
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s13099-014-0037-x) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Background

Escherichia coli is a normal inhabitant of the gastrointestinal microbiota of mammalians and birds, but at the same time it can cause a variety of diseases relevant for public and animal health such as diarrhoea, bacteraemia, septicaemia, urinary tract infections [1]. From a clinical perspective, E. coli is broadly classified into commensals, intestinal pathogenic E. coli (InPEC) and extraintestinal pathogenic E. coli (ExPEC), the latter group being further divided into uropathogenic E. coli (UPEC), septicaemia-associated E. coli (SEPEC), neonatal meningitis E. coli (NMEC), and avian pathogenic E. coli (APEC). ExPEC strains are normal colonizers of the gut of men and animals, but in contrast to intestinal pathogenic variants, they can cause infections to the urinary tract or the blood stream [2] once they reach the corresponding body site. Although collectively termed ExPEC, simply to reflect their shared ability to express functionally similar virulence factors and to denote considerable overlaps concerning serotypes and phylogenetic background [3],[4], this group of strains exhibits large genome diversity. This has been mainly attributed to the frequent location of virulence associated genes (VAGs) on plasmids, pathogenicity islands, or phages, allowing the VAGs to be highly interchangeable among strains through horizontal gene transfer (HGT) [5],[6]. The population structure of E. coli is characterised by the presence of distinct phylogenetic groups as observed by phylogenetic reconstruction [7],[8] or by the use of specific markers [9]. Based on these approaches, four (A, B1, B2 and D) major phylogroups have been described while according to the method, two minor (E and F) or two hybrid (AxB1 and ABD) phylogroups have been defined in addition, which are not necessarily equivalent [8]-[10]. The distribution (presence/absence) of virulence factors thought to be involved in the ability of a strain to cause diverse diseases also varies among strains of these phylogenetic groups, indicating a role of the genetic background in the expression of virulence [11]-[13].
The high diversity of ExPEC and the difficulty in a clear demarcation of these facultative pathogenic strains from their commensal counterpart poses a huge challenge to infectious medicine in terms of diagnostic and risk assessment. As recently shown, the genetic variability of the mutS-rpoS chromosomal region may serve as indicator and thus as a chromosomal marker for the different virulence potential of E. coli strains [2],[14]-[16]. The crucial genes are mutS, which encodes one of the four proteins required for methyl-directed mismatch repair (MMR) of DNA, and rpoS, which encodes a sigma factor (sigma 38) that regulates many stationary-phase and environmental stress response genes [17]. Although mutS and rpoS are generally conserved in Enterobacteriaceae, the mutS-rpoS intergenic and its adjacent region revealed extensive genetic variability that was subjected to genetic exchange during the evolution of pathogenic lineages. Several studies revealed a pathotype-associated polymorphism in this genetic region [15],[18],[19] suggesting it to be the region owing to HGT and evolutionary processes. In comparison to E. coli K-12, previous studies revealed that enteropathogenic E. coli (EPEC), enterohaemorrhagic E. coli (EHEC) and E. coli group B2 strains harbour specific DNA insertions within the mutS-rpoS intergenic region [15],[16],[19]. An insertion of 2.1 kb, in place of the initially identified 2.9 kb insert at the proximity of E. coli O157:H7 [19] has been found in strains of uropathogenic E. coli[15] and larger intergenic regions exist in strains of EPEC and EHEC [16]. Moreover, phylogenetic analysis of EHEC and EPEC strains, as well as strains of the Ecor collection, revealed that the mutS gene itself may be frequently subject to horizontal transfer and recombination during the evolution of these strains which is consistent with mechanism for stabilizing adaptive changes promoted by mutS mutators with relaxed recombination barriers [14],[20].
In the present study we attempted to assess the importance of the mutS-rpoS intergenic region as a surrogate marker for the rapid identification of highly virulent ExPEC strains and to delineate biological meaningful subgroups among this highly diverse group of strains. In particular, we aimed: (i) to characterize the genetic diversity of the mutS gene and of the o454-nlpD genomic region among 510 E. coli strains obtained from animal and human sources; (ii) to delineate associations between the polymorphism of this region and features such as phylogenetic background of E. coli, bacterial class or pathotype, host species, clinical condition, serogroup and virulence associated genes (VAG)s; and (iii) to identify the most important ExPEC-related VAGs for classification of the o454-nlpD genomic region by using the random forest (RF) algorithm [21]. The results could be a valuable contribution to ongoing analyses on pathoadaptive alterations in ExPEC strains that affect disease severity and may have consequences for diagnostics of E. coli infections (15).
Here we provide sound evidence that this polymorphic region indeed is correlated with virulence, and with the high number of newly generated whole genome data of E. coli, researchers working with this versatile bacterial pathogen can further proof validity of our data in a larger context.

Results

Size variation and DNA polymorphism in the fhlA-nlpD region with respect to the phylogenetic background of E. coli strains

PCR amplification of the o454-nlpD region among 510 E. coli strains revealed a mosaic structure of the o454-nlpD genomic region. Four patterns characterized by a differentiating length and genomic structure, were identified: pattern I was defined by the absence of a PCR product due to a lack of o454 gene (synonyms b2740 and ygbN), which codes for a putative Zn++-dependent hydrolase and a permease; pattern II showed an amplicon of 1.319 bp in length consisting of the full sequence of the RNA-polymerase gene rpoS; pattern III consisted of a DNA fragment of 3.685 bp in length carrying the full sequences of hypothetical protein genes c3302, c3303 and c3304 genes; pattern IV comprised a DNA fragment of 4.546 bp in length carrying the full gene sequences of hydroxybenzoate decarboxylase subunit genes kpdD, kpdC, kpdB and of Salmonella lysis gene slyA (transcriptional regulator gene, required for survival within macrophages). Only exceptionally, other amplicon sizes were observed. One human commensal strain (IMT13844; ST405) showed an o454-nlpD pattern of ca. 2000 bp length. Sequencing of this DNA region revealed the insertion of a mobile element between o454 and rpoS sharing 100% identity with a transposase of the IS200 family [22]. Strain Ecor6 principally showed MG1655-specific pattern I, but with a 354 bp-deletion in the rpoS gene (position 298 to 651 bp). Strain Ecor32 revealed pattern III with a ca. 300 bp deletion and Ecor36 showed a pattern IV structure with a ca. 250 bp insertion of unknown sequence.
The results of pattern distribution were in agreement with the presence/absence and sizes of other amplicons along the fhlA-nlpD genetic region (Table 1 and Figure 1). For example, fhlA-mutS amplicons (primers F1/R1; Table 1) of 1.673 bp and o454-o347 amplicons (primers F5/R5) of 816 bp in size were exclusively determined in pattern III strains, such as UPEC strain CFT073. A 716-bp o454-yclC (kpdC) amplicon (primers F5/R4) was only detected in pattern IV strains, and a 1318-bp mutS-yclC/kpdC amplicon was only present in pattern I strains.
Table 1
Oligonucleotide primers used for the amplification of the intergenic and adjacent o454-nlpD genomic region of E. coli
Primer name
Genetic regiona
Predicted amplicon size (bp) in reference strainsb
Forward/reverse primer sequences (5?-3?)
For
Rev
 
MG1655
CFT073
E2348/69
EDL933
 
F1
R1
fhlA-mutS
1.208
1.673
1.208
1.208
AGAGTTCCGTAGCGATCTC/CTGCTGCATCATGGGCGTAT
F1
R2
fhlA-nlpD
11.840
14.357
15.192
8.679
AGAGTTCCGTAGCGATCTC/ CATAACGACACAATGCTGGTCC
F2
R1
ygbA-mutS
361
360
359
361
TTCACGAGAGATACGCTTGC/CTGCTGCATCATGGGCGTAT
F3
R3
mutS-o388
2.881
2.881
2.881
-
AAAGCATTTCGCCGAACGCCGC/CATCGGCGATAACGCCAAT
F3
R4
mutS-yclC
-
-
7.365
1.318
AAAGCATTTCGCCGAACGCCGC/GACAACCGTGGTCACTACA
F4
R3
f265-o388
1.146
1.146
1.146
-
ACGCTCTACGGGTATCAACT/CATCGGCGATAACGCCAAT
F5
R2
o454-nlpD
1.318
3.685
4.546
-
AAGCCCTTGCCAACATGCTAC/CATAACGACACAATGCTGGTCC
F5
R5
o454-o347
-
816
-
-
AAGCCCTTGCCAACATGCTAC/CGTCAGGTTGAAATGCTTGACT
F5
R4
o454-yclC
-
-
716
-
AAGCCCTTGCCAACATGCTAC/GACAACCGTGGTCACTACA
F6
R2
slyA-nlpD
-
-
1.394
1.393
TTGAGTGCAGAAGAGCAGG/CATAACGACACAATGCTGGTCC
F2
R1
c3292-mutS
-
1.120
1.119
-
TAACCGGAACAGTTAGCGC/CTGCTGCATCATGGGCGTAT
aBiological functions of amplified genes: fhlA, formate hydgrogen lyase; mutS, mismatch repair protein; nlpD, outer membrane lipoprotein; ygbA, hypothetical protein; o388 (syn. ygbK), hypothetical protein; yclC (syn. kpdC), 4-hydroxybenzoate decarboxylase determinant; f265 (syn. ygbL), hypothetical transcriptional regulator; o454 (syn. b2740 and ygbN), putative zinc-dependent hydrolase; o347 (syn. c3302), limited level of similarity to enzymes implicated in antibiotic hydrolysis and synthesis; slyA (syn. kpdR), 4-hydroxybenzoate decarboxylase determinant, in Salmonella transcriptional regulator, required for survival within macrophages the induction of hemolytic and pore-forming proteins; c3292, putative molybdenum-pterin-binding protein. bBased on whole genome sequences deposited to GenBank under accession numbers U00096 (MG1655), NC_004431 (CFT073), FM180568 (E2348/69), and NC_0022655 (EDL933).
To link the different o454-nlpD regions with the phylogenetic background of the strains, multilocus sequence- typing (MLST) and phylogenetic grouping by structure analysis was performed. MLST revealed that the E. coli strains under study were dispersed among 173 STs, and 54 of them were allocated to the following ST complexes: STC73, STC14, STC12, STC95, STC101, SC155, STC10, STC350, STC86 and STC23. The most prominent STCs, harbouring half of the strains investigated, were STC95, STC10, STC73, STC23, and STC12. E. coli strains carrying the o454-nlpD fragment of 3.656 bp (pattern III) were nearly exclusively allocated to Ecor group B2-ST complexes such as STC95, STC73 and STC12 as shown in Figure 2. Generally, the strains were classified into six phylogenetic groups including hybrid groups ABD and AxB1 as follows: A (n?=?71), ABD (n?=?53), AxB1 (n?=?39), B1 (n?=?60), B2 (n?=?250) and D (n?=?37). E. coli strains characterized by pattern III were found exclusively in B2 group with only two exceptions (Table 2).
Table 2
Distribution of o454-nlpD patterns with respect to E. coli phylogenetic groups*
 
Pattern I
Pattern II
Pattern III
Pattern IV
ExPEC (n?=?367)
A
1
35
0
1
ABD
18
2
2
21
AxB1
1
6
0
13
B1
0
37
0
15
B2
0
1
196
0
D
7
0
0
11
Fecal (n?=?143)
A
0
34
0
0
ABD
6
1
0
3
AxB1
1
4
0
14
B1
0
2
0
0
B2
0
0
53
0
D
7
2
0
10
Total No. of strains (n?=?510)
A
1
69
0
1
ABD
24
3
2
24
AxB1
2
10
0
27
B1
0
39
0
21
B2
0
1
249
0
D
14
2
0
21
o454-nlpD patterns: I?=?o454-negative, II?=?1.319 bp, III?=?3.685 bp, IV?=?4.546 bp.
*One E. coli strain which carries the IS 2000 in the o454-nlpD region is not included here.
The genomic region surrounding the mutS-rpoS genes was further amplified from E. coli strains EDL933, MG1655, CFT073, and E2348/69 as a single?~?8.6 kb, 11.8kb, 14.3 kb, and 15.2 kb fragment, respectively, as predicted from the genomic sequence (Figure 1). Application of the long range PCR to a subset of 225 strains of E. coli representing different hosts, clinical origins and phylogenetic groups also ranged in size between?~?8 kb and 15 kb (Figure 3). Digestion of the long PCR amplicons with the four-base cutting enzyme AluI resolves the 225 strains into 19 different RFLP types (types A to S) with an RFLP type defined as revealing a unique restriction profile and containing at least 2 strains. In addition, eight singletons have been determined and RFLP types are exemplarily shown in an additional File (see Additional file 1). Results from single PCRs performed on these 225 strains to amplify distinct genomic regions located along the entire fhlA-nlpD region were consistent with the gene patterns and sizes deduced from the control strains (Table 1). RFLP type A (n?=?69 strains) was the most predominant restriction pattern and was exclusively constituted by phylogroup B2 and o454-nlpD pattern III strains of different multilocus sequence types, particularly of those belonging to the ST complex STC95 (88.4%). Another 37 strains were assigned to RFLP type B that resembles the CFT073 AluI-restriction profile. More than two thirds of the strains allocated to this RFLP type were assigned to five different sequence types of the B2-ST complex STC73, while single strains were also assigned to STs of other clonal complexes, including ST131, ST12, ST144, and ST355, all of which are allocated to the B2 group. Likewise, other RFLP types are linked with certain phylogenetic backgrounds such as type D with B2-ST141, type E with D-ST115 and D-ST68, type F with ABD-ST117, type H with D-ST38, type J with ABD-ST62, type P with B1-STC23 or type Q and type R with A-STC10. Only exceptionally, different phylogenetic groups are associated with one RFLP type, while the clustering of different STs of same phylogenetic groups within a single RFLP type was frequently observed.

Serogroups

Among the E. coli strains subjected to serotyping (n?=?426) 62 different O-antigens and 29 different H-antigens were determined (see Additional file 2). The most commonly occurring serogroups were O1:H7 (n?=?15), O78:NM (n?=?14), O18:H7 (n?=?16), O6:H1 (n?=?13), and O2:H5 (n?=?10). While O78:NM was associated almost exclusively with pattern II, all the others were strictly associated with pattern III with only one exception. A number of isolates revealed an O antigen which was either not typable (n?=?74) or rough (n?=?12). Another 45 isolates harboured a flagella antigen which could not be assigned a known type.

Association between o454-nlpD genomic region and sample category, MLST, phylogroup, class/pathotype, host species, clinical condition and serotype

Person’s chi-squared test showed a strong association between the o454-nlpD patterns and the strain categories ‘Faecal/Commensal’ and ‘ExPEC’, with a p-value?<?0.01 (p?=?0.008). In particular, the Cohen-Friendly association plot revealed a positive and exclusive association between the pattern III and the ExPEC category (Figure 4). Differently, the faecal category was positively associated to all other patterns.
Due to the high number of nominal variables, the strength of association between o454-nlpD patterns and one of the variables sequence type, phylogroup, class/pathotype, host species, clinical condition and serotype, was investigated using a Cramer’s V test (Table 3). The o454-nlpD regions and MLST groups were strongly associated with a Cramer’s V value of 0.99. The Theil’s symmetric Uncertainty Coefficient (uc) revealed that knowing the values of the independent MLST variable, the uncertainty about the values of the dependent variable o454-nlpD pattern decreased by about 98% with a significant p-value of zero (p.uc.CR?=?0), but not vice versa. Similarly to the MLST, a very strong association between o454-nlpD regions and the phylogenetic group was found (Cramer’s V?=?0.75). In this case, the uncertainty on predicting one of the variables from another on average was about 65% (uc.sym =0.65). Statistical analysis revealed a strong association (Cramer’s V?=?0.76) between the o454-nlpD patterns and the serogroup. However, the uc.sym of 0.27 revealed a probability of only 27% on correctly predicting the two variables from each other. A weaker relationship was found between o454-nlpD regions and class/pathotype, host species, clinical category, and clinical condition.
Table 3
Strength of association between the o454-nlpD regions and the MLST and Ecor groups, class or pathotype, host species, clinical category, and serogroup
 
cramers.v
uc.RC
p.uc.RC
uc.CR
p.uc.CR
uc.sym
MLST
0.99
0.28
0
0.99
0
0.44
Ecor
0.75
0.58
1.49e-228
0.72
4.63e-284
0.65
Class/Pathotype
0.22
0.05
2.79e-06
0.06
3.64e-06
0.05
Host species
0.31
0.08
1.42e-13
0.11
2.23e-11
0.09
Clinical category
0.19
0.03
1.38e-05
0.05
1.57e-05
0.04
O-groups
0.63
0.16
2.12e-65
0.45
1.8e-62
0.24
H-groups
0.56
0.17
1.48e-47
0.38
1.77e-42
0.24
Serogroup
0.84
0.19
8.93e-156
0.75
1.65e-272
0.3
The values Cramer’s V, uc.RC, p.uc.RC, uc.CR, p.uc.CR and uc.sym are reported here. Cramers.v measure the association between two nominal variables, giving a value between 0 and +1 (inclusive); uc.RC is the Theil’s symmetric Uncertainty Coefficient UC, indicating how much knowing the values of the Row variables decreases uncertainty about the Column variables; p.uc.RC is the probability of gaining UC(R|C) by chance; uc.CR is the Theil’s symmetric Uncertainty Coefficient UC, indicating how much knowing the values of the Column variables decreases uncertainty about the Row variables; p.uc.CR is the probability of gaining UC(C|R) by chance; uc.sym is a combination of uc.RC and uc.CR. The association was evaluated with the R-package ‘polytomous’. The two-way contingency tables used for this analysis are reported in Additional files (see Additional file 2, Additional file 5, Additional file 6, Additional file 7, Additional file 8 and Additional file 9).

Virulence associated genes and o454-nlpD genomic region

Among 47 VAGs tested the non-fimbrial adhesin gene nfaE was absent in all strains, while the other 46 VAGs occurred differently in our data set. For each VAG the significance of the pattern association in terms of p-values, the pattern to which they are associated with and the type of associations (positive/negative) were investigated and reported in Table 4. Statistical analysis revealed that pattern III, which generally harboured the highest mean number of VAGs (23.1±4.6) compared with strains of patterns I (13.1±5.0), II (10.7±5.7), and IV (12.6±6.2), was exclusively associated with 26 VAGs, 23 of which were positively, and three negatively associated. Pattern III was also significantly associated with another twelve VAGs, but not in an exclusive way. For instance, the curli gene csgA and the bifunctional adhesin and iron receptor gene iha were negatively associated with pattern III together with pattern I and II, respectively. Genes such as hra (heat-resistant agglutinin), papC (Pap-fimbrial subunit), chuA (haem utilization gene), kpsMTII (capsule group II synthesis), sat (secreted autotransporter toxin) and tia (toxigenic invasion locus A) were positively associated with pattern III together with pattern I, while the genes ompT (outer membrane protein), traT (transfer protein), hlyF (hemolysin) and pic (serin protease) were positively associated with pattern III together with pattern IV. No significant association between o454-nlpD regions and adhesion genes afa/draBC, bmaE, gafD, and tsh, iron acquisition genes iucD, iutA, and sitDchromosomal, and with serum resistance gene ompA was found.
Table 4
Virulence-associated genes with significant association to o454-nlpD patterns
VAG
P-value
Association with pattern
Type of association
focG
1.18e-15
III
+
papAH
8.50e-25
III
+
papEF
3.83e-11
III
+
papG II/III
3.32e-20
III
+
sfa/foc
1.23e-33
III
+
sfaS
6.01e-15
III
+
fyuA
7.10e-25
III
+
ireA
1.99e-08
III
+
iroN
3.62e-40
III
+
irp2
7.14e-42
III
+
sitD chromosomal
6.87e-80
III
+
colV
0.000
III
+
iss
0.001
III
+
neuC
1.96e-28
III
+
cnf
1.30e-17
III
+
vat
2.41e-76
III
+
hlyA
1.39e-20
III
+
ibeA
3.96e-22
III
+
gimB
1.12e-35
III
+
malX
2.03e-94
III
+
pks
3.53e-49
III
+
puvA
6.94e-05
III
+
ea/I
1.59e-67
III
+
fimC
4.52e-06
III
-
mat
0.047
III
-
astA
0.002
III
-
hrA
3.39e-05
I, III
+
papC
2.31e-19
I, III
+
chuA
6.42e-78
I, III
+
kpsMTII
9.17e-42
I, III
+
ompT
0.001
III, IV
+
traT
0.034
III, IV
+
sat
0.007
I, III
+
hlyF
0.001
III, IV
+
tia
4.84e-05
I, III
+
pic
3.95e-14
III, IV
+
csgA
6.44e-85
I, III
-
iha
7.91e-05
II, III
-
P-values obtained with Fisher’ exact test and type of association with Cohen-Friendly association plot. No significant association was observed for genes afa/draBC (p?=?0.463), bmaE (p?=?0.085), gafD (p?=?0.257), tsh (p?=?0.386), iucD (p?=?0.565), iutA (p?=?0.506), sitDepisomal (p?=?0.89), and ompA (p?=?0.354).

Random forest and importance of VAGs for classification of E. coli population into patterns

In order to interpret the relevance of VAGs variables for pattern prediction of the data set under study and to filter out non-informative VAGs, Random Forest algorithm was used. The RF classification of the o454-nlpD patterns estimated an out-of-bag (OOB) error rate mean of 18.43% when using 46 VAGs. The OOB error rate for classification of each pattern is reported in Table 5. Only pattern III showed an error rate of zero, indicating a good performance of RF for pattern III prediction. The first most important genes for classification, as measured by the mean decrease in accuracy, were genes for curli adhesin CsgA, pathogenicity island marker MalX which represents a major carbohydrate active-transport system, haemin uptake system ChuA, vacuolating autotransporter toxin Vat, and iron and manganese transporter SitD (chromosomal gene variant) with values ranging between 25 and 30 (Figure 5a). Similar results were obtained measuring the importance of each VAG using the OOB data and the mean decrease Gini scores as shown in Figure 5b.
Table 5
OOB (out-of-bag) error rate for o454-nlpD pattern classification*
 
Pattern I
Pattern II
Pattern III
Pattern IV
Class. error
Pattern I
29
0
1
11
0.29
Pattern II
0
115
5
4
0.07
Pattern III
0
0
251
0
0
Pattern IV
15
51
7
21
0.78
o454-nlpD patterns: I?=?o454-negative, II?=?1.319 bp, III?=?3.685 bp, IV?=?4.546 bp.
*One E. coli strain which carries the IS 2000 in the o454-nlpD region is not included here.

Phylogenetic analysis of the E. coli mutS gene

Comparison of 177 partial mutS gene sequences generated in this study (n?=?85 strains representing different o454-nlpD patterns, pathotypes, hosts, and multilocus sequence types), described in a previous study [14] (n?=?72 Ecor strains; n?=?20 mutS sequences obtained from available whole genome sequences), and obtained from 20 whole genome sequences of various E. coli pathotypes revealed 60 different mutS alleles. Although some of the bootstrap values show a low support for certain branches of the tree for the mutS sequence dataset a significant clustering of the mutS alleles can be observed (Figure 6). Many of these clusters are according to the population structure given from the housekeeping genes phylogeny (see Additional file 3), as deduced from the MLST dataset and corresponding assignment to Ecor groups performed by structure analysis. Yet there are some strains that contain a mutS from a different phylogroup. For example, in APEC strain IMT2104 and avian commensal strain IMT10740 the Ecor group B2 is involved which is usually a very distinct phylogenetic group. These observations confirm former analyses about the differences in the evolution of mutS compared to the core genome. One possible explanation for this phenomenon could be a different recombination rate for the region containing the mutS gene.

Discussion

The mutS-nlpD region represents a major operational region of genomic evolution in Enterobacteriaceae. Previous studies suggested that the polymorphic nature of this genetic region due to high mutation rate and to loss or acquisition of genes by horizontal gene transfer plays an important role in the constant adaptation of the bacteria to environmental changes and to new ecological niches [2],[14]-[16]. So far, the mosaic structure of the mutS-nlpD region was mainly investigated in intestinal pathogenic strains. By that, RFLP type analysis of the fhlA-nlpD genomic region revealed four different clusters: i.e. K-12 and Ecor group A, EPEC 1 group, EPEC 2 & EHEC 2 groups, and O157:H7 & EHEC 1 group [16]. Soon after, Le Clerc et al. [19] detected a polymorphism at the proximity of the rpoS gene. In particular, a 2.9-kb DNA insertion was identified in E. coli O157:H7 and related enterohaemorrhagic E. coli (EHEC) strains as well as in Shigella dysenteriae[19], while a 2.1-kb DNA insert was observed in E. coli pyelonephritis strain CFT073 [15]. These authors investigated diverse clinical isolates, including 23 from urinary tract infections (UTIs), 26 from infantile diarrhoea and haemorrhagic colitis, and seven from catheter-associated infections. Since the DNA insert previously identified in UPEC strain CFT073 was more common among urinary tract infection isolates (82.6%) than among other clinical E. coli isolates they suggested it to be specifically linked with uropathogens [15]. They also stated, that all B2 strains of the E. coli reference collection harboured this specific DNA insert und concluded that it might also predict the virulence of a strain, as B2 strains are known to be highly virulent in terms of extraintestinal pathogenicity.
From these studies it seemed likely that there might be pathotype- or virulence-associated polymorphisms in the mutS-rpoS region of the E. coli chromosome, although this has not been verified by using a large set of field strains. In the present study, PCR analyses of the o454-nlpD intergenic sequence from 510 predominantly extraintestinal pathogenic and commensal E. coli strains revealed substantial size variation. With only few exceptions, the strains were grouped into four patterns which resembled previously identified groups determined for the O157:H7 & EHEC 1 group (termed as pattern I in our study), K-12 and Ecor A group (pattern II), CFT073 and other uropathogens (pattern III), and the EPEC group (pattern IV) [15]. While patterns I, II, and IV were randomly distributed among all non-B2 group strains, pattern III was exclusively observed in group B2 strains, both of clinical and faecal origin. This is consistent with the genomic variation in selected Ecor strains described by others [15],[19],[23],[24]. With respect to the ongoing evolution and due to observations from previous MLST analyses [8] it is generally recognized that the Ecor collection does not reflect the entire E. coli population. Previous findings about the presence of the rpoS-proximal 2.1-kb insertion in all Ecor group B2 isolates and in a limited number of clinical isolates could thus not be extrapolated to nowadays relevant ExPEC-sequence types, such as ST95, ST127, ST372, and the global emerging multiresistant ST131 clone [25]-[29]. In our strain collection, these sequence types as well as other clinically important B2-STs, including ST73 and ST80 [28],[30] were frequently represented suggesting the existence of a B2-associated mutS-nlpD intergenic region.
Since pattern III was found to be highly associated to the strain category ExPEC and with a higher number of ExPEC-related VAGs we could speculate a potential role of these genes with the ability of the strain to invade extraintestinal tissues. However, replacement of slyA with other genes such as o347 and o183 in pattern III and their roles in pathogenesis remain to be investigated. SlyA, found exclusively in the EHEC- and EPEC-related patterns I and IV plays an important role in the invasion and survival of Salmonella in macrophage cells [31]. The relevance of this transcriptional regulator for the pathogenesis of non-B2 ExPEC strains has not been explored yet. Similarly, the putative role of the o347-encoded factor, showing a limited level of similarity to enzymes implicated in antibiotic hydrolysis, remains to be determined [15],[32]. Girardeau et al. [33] investigated common traits between animal and human ExPEC isolates positive for afimbrial adhesin gene afa-8. Interestingly, they found a significant proportion of human pyelonephritis-associated isolates showing the mutS-rpoS intergenic region found in EPEC and EHEC isolates. Furthermore, a putative function of SlyA in the pathogenesis of certain extraintestinal E. coli isolates which largely lack ExPEC-associated traits, such as S-fimbrial gene sfa, alpha-hemolysin gene hly, cytotoxic necrotizing factor gene cnf, was suggested. In accordance with our data, Girardeau et al. [33] and others observed mutS-rpoS intergenic patterns among ExPEC strains, which were previously associated with intestinal pathotypes [15],[33]. Thus, with respect to the group of ExPEC and its various pathotypes this genetic region may not be regarded as pathotype-associated but more likely as a marker to reflect their diversity and probably to predict highly virulent members of this group, as different patterns are obviously linked with single ExPEC-related virulence genes.
Advance statistics like Random Forest (RF) algorithm was used to resolve difficult tasks such as the identification of the most important VAGs for the prediction of the o454-nlpD patterns. The RF classification of the o454-nlpD patterns estimated an OOB (out-of-bag) error rate of 18.4% when using 46 virulence-associated genes (VAGs). This relatively high error rate clearly indicated that not all VAGs used were strongly associated with a specific o454-nlpD pattern as shown in Table 3 where only pattern III is associated to specific genes. Other genes where associated to at least two different patterns. However, since the error rate in predicting the pattern III was zero (Table 5 and Additional file 4) we can conclude that RF performed very well for pattern III prediction. Furthermore, RF allowed us to identify for the first time the top-ranked VAGs for pattern III prediction. The most predictive indicators, the genes csgA, malX, chuA, vat and sitDchromosomal were also statistically significant predictors, and thus worthy of further investigation. Since pattern III was nearly exclusively linked with group B2 strains in our study, these genes may also be regarded as predictive for highly virulent members of the ExPEC group and of commensal E. coli harbouring virulence potential, respectively. Indeed, the heme binding protein encoding gene chuA is one of the genetic regions targeted in the PCR-based approach for rapid phylogenetic typing of E. coli strains and is said to occur regularly in group B2 and D strains [9],[34]. ChuA, together with vat, which encodes an autotransporter serine protease toxin, fyuA, which encodes the yersiniabactin receptor and finally a gene (yfcV), which encodes the major subunit of a putative chaperone-usher fimbria, have previously been included in a diagnostic multiplex PCR to identify strains of the UPEC pathotype [35]. In their study, Spurbeck et al. [35] suggested that E. coli isolates that encode these four genes are correlated with high numbers of other VAGs, are able to colonize the bladder in higher numbers than strains lacking these genes, and are nearly 10 times more likely to represent UPEC or NMEC strains than faecal commensal strains [35]. Likewise positively linked with pattern III strains is malX, which codes for a phosphotransferase system enzyme II that recognizes maltose and glucose [36] and is frequently present in ExPEC strains [37]-[39]. Östblom et al. [40] could demonstrate, that malX was among those genes that were associated with fitness of E. coli in the infant bowel microbiota. Here, carriage of various pathogenicity island markers and particularly malX correlated positively with the time of persistence of individual strains in the colon, supporting their role to increase the fitness of E. coli in its natural niche, the colon [38].
The mutS chromosomal region has long been identified as the location for the insertion of blocks of VAGs e.g. in the case of the two widely diverged pathogens, Salmonella Typhimurium and Haemophilus influenzae. In S. Typhimurium, a 40 kb pathogenicity island (SPI-1) is inserted 5? to the mutS gene [40] and in H. influenzae, a 3.1 kb tryptophanase gene cluster (tna) is inserted on the 3? side of the mutS gene in strains that cause spinal meningitis in infants [41]. This insertion allows the utilization of tryptophan and, thus, provides a growth advantage for the pathogen, particularly in the tryptophan-rich environment of cerebrospinal fluid. In our study, there was no indication for an insertion of PAI-like structures or of larger blocks of VAGs in the intergenic mutS-rpoS region in any of the 510 E. coli strains under investigation. Other studies raised the hypothesis that a certain o454-nlpD pattern, reflecting distinct evolutionary E. coli lineages, might be linked with the acquisition of VAGs at chromosomal sites outside this genetic region by HGT [2],[15],[42]. Culham and Wood [15] suggested that the 2.1-kb insertion upstream of rpoS arrived earlier than certain virulence determinants linked with urinary tract infections, such as genes for P-fimbriae (pap), S-fimbriae (sfa), a polyketide synthetase (pks), and ?-hemolysin (hly) during the evolution of group B2. Basically, the polymorphism in this genetic region is considered to result from the close linkage of mutS and rpoS genes which are frequently mutated in E. coli evolution due to ecological specialization upon repeated shuttles between different environments [2]. Here, their inactivation as well as the re-acquisition of functional alleles might have been of selective advantage, e.g. in terms of stress resistance, higher mutation rates, genome plasticity, and stabilization of beneficial adaptive mutations [5],[43].
Indeed, in addition to the findings of genetic variability, phylogenetic analysis of EHEC and EPEC pathogens, as well as strains of the Ecor collection, revealed that an unexpected level of recombination between mutS genes has occurred during the evolution of these strains [14],[20]. In a comparison of mutS phylogeny against predicted E. coli ‘whole-chromosome’ phylogenies, derived from multilocus enzyme electrophoresis (MLEE) and mdh sequences, Brown et al. [14] observed striking levels of phylogenetic discordance among mutS alleles and their host strains, which basically represented the Ecor collection. To investigate whether this is also true for a greater collection of strains and using concatenated MLST gene sequences instead of single genes or MLEE as comparison, we extended this approach on 177 ExPEC and commensal strains. Here, many of the mutS alleles clustered according to the population structure given from the housekeeping genes phylogeny, indicating a low frequency of recombination events across phylogenetic groups. However, for a number of strains we also found incongruence between these two phylogenies, which is likely due to recombination of mutS between different phylogenetic groups. By investigating the molecular phylogeny of MMR (methyl-directed mismatch repair) genes from natural E. coli isolates Denamur et al. [20] could show that, compared to two housekeeping genes, individual functional MMR genes exhibit high sequence mosaicism derived from diverse phylogenetic lineages. They suggested that the MMR functions have frequently been lost and reacquired in the evolution of E. coli. To which extent mutS and other genes of the MMR system as well as the mutS-nlpD intergenic region represent a hallmark of a mechanism of adaptive evolution in ExPEC and in other E. coli pathotypes has been scarcely investigated. Certainly, mutS has a unique role in the formation of mutators with relaxed recombination barriers, and bacteria with a defect in their MMR system, e.g. by a temporary loss of mutS, are more prone to genetic variations and HGT and, consequently, have an increased capacity to adapt to the host environment or acquire new VAGs, respectively [2],[44]. This phenomenon was recently described for UPEC strains, where mutS and other genes of the MMR system were found to be involved in the reciprocal control of motility and adherence of UPEC due to an increased expression of flagellin [44]. The authors discussed a possible relationship between MutS and UPEC pathogenesis in general as urinary tract isolates exhibit a higher occurrence of mutator strains than commensal E. coli or any other E. coli pathotype [42].

Conclusions

The mutS-rpoS intergenic region of ExPEC and commensal E. coli strains resembles a great phylogenetic diversity of these strains as exemplified by the presence of four different patterns. The grouping based on o454-nlpD amplicons and RFLP patterns of the entire mutS-rpoS region was in accordance with other genotype-based methods, like MLST and Ecor typing. Significant associations were determined between pattern III and phylogenetic group B2 strains, representing the most virulent members of the ExPEC group. MutS alleles revealed an evolution parallel to their phylogenetic background with few exceptions. The random forest algorithm allowed for the first time the identification of the most important virulence genes for prediction of the most virulent ExPEC strains.
Our results suggest the mutS-rpoS region to be of great value in identifying highly extraintestinal virulent strains among the mixed population of E. coli promising to be the basis of a typing tool for ExPEC and their reservoir.

Methods

Bacterial strains

A total of 510 E. coli isolates, including 72 strains of the E. coli reference collection (Ecor) were examined for their o454-nlpD genomic region. This strain collection comprised of 367 extraintestinal pathogenic E. coli (ExPEC) isolated from multiple anatomical sites and 143 strains isolated from the faeces of clinically healthy humans (n?=?83) and animals (n?=?60). Pathogenic strains were isolated from urinary tract infections in humans (n?=?65) and animals, including dogs, cats, horses, and pigs (n?=?93), avian systemic and local E. coli infections (collectively termed colibacillosis) (n?=?135), meningitis in infants (n?=?24), septicaemia in humans (n?=?28) and animals (n?=?5), and from other diseases, such as peritonitis, mastitis, metritis, cervicitis, and vaginitis in various animal species (n?=?18), the latter three diseases broadly categorized as genital tract infection. Clinical strains were recovered during routine microbiological diagnostic of samples from patients in hospitals and veterinary clinics in Germany. In case of disease outbreaks, only one strain per event was included. E. coli isolated from healthy individuals were avian faecal strains, which originated from cloacal swabs of clinically healthy poultry from Germany and human commensal strains isolated from the gut of healthy human carriers published earlier [45]-[47]. Commensal strains belonging to the Ecor collection originated from the gut of clinically healthy animals, such as cattle, dogs, sheep, pigs, and orang-utan [48].
We further included enteropathogenic E. coli E3248/69 [49] and enterohaemorrhagic E. coli EDL933 [50] as well as K-12 laboratory strain MG1655 as references for PCR mapping of the mutS-nlpD genomic region. Strains were stored at -70°C in brain heart infusion broth with 10% glycerol until further use.

DNA preparations

Bacterial DNA was extracted using the Master-PureTH Genomic DNA Purification Kit (Biozym Diagnostik GmbH, Hessisch Oldendorf, Germany) according to the manufacturer’ recommendations. DNA concentrations were determined by NanoDrop ND-1000 spectrophotometer. The DNA was diluted in MilliQ sterilized water to obtain ca. 50ng/μl, and 4μl were used for single and multiplex PCR.

Characterization of the o454-nlpD genomic region and sequence analysis of mutS

In order to investigate the o454-nlpD region size a PCR approach was used. The amplification of the o454-nlpD regions was carried out with oligonucleotide primers F5 and R2 (Table 1) using standard PCR conditions. The reference sequences selected for were: MG1655 (U00096), EDL933 (NC_002655), CFT073 (NC_004431) and E2348/69 (FM180568). The structure of these genomic regions and the relative size of the reference sequences are illustrated in Figure 1.
Long range PCRs for amplification of the whole fhlA-mutS region, using primers fhlA FP and nlpD RP, were performed by an Extensor Hi-Fidelity PCR Master Mix (ABgene’, Fisher Scientific - Germany GmbH) as recommended by the manufacturer. Briefly, for a 25μl reaction 10.0μl of Extensor Master Mix was mixed with 0.2μl of oligonucleotide primers in a 100 pmol concentration, 4 μl (400 ng) template DNA and 10.8μl deionized water. The amplification was performed in a thermal cycler (Perkin Elmer GeneAmp® PCR System 2400, Applied Biosystems, Darmstadt, Germany) using the following program: 92°, 2 min for initial denaturation; 10 cycles of 92°C, 10 sec denaturation, 59°C, 30 sec annealing and 68°C, 8 min elongation; the following 15°Cycles started with an extension time of 68°C, which was prolonged for 10 sec per cycle. A final extension cycle was applied at 68°C for 7 min.
E. coli strains were further investigated for various regions within the fhlA-mutS-rpoS-nlpD genomic region by PCR assays according to standard protocols [51]. Targeted genes, their descriptions as well as sequences of oligonucleotide primers and their positions within the target sequences are given in Table 1 and Figure 1.
Oligonucleotide primers used to amplify the mutS genes in E. coli were F1 and R3 and the sequences are given in Table 1. Amplification of mutS sequences was performed under the following conditions: initial denaturation at 94°C for 4 min; 30 cycles of 94°C for 45 sec, 58°C for 1 min, and 72°C for 2.30 min; and final incubation at 72°C for 10 min. After double strand sequencing of the amplicon (LGC Genomics, Berlin, Germany) the 380 bp-segment of the mutS gene, which corresponds to the conserved ATP-binding domain and to base pair coordinates 1808 to 2187 of the mutS coding region in E. coli CFT073 (GenBank accession number AE014075) was used for comparative phylogenetic analyses.
In addition to the 88 mutS alleles sequenced here, another 92 partial mutS sequences, originating from the Ecor strain collection (accession no. AF001987 - AF002010, AJ005826 - AJ005828, AF004287, AJ242620, and AF291185 - AF291258) and from fully sequenced strains CFT073 (UPEC, accession no. AE0140075), APEC_O1 (APEC, CP000468), UTI89 (UPEC, CP000243), HS (Commensal, CP000802), MG1655 (K-12, U00096), W3110 (K-12, AP009048), SMS-3-5 (Environmental, CP000970), 042 (EAEC, FN554766), 11128 (EHEC, AP010960), 11368 (EHEC, AP010953), 12009 (EHEC, AP010958), E2348/69 (EPEC, FM180568), EC4115 (EHEC, CP001164), EDL933 (EHEC, AE005174), H10407 (ETEC, FN649414), LF82 (AIEC, CU651637), O157:H7 Sakai (EHEC, BA000007), 536 (UPEC, CP000247), IAI39 (UPEC, CU928164), and UMN026 (UPEC, CU928163) were obtained from GenBank.
Phylogenetic trees of mutS sequences and concatenated sequences of the seven housekeeping genes included in MLST analyses were calculated using RAxML 8 [52]. For each phylogeny, 100 bootstrap replicates were calculated. The visualization of the tree was performed with Dendroscope 3 [53].

Nucleotide sequence accession numbers

The mutS nucleotide sequence data reported in this paper has been deposited in the GenBank sequence database with accession numbers KM232523 through KM232607.

Serotyping

Serotyping was performed on 426 strains at the Robert-Koch Institute (Wernigerode, Germany) by tube agglutination with rabbit anti-E. coli immune sera produced against a panel of antigenic test strains containing E. coli O-groups 1 to 181. Similar analysis was carried out in order to investigate the bacterial flagella antigens H group.

Multilocus sequence typing (MLST), Ecor grouping and phylogenetic analyses

Multi locus sequence typing was performed using the scheme published by Wirth et al. [8]. Allele sequences were allocated to the public database available at the MLST website (http://​mlst.​warwick.​ac.​uk/​mlst/​dbs/​Ecoli). Ancestral groups were determined by an analysis based on the concatenated sequences of the seven housekeeping genes used for MLST. The linkage model implemented in the software Structure (http://​pritch.​bsd.​uchicago.​edu/​software.​html) was used to identify groups with distinct allele frequencies. Cut-off values for the assignment of individual isolates to one of the four groups (A, B1, B2, and D) as well as to hybrid groups AxB1 and ABD were determined according to Wirth et al. [8]. Phylogenetic clustering was performed by calculating a minimum spanning tree by means of a graphical software tool implemented in BioNumerics 7.1 (Applied Maths, Belgium). MLST data were partially adopted from previous publications [37],[45]-[47].

Virulence gene typing

Virulence associated genes (VAG)s of recognized importance in the pathogenesis of ExPEC strains were investigated by multiplex and single PCRs as described previously [37],[47]. VAGs investigated in the present study were 47 and encoded for factors within the categories of adhesins (afa/draB, bmaE, csgA, fimC, focG, gafD, hrlA, iha, mat, papAH, papC, papEF, papG, sfa/foc, sfaS, tsh), iron acquisition (chuA, fyuA, ireA, iroN, irp2, iucD, iutA, sitepisomal, sitchromosomal), serum resistance/protectins (iss, kpsMTII, neuC, ompA, ompT, traT), toxins/hemolysins (astA, cnf, sat, vat, hlyA, hlyF), and invasion (ibeA, gimB, tia). Miscellaneous genes such as malX, pic, puvA, pks, and ColV plasmid operon genes cvi/cva were investigated as well.

Biostatistics

To analyse the significant relationship between two categorical variables with few nominal values, a Person’ chi-square test [54] was used. In case the assumptions of the chi-square test did not hold, a Fisher’ exact test was applied [55]. In particular, Person’ chi-square test was used to analyse the significant relationship between the o454-nlpD regions and the strain category (fecal or ExPEC), while Fisher’ exact test was employed to investigate the relationship between o454-nlpD patterns and single VAG. Cohen-Friendly association plot was used to visualize deviation from independence of rows and columns in a two-way frequency table [56]. P-values?<?0.05 indicate that the relationship between the o454-nlpD regions and the strain category or single VAG is statistically significant. The Person’ chi-square test and Fisher’ exact test were performed using the functions ‘chisq.test’ and ‘fisher.test’ in R software (http://​www.​r-project.​org).
To determine the strength of association between two categorical variables with multiple nominal values, a Cramer’ V test [57] was used. In particular, this type of statistic was applied to measure the association between the o545-nlpD patterns and one of the following variables: MLST type, Ecor group, class or pathotype, host species, clinical conditions and serotype. The two-way contingency tables fitted for Cramer’ V test (see Additional file 2, Additional file 5, Additional file 6, Additional file 7, Additional file 8 and Additional file 9) displayed as column names the o454-nlpD patterns and as row names one of the variables described above. Cramers.v values closer to 1 indicate a strong or high association between the two nominal variables, while closer to 0 indicate a weak or low association between them; uc.RC values, representing the Theil’ symmetric Uncertainty Coefficient UC, indicate how much knowing the values of the Row variables decreases uncertainty about the Column variables; p.uc.RC values indicate the probability of gaining UC(R|C) by chance; uc.CR values indicate how much knowing the values of the Column variables decreases uncertainty about the Row variables; p.uc.CR is the probability of gaining UC(C|R) by chance; uc.sym values closer to 1 indicate a lower uncertainty in predicting one of the variables from another on average. This analysis was performed using the R-package ‘polytomous’ (http://​cran.​r-project.​org/​web/​packages/​polytomous/​index.​html).
In order to interpret the relevance of VAGs variables for pattern prediction and to filter out non-informative VAGs, Random Forest (RF) algorithm [21] was used. RF was performed using the R-packages ‘Random Forest’ (http://​cran.​r-project.​org/​web/​packages/​randomForest/​index.​html) with the following settings: 1000 number of trees and 3 variables tried at each split. The result from RF and conditional variable importance was verified via multiple random forest runs starting with different seeds and sufficiently large number of tree values to ensure robustness and stability of results [58]. The commonly used importance measure from RF is the mean decrease Gini values. Gini value is directly derived from the ‘Gini index’ on the resulting RF trees. The RF classifier uses a splitting function called ‘Gini index’ to determine which attribute to split on during the tree learning phase. The Gini index measure the level of impurity of the samples assigned to a node based on a split at its parent.

Supporting data

The data sets supporting the results of this article are included within the article (and its additional files).

Authors’ contributions

CE designed the experiments. CE, ID, HD, AF, and NN performed the experiments and contributed to acquisition and interpretation of data. CE and FD structured and prepared the manuscript. FD, TS and CE performed biostatistics. LHW and TS revised the manuscript critically for important intellectual content. All authors read and approved the final manuscript.

Additional files

Acknowledgments

This study was financially supported by grant GRK1673 from the German Research Foundation. Torsten Semmler was supported by Research Network Zoonosis FBI-Zoo (grant 01KI1012A). We greatly acknowledge the receipt of human clinical and commensal E. coli strains from U. Vogel and I. Mordhorst (Julius-Maximilian-Universität Würzburg, Germany) and from K. Schnetz and G. Plum (University of Cologne, Germany).
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​4.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

Competing interests

The authors declare that they have no competing interests.
Anhänge

Electronic supplementary material

Literatur
1.
Zurück zum Zitat Kaper JB: Pathogenic Escherichia coli. Int J Med Microbiol. 2005, 295: 355-356. 10.1016/j.ijmm.2005.06.008.CrossRefPubMed Kaper JB: Pathogenic Escherichia coli. Int J Med Microbiol. 2005, 295: 355-356. 10.1016/j.ijmm.2005.06.008.CrossRefPubMed
2.
Zurück zum Zitat Brzuszkiewicz E, Gottschalk G, Ron E, Hacker J, Dobrindt U: Adaptation of Pathogenic E. Coli to Various Niches: Genome Flexibility is the key. Genome Dynamis. Volume 6. Edited by: Reuse H, Bereswill S. 2009, Karger, Basel, 110-125. Brzuszkiewicz E, Gottschalk G, Ron E, Hacker J, Dobrindt U: Adaptation of Pathogenic E. Coli to Various Niches: Genome Flexibility is the key. Genome Dynamis. Volume 6. Edited by: Reuse H, Bereswill S. 2009, Karger, Basel, 110-125.
3.
Zurück zum Zitat Russo TA, Johnson JR: Proposal for a new inclusive designation for extraintestinal pathogenic isolates of Escherichia coli: ExPEC. J Infect Dis. 2000, 181: 1753-1754. 10.1086/315418.CrossRefPubMed Russo TA, Johnson JR: Proposal for a new inclusive designation for extraintestinal pathogenic isolates of Escherichia coli: ExPEC. J Infect Dis. 2000, 181: 1753-1754. 10.1086/315418.CrossRefPubMed
4.
Zurück zum Zitat Kohler CD, Dobrindt U: What defines extraintestinal pathogenic Escherichia coli?. Int J Med Microbiol. 2011, 301: 642-647. 10.1016/j.ijmm.2011.09.006.CrossRefPubMed Kohler CD, Dobrindt U: What defines extraintestinal pathogenic Escherichia coli?. Int J Med Microbiol. 2011, 301: 642-647. 10.1016/j.ijmm.2011.09.006.CrossRefPubMed
5.
Zurück zum Zitat Hacker J, Kaper JB: Pathogenicity islands and the evolution of microbes. Annu Rev Microbiol. 2000, 54: 641-679. 10.1146/annurev.micro.54.1.641.CrossRefPubMed Hacker J, Kaper JB: Pathogenicity islands and the evolution of microbes. Annu Rev Microbiol. 2000, 54: 641-679. 10.1146/annurev.micro.54.1.641.CrossRefPubMed
6.
Zurück zum Zitat Ahmed N, Dobrindt U, Hacker J, Hasnain SE: Genomic fluidity and pathogenic bacteria: applications in diagnostics, epidemiology and intervention. Nat Rev Microbiol. 2008, 6: 387-394. 10.1038/nrmicro1889.CrossRefPubMed Ahmed N, Dobrindt U, Hacker J, Hasnain SE: Genomic fluidity and pathogenic bacteria: applications in diagnostics, epidemiology and intervention. Nat Rev Microbiol. 2008, 6: 387-394. 10.1038/nrmicro1889.CrossRefPubMed
7.
Zurück zum Zitat Tenaillon O, Skurnik D, Picard B, Denamur E: The population genetics of commensal Escherichia coli. Nat Rev Microbiol. 2010, 8: 207-217. 10.1038/nrmicro2298.CrossRefPubMed Tenaillon O, Skurnik D, Picard B, Denamur E: The population genetics of commensal Escherichia coli. Nat Rev Microbiol. 2010, 8: 207-217. 10.1038/nrmicro2298.CrossRefPubMed
8.
Zurück zum Zitat Wirth T, Falush D, Lan R, Colles F, Mensa P, Wieler LH, Karch H, Reeves PR, Maiden MC: Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol. 2006, 60: 1136-1151. 10.1111/j.1365-2958.2006.05172.x.PubMedCentralCrossRefPubMed Wirth T, Falush D, Lan R, Colles F, Mensa P, Wieler LH, Karch H, Reeves PR, Maiden MC: Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol. 2006, 60: 1136-1151. 10.1111/j.1365-2958.2006.05172.x.PubMedCentralCrossRefPubMed
9.
Zurück zum Zitat Clermont O, Christenson JK, Denamur E, Gordon DM: The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep. 2013, 5: 58-65. 10.1111/1758-2229.12019.CrossRefPubMed Clermont O, Christenson JK, Denamur E, Gordon DM: The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups. Environ Microbiol Rep. 2013, 5: 58-65. 10.1111/1758-2229.12019.CrossRefPubMed
10.
Zurück zum Zitat Jaureguy F, Landraud L, Passet V, Diancourt L, Frapy E, Guigon G, Carbonnelle E, Lortholary O, Clermont O, Denamur E, Picard B, Nassif X, Brisse S: Phylogenetic and genomic diversity of human bacteremic Escherichia coli strains. BMC Genomics. 2008, 9: 560-10.1186/1471-2164-9-560.PubMedCentralCrossRefPubMed Jaureguy F, Landraud L, Passet V, Diancourt L, Frapy E, Guigon G, Carbonnelle E, Lortholary O, Clermont O, Denamur E, Picard B, Nassif X, Brisse S: Phylogenetic and genomic diversity of human bacteremic Escherichia coli strains. BMC Genomics. 2008, 9: 560-10.1186/1471-2164-9-560.PubMedCentralCrossRefPubMed
11.
Zurück zum Zitat Picard B, Garcia JS, Gouriou S, Duriez P, Brahimi N, Bingen E, Elion J, Denamur E: The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect Immun. 1999, 67: 546-553.PubMedCentralPubMed Picard B, Garcia JS, Gouriou S, Duriez P, Brahimi N, Bingen E, Elion J, Denamur E: The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect Immun. 1999, 67: 546-553.PubMedCentralPubMed
12.
Zurück zum Zitat Touchon M, Hoede C, Tenaillon O, Barbe V, Baeriswyl S, Bidet P, Bingen E, Bonacorsi S, Bouchier C, Bouvet O, Calteau A, Chiapello H, Clermont O, Cruveiller S, Danchin A, Diard M, Dossat C, Karoui ME, Frapy E, Garry L, Ghigo JM, Gilles AM, Johnson J, Le Bouguenec C, Lescat M, Mangenot S, Martinez-Jehanne V, Matic I, Nassif X, Oztas S: Organised genome dynamics in the Escherichia coli species results in highly diverse adaptive paths. PLoS Genet. 2009, 5: e1000344-10.1371/journal.pgen.1000344.PubMedCentralCrossRefPubMed Touchon M, Hoede C, Tenaillon O, Barbe V, Baeriswyl S, Bidet P, Bingen E, Bonacorsi S, Bouchier C, Bouvet O, Calteau A, Chiapello H, Clermont O, Cruveiller S, Danchin A, Diard M, Dossat C, Karoui ME, Frapy E, Garry L, Ghigo JM, Gilles AM, Johnson J, Le Bouguenec C, Lescat M, Mangenot S, Martinez-Jehanne V, Matic I, Nassif X, Oztas S: Organised genome dynamics in the Escherichia coli species results in highly diverse adaptive paths. PLoS Genet. 2009, 5: e1000344-10.1371/journal.pgen.1000344.PubMedCentralCrossRefPubMed
13.
Zurück zum Zitat Escobar-Paramo P, Clermont O, Blanc-Potard AB, Bui H, Le Bouguenec C, Denamur E: A specific genetic background is required for acquisition and expression of virulence factors in Escherichia coli. Mol Biol Evol. 2004, 21: 1085-1094. 10.1093/molbev/msh118.CrossRefPubMed Escobar-Paramo P, Clermont O, Blanc-Potard AB, Bui H, Le Bouguenec C, Denamur E: A specific genetic background is required for acquisition and expression of virulence factors in Escherichia coli. Mol Biol Evol. 2004, 21: 1085-1094. 10.1093/molbev/msh118.CrossRefPubMed
14.
Zurück zum Zitat Brown EW, LeClerc JE, Li B, Payne WL, Cebula TA: Phylogenetic evidence for horizontal transfer of mutS alleles among naturally occurring Escherichia coli strains. J Bacteriol. 2001, 183: 1631-1644. 10.1128/JB.183.5.1631-1644.2001.PubMedCentralCrossRefPubMed Brown EW, LeClerc JE, Li B, Payne WL, Cebula TA: Phylogenetic evidence for horizontal transfer of mutS alleles among naturally occurring Escherichia coli strains. J Bacteriol. 2001, 183: 1631-1644. 10.1128/JB.183.5.1631-1644.2001.PubMedCentralCrossRefPubMed
15.
Zurück zum Zitat Culham DE, Wood JM: An Escherichia coli reference collection group B2- and uropathogen-associated polymorphism in the rpoS-mutS region of the E. coli chromosome. J Bacteriol. 2000, 182: 6272-6276. 10.1128/JB.182.21.6272-6276.2000.PubMedCentralCrossRefPubMed Culham DE, Wood JM: An Escherichia coli reference collection group B2- and uropathogen-associated polymorphism in the rpoS-mutS region of the E. coli chromosome. J Bacteriol. 2000, 182: 6272-6276. 10.1128/JB.182.21.6272-6276.2000.PubMedCentralCrossRefPubMed
16.
Zurück zum Zitat Herbelin CJ, Chirillo SC, Melnick KA, Whittam TS: Gene conservation and loss in the mutS-rpoS genomic region of pathogenic Escherichia coli. J Bacteriol. 2000, 182: 5381-5390. 10.1128/JB.182.19.5381-5390.2000.PubMedCentralCrossRefPubMed Herbelin CJ, Chirillo SC, Melnick KA, Whittam TS: Gene conservation and loss in the mutS-rpoS genomic region of pathogenic Escherichia coli. J Bacteriol. 2000, 182: 5381-5390. 10.1128/JB.182.19.5381-5390.2000.PubMedCentralCrossRefPubMed
17.
Zurück zum Zitat Hengge-Aronis R: Back to log phase: sigma S as a global regulator in the osmotic control of gene expression in Escherichia coli. Mol Microbiol. 1996, 21: 887-893. 10.1046/j.1365-2958.1996.511405.x.CrossRefPubMed Hengge-Aronis R: Back to log phase: sigma S as a global regulator in the osmotic control of gene expression in Escherichia coli. Mol Microbiol. 1996, 21: 887-893. 10.1046/j.1365-2958.1996.511405.x.CrossRefPubMed
18.
Zurück zum Zitat Hilali F, Ruimy R, Saulnier P, Barnabe C, Lebouguenec C, Tibayrenc M, Andremont A: Prevalence of virulence genes and clonality in Escherichia coli strains that cause bacteremia in cancer patients. Infect Immun. 2000, 68: 3983-3989. 10.1128/IAI.68.7.3983-3989.2000.PubMedCentralCrossRefPubMed Hilali F, Ruimy R, Saulnier P, Barnabe C, Lebouguenec C, Tibayrenc M, Andremont A: Prevalence of virulence genes and clonality in Escherichia coli strains that cause bacteremia in cancer patients. Infect Immun. 2000, 68: 3983-3989. 10.1128/IAI.68.7.3983-3989.2000.PubMedCentralCrossRefPubMed
19.
Zurück zum Zitat LeClerc JE, Li B, Payne WL, Cebula TA: Promiscuous origin of a chimeric sequence in the Escherichia coli O157:H7 genome. J Bacteriol. 1999, 181: 7614-7617.PubMedCentralPubMed LeClerc JE, Li B, Payne WL, Cebula TA: Promiscuous origin of a chimeric sequence in the Escherichia coli O157:H7 genome. J Bacteriol. 1999, 181: 7614-7617.PubMedCentralPubMed
20.
Zurück zum Zitat Denamur E, Lecointre G, Darlu P, Tenaillon O, Acquaviva C, Sayada C, Sunjevaric I, Rothstein R, Elion J, Taddei F, Radman M, Matic I: Evolutionary implications of the frequent horizontal transfer of mismatch repair genes. Cell. 2000, 103: 711-721. 10.1016/S0092-8674(00)00175-6.CrossRefPubMed Denamur E, Lecointre G, Darlu P, Tenaillon O, Acquaviva C, Sayada C, Sunjevaric I, Rothstein R, Elion J, Taddei F, Radman M, Matic I: Evolutionary implications of the frequent horizontal transfer of mismatch repair genes. Cell. 2000, 103: 711-721. 10.1016/S0092-8674(00)00175-6.CrossRefPubMed
21.
Zurück zum Zitat Touw WG, Bayjanov JR, Overmars L, Backus L, Boekhorst J, Wels M, van Hijum SA: Data mining in the life sciences with random forest: a walk in the park or lost in the jungle?. Brief Bioinform. 2013, 14: 315-326. 10.1093/bib/bbs034.PubMedCentralCrossRefPubMed Touw WG, Bayjanov JR, Overmars L, Backus L, Boekhorst J, Wels M, van Hijum SA: Data mining in the life sciences with random forest: a walk in the park or lost in the jungle?. Brief Bioinform. 2013, 14: 315-326. 10.1093/bib/bbs034.PubMedCentralCrossRefPubMed
23.
Zurück zum Zitat Kotewicz ML, Brown EW, Eugene LeClerc J, Cebula TA: Genomic variability among enteric pathogens: the case of the mutS-rpoS intergenic region. Trends Microbiol. 2003, 11: 2-6. 10.1016/S0966-842X(02)00005-7.CrossRefPubMed Kotewicz ML, Brown EW, Eugene LeClerc J, Cebula TA: Genomic variability among enteric pathogens: the case of the mutS-rpoS intergenic region. Trends Microbiol. 2003, 11: 2-6. 10.1016/S0966-842X(02)00005-7.CrossRefPubMed
24.
Zurück zum Zitat Ferenci T, Galbiati HF, Betteridge T, Phan K, Spira B: The constancy of global regulation across a species: the concentrations of ppGpp and RpoS are strain-specific in Escherichia coli. BMC Microbiol. 2011, 11: 62-10.1186/1471-2180-11-62.PubMedCentralCrossRefPubMed Ferenci T, Galbiati HF, Betteridge T, Phan K, Spira B: The constancy of global regulation across a species: the concentrations of ppGpp and RpoS are strain-specific in Escherichia coli. BMC Microbiol. 2011, 11: 62-10.1186/1471-2180-11-62.PubMedCentralCrossRefPubMed
25.
Zurück zum Zitat Johnson TJ, Wannemuehler Y, Johnson SJ, Stell AL, Doetkott C, Johnson JR, Kim KS, Spanjaard L, Nolan LK: Comparison of extraintestinal pathogenic Escherichia coli strains from human and avian sources reveals a mixed subset representing potential zoonotic pathogens. Appl Environ Microbiol. 2008, 74: 7043-7050. 10.1128/AEM.01395-08.PubMedCentralCrossRefPubMed Johnson TJ, Wannemuehler Y, Johnson SJ, Stell AL, Doetkott C, Johnson JR, Kim KS, Spanjaard L, Nolan LK: Comparison of extraintestinal pathogenic Escherichia coli strains from human and avian sources reveals a mixed subset representing potential zoonotic pathogens. Appl Environ Microbiol. 2008, 74: 7043-7050. 10.1128/AEM.01395-08.PubMedCentralCrossRefPubMed
26.
Zurück zum Zitat Ewers C, Bethe A, Semmler T, Guenther S, Wieler LH: Extended-spectrum beta-lactamase-producing and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on public health: a global perspective. Clin Microbiol Infect. 2012, 18: 646-655. 10.1111/j.1469-0691.2012.03850.x.CrossRefPubMed Ewers C, Bethe A, Semmler T, Guenther S, Wieler LH: Extended-spectrum beta-lactamase-producing and AmpC-producing Escherichia coli from livestock and companion animals, and their putative impact on public health: a global perspective. Clin Microbiol Infect. 2012, 18: 646-655. 10.1111/j.1469-0691.2012.03850.x.CrossRefPubMed
28.
Zurück zum Zitat Banerjee R, Johnston B, Lohse C, Chattopadhyay S, Tchesnokova V, Sokurenko EV, Johnson JR: The clonal distribution and diversity of extraintestinal Escherichia coli isolates vary according to patient characteristics. Antimicrob Agents Chemother. 2013, 57: 5912-5917. 10.1128/AAC.01065-13.PubMedCentralCrossRefPubMed Banerjee R, Johnston B, Lohse C, Chattopadhyay S, Tchesnokova V, Sokurenko EV, Johnson JR: The clonal distribution and diversity of extraintestinal Escherichia coli isolates vary according to patient characteristics. Antimicrob Agents Chemother. 2013, 57: 5912-5917. 10.1128/AAC.01065-13.PubMedCentralCrossRefPubMed
29.
Zurück zum Zitat Ewers C, Grobbel M, Stamm I, Kopp PA, Diehl I, Semmler T, Fruth A, Beutlich J, Guerra B, Wieler LH, Guenther S: Emergence of human pandemic O25:H4-ST131 CTX-M-15 extended-spectrum beta-lactamase-producing Escherichia coli among companion animals. J Antimicrob Chemother. 2010, 65: 651-660. 10.1093/jac/dkq004.CrossRefPubMed Ewers C, Grobbel M, Stamm I, Kopp PA, Diehl I, Semmler T, Fruth A, Beutlich J, Guerra B, Wieler LH, Guenther S: Emergence of human pandemic O25:H4-ST131 CTX-M-15 extended-spectrum beta-lactamase-producing Escherichia coli among companion animals. J Antimicrob Chemother. 2010, 65: 651-660. 10.1093/jac/dkq004.CrossRefPubMed
30.
Zurück zum Zitat Zdziarski J, Svanborg C, Wullt B, Hacker J, Dobrindt U: Molecular basis of commensalism in the urinary tract: low virulence or virulence attenuation?. Infect Immun. 2008, 76: 695-703. 10.1128/IAI.01215-07.PubMedCentralCrossRefPubMed Zdziarski J, Svanborg C, Wullt B, Hacker J, Dobrindt U: Molecular basis of commensalism in the urinary tract: low virulence or virulence attenuation?. Infect Immun. 2008, 76: 695-703. 10.1128/IAI.01215-07.PubMedCentralCrossRefPubMed
31.
Zurück zum Zitat Buchmeier N, Bossie S, Chen CY, Fang FC, Guiney DG, Libby SJ: SlyA, a transcriptional regulator of Salmonella typhimurium, is required for resistance to oxidative stress and is expressed in the intracellular environment of macrophages. Infect Immun. 1997, 65: 3725-3730.PubMedCentralPubMed Buchmeier N, Bossie S, Chen CY, Fang FC, Guiney DG, Libby SJ: SlyA, a transcriptional regulator of Salmonella typhimurium, is required for resistance to oxidative stress and is expressed in the intracellular environment of macrophages. Infect Immun. 1997, 65: 3725-3730.PubMedCentralPubMed
32.
Zurück zum Zitat Bellais S, Leotard S, Poirel L, Naas T, Nordmann P: Molecular characterization of a carbapenem-hydrolyzing beta-lactamase from Chryseobacterium (Flavobacterium) indologenes. FEMS Microbiol Lett. 1999, 171: 127-132.PubMed Bellais S, Leotard S, Poirel L, Naas T, Nordmann P: Molecular characterization of a carbapenem-hydrolyzing beta-lactamase from Chryseobacterium (Flavobacterium) indologenes. FEMS Microbiol Lett. 1999, 171: 127-132.PubMed
33.
Zurück zum Zitat Girardeau JP, Lalioui L, Said AM, De Champs C, Le Bouguenec C: Extended virulence genotype of pathogenic Escherichia coli isolates carrying the afa-8 operon: evidence of similarities between isolates from humans and animals with extraintestinal infections. J Clin Microbiol. 2003, 41: 218-226. 10.1128/JCM.41.1.218-226.2003.PubMedCentralCrossRefPubMed Girardeau JP, Lalioui L, Said AM, De Champs C, Le Bouguenec C: Extended virulence genotype of pathogenic Escherichia coli isolates carrying the afa-8 operon: evidence of similarities between isolates from humans and animals with extraintestinal infections. J Clin Microbiol. 2003, 41: 218-226. 10.1128/JCM.41.1.218-226.2003.PubMedCentralCrossRefPubMed
34.
Zurück zum Zitat Clermont O, Bonacorsi S, Bingen E: Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol. 2000, 66: 4555-4558. 10.1128/AEM.66.10.4555-4558.2000.PubMedCentralCrossRefPubMed Clermont O, Bonacorsi S, Bingen E: Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol. 2000, 66: 4555-4558. 10.1128/AEM.66.10.4555-4558.2000.PubMedCentralCrossRefPubMed
35.
Zurück zum Zitat Spurbeck RR, Dinh PC, Walk ST, Stapleton AE, Hooton TM, Nolan LK, Kim KS, Johnson JR, Mobley HL:Escherichia coli isolates that carry vat, fyuA, chuA, and yfcV efficiently colonize the urinary tract. Infect Immun. 2012, 80: 4115-4122. 10.1128/IAI.00752-12.PubMedCentralCrossRefPubMed Spurbeck RR, Dinh PC, Walk ST, Stapleton AE, Hooton TM, Nolan LK, Kim KS, Johnson JR, Mobley HL:Escherichia coli isolates that carry vat, fyuA, chuA, and yfcV efficiently colonize the urinary tract. Infect Immun. 2012, 80: 4115-4122. 10.1128/IAI.00752-12.PubMedCentralCrossRefPubMed
36.
Zurück zum Zitat Reidl J, Boos W: The malX malY operon of Escherichia coli encodes a novel enzyme II of the phosphotransferase system recognizing glucose and maltose and an enzyme abolishing the endogenous induction of the maltose system. J Bacteriol. 1991, 173: 4862-4876.PubMedCentralPubMed Reidl J, Boos W: The malX malY operon of Escherichia coli encodes a novel enzyme II of the phosphotransferase system recognizing glucose and maltose and an enzyme abolishing the endogenous induction of the maltose system. J Bacteriol. 1991, 173: 4862-4876.PubMedCentralPubMed
37.
Zurück zum Zitat Ewers C, Li G, Wilking H, Kiessling S, Alt K, Antao EM, Laturnus C, Diehl I, Glodde S, Homeier T, Boehnke U, Steinrueck H, Philipp HC, Wieler LH: Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they?. Int J Med Microbiol. 2007, 297: 163-176. 10.1016/j.ijmm.2007.01.003.CrossRefPubMed Ewers C, Li G, Wilking H, Kiessling S, Alt K, Antao EM, Laturnus C, Diehl I, Glodde S, Homeier T, Boehnke U, Steinrueck H, Philipp HC, Wieler LH: Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: how closely related are they?. Int J Med Microbiol. 2007, 297: 163-176. 10.1016/j.ijmm.2007.01.003.CrossRefPubMed
38.
Zurück zum Zitat Ostblom A, Adlerberth I, Wold AE, Nowrouzian FL: Pathogenicity island markers, virulence determinants malX and usp, and the capacity of Escherichia coli to persist in infants’ commensal microbiotas. Appl Environ Microbiol. 2011, 77: 2303-2308. 10.1128/AEM.02405-10.PubMedCentralCrossRefPubMed Ostblom A, Adlerberth I, Wold AE, Nowrouzian FL: Pathogenicity island markers, virulence determinants malX and usp, and the capacity of Escherichia coli to persist in infants’ commensal microbiotas. Appl Environ Microbiol. 2011, 77: 2303-2308. 10.1128/AEM.02405-10.PubMedCentralCrossRefPubMed
39.
Zurück zum Zitat Johnson JR, Stell AL: Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis. 2000, 181: 261-272. 10.1086/315217.CrossRefPubMed Johnson JR, Stell AL: Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis. 2000, 181: 261-272. 10.1086/315217.CrossRefPubMed
40.
Zurück zum Zitat Mills DM, Bajaj V, Lee CA: A 40 kb chromosomal fragment encoding Salmonella typhimurium invasion genes is absent from the corresponding region of the Escherichia coli K-12 chromosome. Mol Microbiol. 1995, 15: 749-759. 10.1111/j.1365-2958.1995.tb02382.x.CrossRefPubMed Mills DM, Bajaj V, Lee CA: A 40 kb chromosomal fragment encoding Salmonella typhimurium invasion genes is absent from the corresponding region of the Escherichia coli K-12 chromosome. Mol Microbiol. 1995, 15: 749-759. 10.1111/j.1365-2958.1995.tb02382.x.CrossRefPubMed
41.
Zurück zum Zitat Martin K, Morlin G, Smith A, Nordyke A, Eisenstark A, Golomb M: The tryptophanase gene cluster of Haemophilus influenzae type b: evidence for horizontal gene transfer. J Bacteriol. 1998, 180: 107-118.PubMedCentralPubMed Martin K, Morlin G, Smith A, Nordyke A, Eisenstark A, Golomb M: The tryptophanase gene cluster of Haemophilus influenzae type b: evidence for horizontal gene transfer. J Bacteriol. 1998, 180: 107-118.PubMedCentralPubMed
42.
Zurück zum Zitat Denamur E, Bonacorsi S, Giraud A, Duriez P, Hilali F, Amorin C, Bingen E, Andremont A, Picard B, Taddei F, Matic I: High frequency of mutator strains among human uropathogenic Escherichia coli isolates. J Bacteriol. 2002, 184: 605-609. 10.1128/JB.184.2.605-609.2002.PubMedCentralCrossRefPubMed Denamur E, Bonacorsi S, Giraud A, Duriez P, Hilali F, Amorin C, Bingen E, Andremont A, Picard B, Taddei F, Matic I: High frequency of mutator strains among human uropathogenic Escherichia coli isolates. J Bacteriol. 2002, 184: 605-609. 10.1128/JB.184.2.605-609.2002.PubMedCentralCrossRefPubMed
43.
Zurück zum Zitat Ferenci T: What is driving the acquisition of mutS and rpoS polymorphisms in Escherichia coli?. Trends Microbiol. 2003, 11: 457-461. 10.1016/j.tim.2003.08.003.CrossRefPubMed Ferenci T: What is driving the acquisition of mutS and rpoS polymorphisms in Escherichia coli?. Trends Microbiol. 2003, 11: 457-461. 10.1016/j.tim.2003.08.003.CrossRefPubMed
44.
Zurück zum Zitat Cooper LA, Simmons LA, Mobley HL: Involvement of mismatch repair in the reciprocal control of motility and adherence of uropathogenic Escherichia coli. Infect Immun. 2012, 80: 1969-1979. 10.1128/IAI.00043-12.PubMedCentralCrossRefPubMed Cooper LA, Simmons LA, Mobley HL: Involvement of mismatch repair in the reciprocal control of motility and adherence of uropathogenic Escherichia coli. Infect Immun. 2012, 80: 1969-1979. 10.1128/IAI.00043-12.PubMedCentralCrossRefPubMed
45.
Zurück zum Zitat Mordhorst IL, Claus H, Ewers C, Lappann M, Schoen C, Elias J, Batzilla J, Dobrindt U, Wieler LH, Bergfeld AK, Muhlenhoff M, Vogel U: O-acetyltransferase gene neuO is segregated according to phylogenetic background and contributes to environmental desiccation resistance in Escherichia coli K1. Environ Microbiol. 2009, 11: 3154-3165. 10.1111/j.1462-2920.2009.02019.x.CrossRefPubMed Mordhorst IL, Claus H, Ewers C, Lappann M, Schoen C, Elias J, Batzilla J, Dobrindt U, Wieler LH, Bergfeld AK, Muhlenhoff M, Vogel U: O-acetyltransferase gene neuO is segregated according to phylogenetic background and contributes to environmental desiccation resistance in Escherichia coli K1. Environ Microbiol. 2009, 11: 3154-3165. 10.1111/j.1462-2920.2009.02019.x.CrossRefPubMed
46.
Zurück zum Zitat Sankar TS, Neelakanta G, Sangal V, Plum G, Achtman M, Schnetz K: Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli. PLoS Genet. 2009, 5: e1000405-10.1371/journal.pgen.1000405.PubMedCentralCrossRefPubMed Sankar TS, Neelakanta G, Sangal V, Plum G, Achtman M, Schnetz K: Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli. PLoS Genet. 2009, 5: e1000405-10.1371/journal.pgen.1000405.PubMedCentralCrossRefPubMed
47.
Zurück zum Zitat Ewers C, Antao EM, Diehl I, Philipp HC, Wieler LH: Intestine and environment of the chicken as reservoirs for extraintestinal pathogenic Escherichia coli strains with zoonotic potential. Appl Environ Microbiol. 2009, 75: 184-192. 10.1128/AEM.01324-08.PubMedCentralCrossRefPubMed Ewers C, Antao EM, Diehl I, Philipp HC, Wieler LH: Intestine and environment of the chicken as reservoirs for extraintestinal pathogenic Escherichia coli strains with zoonotic potential. Appl Environ Microbiol. 2009, 75: 184-192. 10.1128/AEM.01324-08.PubMedCentralCrossRefPubMed
48.
Zurück zum Zitat Herzer PJ, Inouye S, Inouye M, Whittam TS:Phylogenetic distribution of branched RNA-linked multicopy single-stranded DNA among natural isolates ofEscherichia coli. J Bacteriol. 1990, 172: 6175-6181.PubMedCentralPubMed Herzer PJ, Inouye S, Inouye M, Whittam TS:Phylogenetic distribution of branched RNA-linked multicopy single-stranded DNA among natural isolates ofEscherichia coli. J Bacteriol. 1990, 172: 6175-6181.PubMedCentralPubMed
49.
Zurück zum Zitat Levine MM:Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J Infect Dis. 1987, 155: 377-389. 10.1093/infdis/155.3.377.CrossRefPubMed Levine MM:Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J Infect Dis. 1987, 155: 377-389. 10.1093/infdis/155.3.377.CrossRefPubMed
50.
Zurück zum Zitat Strockbine NA, Marques LR, Newland JW, Smith HW, Holmes RK, O’Brien AD: Two toxin-converting phages from Escherichia coli O157:H7 strain 933 encode antigenically distinct toxins with similar biologic activities. Infect Immun. 1986, 53: 135-140.PubMedCentralPubMed Strockbine NA, Marques LR, Newland JW, Smith HW, Holmes RK, O’Brien AD: Two toxin-converting phages from Escherichia coli O157:H7 strain 933 encode antigenically distinct toxins with similar biologic activities. Infect Immun. 1986, 53: 135-140.PubMedCentralPubMed
51.
Zurück zum Zitat Current Protocols in Molecular Biology. New York: Wiley and Sons, Inc,; 1987-2000. Current Protocols in Molecular Biology. New York: Wiley and Sons, Inc,; 1987-2000.
52.
Zurück zum Zitat Stamatakis A: RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014, 30: 1312-1313. 10.1093/bioinformatics/btu033.PubMedCentralCrossRefPubMed Stamatakis A: RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014, 30: 1312-1313. 10.1093/bioinformatics/btu033.PubMedCentralCrossRefPubMed
53.
Zurück zum Zitat Huson DH, Scornavacca C: Dendroscope 3: an interactive tool for rooted phylogenetic trees and networks. Syst Biol. 2012, 61: 1061-1067. 10.1093/sysbio/sys062.CrossRefPubMed Huson DH, Scornavacca C: Dendroscope 3: an interactive tool for rooted phylogenetic trees and networks. Syst Biol. 2012, 61: 1061-1067. 10.1093/sysbio/sys062.CrossRefPubMed
54.
Zurück zum Zitat Plackett RL: Karl Pearson and the Chi-Squared Test. Int Stat Rev. 1983, 51: 59-72. 10.2307/1402731.CrossRef Plackett RL: Karl Pearson and the Chi-Squared Test. Int Stat Rev. 1983, 51: 59-72. 10.2307/1402731.CrossRef
55.
Zurück zum Zitat Campbell I: Chi-squared and Fisher-Irwin tests of two-by-two tables with small sample recommendations. Stat Med. 2007, 26: 3661-3675. 10.1002/sim.2832.CrossRefPubMed Campbell I: Chi-squared and Fisher-Irwin tests of two-by-two tables with small sample recommendations. Stat Med. 2007, 26: 3661-3675. 10.1002/sim.2832.CrossRefPubMed
56.
Zurück zum Zitat Meyer D, Zeileis A, Hornik K: Visualizing Indepence Using Extended Association Plots. 3rd International Workshop on Distributed Statistical Computing; March 20-22, 2003; Vienna, Austria. Edited by: Hornik K, Leisch F, Zeileis A. 2003. Meyer D, Zeileis A, Hornik K: Visualizing Indepence Using Extended Association Plots. 3rd International Workshop on Distributed Statistical Computing; March 20-22, 2003; Vienna, Austria. Edited by: Hornik K, Leisch F, Zeileis A. 2003.
57.
Zurück zum Zitat Sheskin DJ: Parametric and Nonparametric Statistical Procedures.5th edition. Boca Raton, Florida, U.S.A: CRC Press, Inc; 2011. Sheskin DJ: Parametric and Nonparametric Statistical Procedures.5th edition. Boca Raton, Florida, U.S.A: CRC Press, Inc; 2011.
58.
Zurück zum Zitat Strobl C, Boulesteix AL, Kneib T, Augustin T, Zeileis A: Conditional variable importance for random forests. BMC Bioinformatics. 2008, 9: 307-10.1186/1471-2105-9-307.PubMedCentralCrossRefPubMed Strobl C, Boulesteix AL, Kneib T, Augustin T, Zeileis A: Conditional variable importance for random forests. BMC Bioinformatics. 2008, 9: 307-10.1186/1471-2105-9-307.PubMedCentralCrossRefPubMed
Metadaten
Titel
Correlation between the genomic o454-nlpD region polymorphisms, virulence gene equipment and phylogenetic group of extraintestinal Escherichia coli (ExPEC) enables pathotyping irrespective of host, disease and source of isolation
verfasst von
Christa Ewers
Flavia Dematheis
Haritha Devi Singamaneni
Nishant Nandanwar
Angelika Fruth
Ines Diehl
Torsten Semmler
Lothar H Wieler
Publikationsdatum
01.09.2014
Verlag
BioMed Central
Erschienen in
Gut Pathogens / Ausgabe 1/2014
Elektronische ISSN: 1757-4749
DOI
https://doi.org/10.1186/s13099-014-0037-x

Weitere Artikel der Ausgabe 1/2014

Gut Pathogens 1/2014 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.