Clinical characteristics of patients with 2019 coronavirus disease in a non-Wuhan area of Hubei Province, China: a retrospective study

We retrospectively analyzed patients diagnosed with COVID-19 hospitalized from January 16, 2020 to February 10, 2020. Patients suspected of having COVID-19 were admitted and quarantined, and throat swab samples were collected and tested for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) by quantitative polymerase chain reaction assay (qPCR). Patients diagnosed with COVID-19 were enrolled in this study and asked to sign a written informed consent form during hospitalization. This study was approved by the ethics committee of Jingzhou Central Hospital. The patients have not been reported in any other submission by anyone else. The final date of follow-up was February 10, 2020.

Clinical data [age, previous chronic disease, epidemiological history, symptoms, vital signs, computed tomography (CT) images, virus load, laboratory tests, complications, and treatment process] of the 91 patients involved in this study were collected. Acute respiratory distress syndrome was defined according to the Berlin definition [6]. Liver injury was judged by alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. Acute kidney injury was identified according to elevated creatinine (Cr) and uric acid levels. The presence of cardiac injury was confirmed if the serum levels of cardiac biomarkers [cardiac troponin i (CTnI), creatine kinase (CK), creatine kinase isoenzyme (CK-MB)] were elevated. The diagnosis of COVID-19 was made by the comprehensive evaluation of epidemiological exposure, symptoms, laboratory tests, chest CT scan, and qPCR analysis.

RNA for further tests was extracted from the throat swab samples, which were collected in virus preservation solution. Next, 5 μl of RNA was added in a PCR reaction tube with 12 μl of nucleic acid amplification reaction solution, 4 μl of enzyme mixture, and 12 μl of ORF1ab/N reaction solution (BioGerm, Shanghai, China). The cycle parameters for PCR amplification assay were set as follows: reverse transcription at 50 °C for 10 min; predenaturation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 10 s; and annealing, extending, and collection of fluorescence at 55 °C for 40 s. The open reading frame 1ab (ORF1ab) and nucleocapsid protein (N) gene regions of SARS-CoV-2 were simultaneously tested. Primers for ORF1ab were as follows: forward primer CCCTGTGGGTTTTACACTTAA, reverse primer ACGATTGTGCATCAGCTGA, and the probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1–3′. Primers for N were as follows: forward primer GGGGAACTTCTCCTGCTAGAAT, reverse primer CAGACATTTTGCTCTCAAGCTG, and the probe 5′-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3′. A cycle threshold value (Ct value) of less than 37 suggested a positive result, while a Ct value of higher than 40 indicated a negative result. And a Ct value between 37 and 40 required retesting.

We collected clinical information of 91 patients diagnosed with COVID-19 in Jingzhou Central Hospital. Of these patients, 30 (33.0%) were assessed as being severely ill (Table 1). The median age of our study population was 46.0 years, with severe patients being generally older with a median age of 50.5 years relative to that of 42.0 years among the mild cases (p = 0.049). Slightly more than half (53.8%) of the patients were male and there were no significant differences in the sex ratio between the severe and mild cases (p = 0.230). Twenty-one patients (23.1%) had one or more coexisting medical conditions, including hypertension, diabetes, chronic obstructive pulmonary disease, kidney disease, and malignancies. Coexisting medical conditions were more prominent in the severe disease group (40% had chronic disease vs. 14.8% in mild disease group; p = 0.009). The median duration from onset of symptoms to hospital admission was 4 days. All patients were confirmed as qPCR-positive eventually, while only 73.6% of patients were qPCR-positive when they first received the test. The qPCR-positive rate at different times was not different in the severe and mild disease groups (p = 0.884). In addition, the vital signs (pulse rate, temperature, and mean arterial pressure) between the two groups showed no significant differences. Compared to the severe disease group (6.7%), the mild disease group (19.7%) had a higher proportion of discharged cases. Of the two deceased patients who were critically ill, one had lung cancer and the other had hypertension. Both suffered respiratory and acute renal failure on the day of admission. The mortality rate was 2.2%. Taken together, our results supported that older patients with chronic disease were more likely to become critically ill and negative qPCR results could not confidently exclude infection with the virus at symptom onset.

At data cut off, considering 91 evaluable patients, the most common symptoms were fever (n = 75; 82.4%) and cough (n = 59; 64.8%), followed by fatigue (n = 35; 38.5%), chest distress (n = 21; 23.1%), chill (n = 21; 23.1%), pharyngalgia (n = 19; 20.9%), and myalgia (n = 15; 16.5%) (Fig. 1). Additionally, some patients reported gastrointestinal problems, including diarrhea (n = 14; 15.4%) and nausea (n = 19; 12.1%) (Fig. 1). Symptoms of polypnea and the disturbance of consciousness, as signs of greater disease severity, were reported by 12.1% (n = 19) and 3.3% (n = 3) of patients, respectively (Fig. 1). Anorexia, arthrodynia, dizziness, and abdominal pain were also found (Fig. 1).

To explore the characteristics of laboratory tests from our patients with COVID-19, the baseline hematological and biochemical indices of the 91 patients were analyzed (Table 2). On admission, 51.6% of patients had lymphopenia, which was more prominent in mild cases (Table 2). Elevated CK levels were observed in 15.4% of patients, while elevated ALT and AST levels were recorded in 11.0 and 19.8% of patients. Severe cases had more prominently elevated Cr (16.7% vs. 0%; p < 0.001) and CK (26.7% vs. 9.8%; p = 0.018) levels. The prothrombin time was prolonged in 20.9% of patients. Levels of interleukin-6 and C-reactive protein, two biomarkers of inflammation, were increased in 19.8 and 40.7% of patients (Table 2). These laboratory findings indicated that COVID-19 resulted in liver, kidney, and cardiovascular injury.

Interestingly, separate from damage to the respiratory system, COVID-19 patients showed signs of multiple organ injury on admission, including 18 cases (19.8%) of liver injury; 14 cases (15.4%) of cardiovascular damage with abnormal increases in troponin, CK, or CK-MB levels; five cases (5.5%) of acute renal injury; and 19 cases (20.9%) of poor coagulation function (Table 3). Together, 28 patients (30.8%) suffered non-respiratory system injury, with an especially higher rate (50% vs. 21.3%; p = 0.003) in the severe disease group (Table 3). Further analysis revealed that severe patients tended to suffer damage to the cardiovascular system (26.7% vs. 9.8%; p = 0.04) and renal function (16.7% vs. 0%; p = 0.003) (Table 3). Angiotensin-converting enzyme II (ACE2) was proved to be the cell receptor of COVID-19 [7], the same as SARS infection [8]. We performed bioinformatics analysis on the expression of ACE2 receptors in different normal tissues sourced from the cancer microarray database Oncomine, as shown in Additional file 1. The data indicated that the highest level of ACE2 was present in the ileum, followed by in the testis, diaphragm, heart, kidneys, seminal vesicle, colon, and respiratory tract. Hence, we speculated that the high ACE2 expression levels in the ileum, heart, kidneys, and colon caused the virus to pursue direct infection in these specific organs, which might explain the high rate of multiple organ damage caused by COVID-19.

All of the patients in our study presented exudative changes, with different degrees of patchy consolidation or ground-glass opacities, on CT images (Fig. 2a–c). The processing of CT images (Fig. 2a) revealed that the chest presented only scattered dotted shadows on the first day of admission, focal exudation on the fourth day, and diffuse ground-glass shadows on the 13th day. A good example of a case gradually improved with effective therapy is presented in Fig. 2b. In addition, there were patients whose condition progressed rapidly within 1 week (Fig. 2c). On the first day of admission, the chest CT scan was basically normal. However, on the seventh day, the chest CT scan showed patchy high-density shadow and diffused ground glass density shadow in both lungs. Soon after, this patient died of multiple organ failure (Fig. 2c). These results suggest that CT imaging is an important method in differential diagnosis and evaluating the severity of COVID-19.

Most patients received antiviral therapy (n = 81; 89.0%), glucocorticoid therapy (n = 79; 86.8%), and antibacterial therapy (n = 90; 98.9%), which was given in all severe cases (n = 30; 100.0%) (Table 4). Oseltamivir, lopinavir/ritonavir, and umifenovir were common antiviral drugs used in our treatment protocols. In our study, 26.4% of patients were treated with oseltamivir antiviral therapy (Table 4). Lopinavir/ritonavir was more likely to be used in the mild disease group (53.3% vs. 78.7%; p = 0.013), while umifenovir was more likely to be used in the severe disease group (73.3% vs. 50.8%; p = 0.033) (Table 4). Supportive treatment measures, including oxygen therapy (n = 29; 31.9%), mechanical ventilation (n = 5; 5.5%), the infusion of immunoglobulin (n = 35; 38.5%), and continuous renal replacement therapy (n = 3; 3.3%), were more likely to be applied to patients in the severe disease group (p < 0.05) (Table 4).