Zum Inhalt

CX3CL1-CX3CR1 signaling orchestrates malignant progression of prostate cancer through luminal progenitor-macrophage crosstalk

  • Open Access
  • 01.04.2026
  • Research
Erschienen in:

Abstract

Purpose

Progression to castration-resistant prostate cancer (CRPC) is shaped by dynamic interactions within the tumor microenvironment (TME). However, the specific cellular crosstalk driving therapeutic resistance and metastasis remains incompletely defined. This study aims to identify key signaling axes between therapy-resistant luminal progenitor (luminal-2) cells and immune components in the TME, particularly tumor-associated macrophages (TAMs), and to determine how these interactions promote immunosuppression and cancer stem-like cell expansion during disease progression.

Methods

We employed an integrative phenomics approach combining single-cell transcriptomics with genetically engineered mouse models (GEMMs) and orthotopic allograft models of prostate cancer. Spatiotemporal changes in cell populations were profiled across disease stages. The functional contribution of the CX3CL1-CX3CR1 axis was evaluated through genetic ablation of Cx3cr1 in host mice, followed by assessment of TAM infiltration, luminal progenitor cell dynamics, tumor growth, and immunosuppression signature score.

Results

Single-cell profiling revealed a distinct luminal-2 progenitor population with high CX3CL1 expression that recruits CX3CR1+ TAMs and supports a pro-tumoral program. These CX3CL1hi luminal-2 cells and CX3CR1hi TAMs expand in a stage-specific manner and co-evolve during CRPC progression, forming an immunosuppressive and pro-metastatic niche. Host Cx3cr1 deletion disrupted this signaling axis, leading to reduced TAM infiltration, suppression of luminal progenitor cells expansion, and significant inhibition of tumor growth and progression.

Conclusion

The CX3CL1–CX3CR1 axis functions as a critical mediator of reciprocal signaling between luminal-2 progenitors and TAMs that promotes immune evasion, stemness maintenance, and therapeutic resistance in prostate cancer. Disrupting this pathway impairs the pro-tumoral niche and may represent a promising therapeutic approach for advanced prostate cancer.

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1007/s13402-026-01179-5.
Yu Jiang and Yuchen Guo contributed equally to this work.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

1 Introduction

Prostate cancer (PCa) represents the most frequently diagnosed malignancy in men worldwide and poses an escalating public health burden [1]. Global projections estimate that annual incidence will nearly double from 1.4 million cases in 2020 to 2.9 million by 2040, largely due to aging populations and changing lifestyle factors [2]. Although androgen deprivation therapy (ADT) remains the cornerstone treatment for hormone-sensitive prostate cancer (HSPC), most patients ultimately progress to castration-resistant prostate cancer (CRPC) [3, 4], an advanced disease state characterized by aggressive growth, metastatic spread, and broad therapeutic resistance.
A hallmark of CRPC progression is the dynamic interplay between therapy-resistant cancer stem cells (CSCs) and an increasingly immunosuppressive tumor microenvironment (TME). Within the prostate, luminal progenitor cells, also known as luminal 2 cells, have been established as bona fide CSCs, exhibiting capabilities for self-renewal, lineage plasticity, and androgen receptor (AR)-independent survival [57]. These cells selectively expand under ADT pressure and are strongly correlated with disease recurrence, metastasis, and poor clinical outcomes [8, 9]. In parallel, CRPC tumors exhibit marked infiltration by tumor-associated macrophages (TAMs), which may constitute up to 50% of the tumor mass and exert profound immunomodulatory effects that favor tumor immune evasion and progression [10, 11]. Despite their abundance and functional importance, therapeutic strategies aimed at broadly targeting TAMs, such as CSF-1R inhibition, have shown limited clinical benefits [1215], highlighting a critical need to better understand the mechanisms that sustain their pro-tumoral functions within the TME.
A fundamental gap remains in understanding how luminal-2 progenitors and TAMs interact to establish and maintain a permissive niche that supports therapeutic resistance and disease progression. Emerging evidence has implicated the CX3CL1-CX3CR1 chemokine axis as a potential mediator of this cellular crosstalk. This signaling pair is upregulated in PCa metastases and has been shown to promote metastatic dissemination via Src/FAK activation in CX3CR1+ tumor cells [1619]. While several studies have focused on the role of CX3CR1 in mediating cancer cell stemness and chemoresistance [18], its function in shaping immune cell behavior within the PCa TME remains largely unexplored [20]. Notably, CX3CL1 is expressed by various cell types, including epithelial, neuronal, and immune cells, whereas its receptor CX3CR1 is predominantly expressed on immune populations, including monocytes, cytotoxic T cells, and macrophages [2125], suggesting that this axis may serve as a key regulator of immune-epithelial interactions in PCa.
In this study, we applied an integrative phenomics strategy to decipher the bidirectional communication between CX3CL1-secreting Luminal-2 progenitors and CX3CR1⁺ TAMs during prostate cancer progression. We hypothesized that this axis forms a self-reinforcing signaling loop that sustains Luminal-2 progenitors’ maintenance, drives TAM-mediated immunosuppression, and accelerates the transition to lethal CRPC. By combining high-resolution single-cell transcriptomic analyses with functional validation in genetically engineered and orthotopic preclinical models, we sought to delineate the cellular and molecular dynamics of this interaction and assess its therapeutic relevance.

2 Materials and methods

2.1 Animals

All animal experiments were conducted in accordance with the ethical guidelines approved by the Institutional Animal Care and Use Committee (IACUC) of Tsinghua University (Approval No. 13-LZH1) and complied with relevant national and international guidelines governing the use of laboratory animals. Male C57BL/6J mice (8–12 weeks old) were housed under specific pathogen-free (SPF) conditions in a controlled environment (21 ± 1 °C, 50 ± 10% humidity, 12 h light/12 h dark cycle) with free access to standard rodent diet and autoclaved water. Animal group assignments and sample sizes for each experiment are detailed in the corresponding figure legends. Adult (8–12 weeks) male and female CX3CR-1GFP mutant mice (Stock# 005582, Jackson Laboratories) were used for this study. PbsnCre; Ptenf/f mice were generously provided by Professor Geng Liu from Nanjing University.

2.2 Cells

RM-1: The castration-resistant prostate cancer (CRPC) cell line RM-1 (Cat# CL-0198, Pricella Life Science & Technology, Wuhan, China) was cultured in Dulbecco’s Modified Eagle Medium (Cat# 11965092, Gibco, New York, USA) supplemented with 10% fetal bovine serum (FBS, Cat# 10091148, Gibco, Auckland, New Zealand) and 1% penicillin/streptomycin (Cat# 15140122, Gibco, New York, USA). Cells were maintained at 80–90% confluence and routinely passaged using 0.25% trypsin (Cat# 15090046, Gibco, New York, USA).
Raw264.7: Mouse monocyte-macrophage leukemia cell line (Cat# CL-0190, Pricella Life Science & Technology, Wuhan, China) was cultured in RPMI 1640 (Cat# 11875093, Gibco, New York, USA) supplemented with 10% fetal bovine serum (FBS, Cat# 10091148, Gibco, Auckland, New Zealand) and 1% penicillin/streptomycin (Cat# 15140122, Gibco, New York, USA). Cells were maintained at 80–90% confluence and routinely passaged using 1–3 mL of complete culture medium to dislodge adherent cells from the flask walls.
Bone Marrow-Derived Macrophages (BMDM)
BMDMs were isolated from 8- to 12-week-old male C57BL/6J wild-type (WT) or Cx3cr1−/− mice. Briefly, bone marrow cells were flushed from femurs with cold PBS, followed by erythrocyte lysis (Cat# 00-4333-57, Gibco, California, USA), and filtration through a 70 μm cell strainer (Cat# BS-70-CS, Biosharp, Anhui, China). The cells were then differentiated into BMDMs by culturing for 7 days in RPMI 1640 medium supplemented with 10% FBS, 1% penicillin/streptomycin, and 20 ng/mL recombinant M-CSF (Cat# 315-02-1MG, PeproTech, New Jersey, USA) at 37 °C under 5% CO₂.
For stimulation experiments, BMDMs were treated with 100 ng/mL recombinant Fractalkine/CX3CL1 (Cat# HY-P72686, MCE, USA) for 2 h in RPMI 1640 containing 10% FBS, 1% penicillin/streptomycin, and 20 ng/mL M-CSF. Subsequently, cells were exposed to either 100 ng/mL LPS (Cat# 437627, Sigma–Aldrich, USA) or 20 µg/mL IL-4 (Cat# ab9729, Abcam, USA), and RNA was extracted 24 h later.

2.3 siRNA transfection

RM-1 cells were transfected with siRNA using Lipofectamine 2000 (Cat# CA92008, Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Briefly, cells were seeded in 12-well plates at a density of 2 × 10⁵ cells per well and cultured overnight to reach 60–70% confluence. For each well, 97.5 µL of RPMI 1640 medium was mixed with 2.5 µL of Lipofectamine 2000 reagent. Simultaneously, 97.5 µL of RPMI 1640 was mixed with 2.5 µL of Cx3cl1 siRNA (Cat# HY-RS16603, MCE, USA) or negative control siRNA. The Lipofectamine 2000 mixture and siRNA mixture were then combined and incubated at room temperature for 15–20 min to allow complex formation. The transfection complexes (200 µL total volume) were added dropwise to cells in fresh culture medium. The cells were incubated at 37 °C in a humidified atmosphere with 5% CO₂. The transfection efficiency was assessed at 12- and 24-hours post-transfection by RT–qPCR analysis of target gene expression, and cells were then harvested for subsequent experiments.

2.4 Orthotopic and ectopic RM-1 tumor models

For in vivo studies, RM-1 cells were harvested, washed, and resuspended in phosphate-buffered saline (PBS) at a density of 2 × 10⁶ cells/mL. In the ectopic tumor model, 100 µL of cell suspension (containing 2 × 10⁵ cells) was injected subcutaneously into the left flank of anesthetized C57BL/6J mice. For the orthotopic model, a midline laparotomy was performed to expose the ventral prostate, and 20 µL of cell suspension (1 × 10⁵ cells) was injected into the prostate capsule using a 30-gauge needle. The abdominal wall was sutured with 5 − 0 silk, and mice were monitored until recovery. All animals were euthanized three weeks post-injection; tumors were excised, and volumes were calculated as (length × width²) / 2.

2.5 In vitro migration assay (Transwell chamber assay)

BMDM migration
To assess the role of CX3CR1 in macrophage migration, a transwell chamber assay (Cat# GLS3422, Corning, New York, USA) was performed. A total of 2 × 10⁵ WT or Cx3cr1−/− BMDMs in 200 µL serum-free RPMI 1640 (Cat# 11875093, Gibco, New York, USA) were seeded into the upper chamber, while the lower chamber contained 600 µL of conditioned medium from RM-1 cells. After 2 h of incubation at 37 °C, migrated cells in the lower chamber were collected and quantified using a Z2 Coulter Counter (Cat# C19196, Beckman Coulter, California, USA).
RAW264.7 migration
To assess the role of CX3CL1 in macrophage migration, transwell assays were performed using inserts (Cat# GLS3422, Corning, New York, USA). RAW264.7 cells (2 × 10⁵) suspended in 200 µL serum-free RPMI 1640 (Cat# 11875093, Gibco, New York, USA) were seeded into the upper chamber, while 600 µL of conditioned medium from RM-1 cells transfected with control or Cx3cl1 siRNA was added to the lower chamber. After incubation for 12–24 h at 37 °C, migrated cells in the lower chamber were collected and quantified using a Z2 Coulter Counter (Cat# C19196, Beckman Coulter, California, USA).

2.6 Quantitative real-time PCR

Total RNA was extracted using Trizol reagent (Cat# 15596026CN, Invitrogen, California, USA) according to the manufacturer’s protocol. cDNA was synthesized using the PrimeScript RT Reagent Kit (Cat# RR037A, TaKaRa, Dalian, China). Quantitative PCR was performed using SYBR Premix Ex Taq (Cat# RR420A, TaKaRa, Dalian, China) on an ABI7500 Real-Time PCR system (Cat# ABI7500, Life Technologies, California, USA). Thermal cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. Gene expression was normalized to Gapdh and analyzed using the 2–ΔΔCt method. The sequences of the primers used are listed below:
Gapdh
Forward 5′–GGTCCTCAGTGTAGCCCAAG–3′, Reverse 5′–AATGTGTCCGTCGTGGATCT–3′.
iNos
Forward 5′–CAGAGGACCCAGAGACAAGC–3′, Reverse 5′–TGCTGAAACATTTCCTGTGC–3′.
Cd163
Forward 5′–TCCACACGTCCAGAACAGTC–3′, Reverse 5′–CCTTGGAAACAGAGACAGGC–3′.
Cd80
Forward 5′–GGCAAGGCAGCAATACCTTA–3′, Reverse 5′–CTCTTTGTGCTGCTGATTCG–3′.
Cd206
Forward 5′–CAGGTGTGGGCTCAGGTAGT–3′, Reverse 5′–TGTGGTGAGCTGAAAGGTGA–3′.
Arg1
Forward 5′–CTCCAAGCCAAAGTCCTTAGAG–3′, Reverse 5′–AGGAGCTGTCATTAGGGACATG–3′.

2.7 Flow cytometry

Tumor tissues were minced and dissociated enzymatically in a digestion cocktail containing 2 mg/mL collagenase type IV (Cat# 17104019, New York, Gibco, USA) and 1 U/µL DNase I (Cat# 18047019, California, Sigma-Aldrich, USA) at 37 °C for 30–45 min. Single-cell suspensions were obtained by filtering through a 70-µm cell strainer (Cat# BS-70-CS, Biosharp, Anhui, China) and subjected to red blood cell lysis using RBC Lysis Buffer (Cat# 420302, Biolegend, California, USA). After washing, cells were resuspended in FACS buffer (PBS containing 2% FBS) and stained with the following fluorescently conjugated antibodies for 30 min at 4 °C in the dark: anti-CD11b-FITC (Cat# 554982, BD Biosciences, New Jersey, USA) and anti-F4/80-APC (Cat# MA5-16625, eBioscience, California, USA). Following two rinses, cells were resuspended in PBS and analyzed on a BD FACS Canto II flow cytometer (BD Biosciences, New Jersey, USA). Data analysis was performed using FlowJo software (v.10.8.1, Tree Star, Oregon, USA).

2.8 Immunohistochemical staining

For immunohistochemical analysis, 6-µm-thick sections from paraffin-embedded tissues were deparaffinized and rehydrated. Antigen retrieval was conducted using citrate buffer (pH 6.0) in an electric steamer. Subsequent staining steps were carried out in accordance with the instructions of the immunohistochemistry kit (Cat# SPN-9002, ZSGB-BIO, Beijing, China). Briefly, endogenous peroxidase activity was blocked with 3% hydrogen peroxide for 15 min, and non-specific binding sites were blocked with 10% normal goat serum for 30 min at room temperature. Sections were then incubated overnight at 4 °C with primary antibodies against Ki67 (1:500; Cat# ab15580, Abcam, USA) or cleaved caspase-3 (1:400; Cat# 9664s, Cell Signaling Technology, USA). After washing, sections were incubated with a biotinylated secondary antibody (Cat# 31460, Invitrogen, USA) for 1 h at room temperature, followed by detection using a streptavidin-biotin-peroxidase complex and a 3,3′-diaminobenzidine (DAB) substrate kit (Cat# PV-6000D, ZSBIO, Beijing, China). Finally, sections were counterstained with hematoxylin, dehydrated through a graded ethanol series, cleared in xylene, and mounted with neutral balsam (Cat#G8590, Solarbio, Beijing, China). Images were acquired using a Nikon Eclipse Ti-S microscope equipped with a DS-Ri2 camera.

2.9 Immunofluorescence staining

For in vitro immunofluorescence, RM-1 cells were plated on glass coverslips at 5 × 10⁴ cells/well, adhered for 24 h, and serum-starved for another 24 h. Cells were fixed in 4% PFA for 10 min, permeabilized with 0.1% PBST, and blocked with 10% goat serum. Subsequent incubations included primary antibodies overnight at 4 °C and fluorophore-conjugated secondary antibodies (1:1000, Cat# 31460, Invitrogen, USA) for 1 h at room temperature. Nuclei were stained with DAPI before mounting with Fluoromount-G (Cat# 010001, SouthernBiotech, Alabama, USA).
For multiplex immunofluorescence staining of paraffin-embedded tissue sections, a tyramide signal amplification (TSA) staining kit (Cat# NECC4100, Histova Biotechnology, Beijing, China) was employed. Sections (6-µm thick) were deparaffinized, rehydrated, and subjected to antigen retrieval. After blocking, samples were incubated overnight at 4 °C with primary antibodies, followed by appropriate secondary antibodies and TSA reagent according to the manufacturer’s protocol. Antibody complexes were eluted between successive staining cycles to enable sequential labeling of multiple antigens. Nuclei were counterstained with DAPI, and slides were mounted with Fluoromount-G (Cat# 010001, SouthernBiotech, Alabama, USA). Imaging was performed using a confocal laser scanning microscope (Nikon A2, Japan). The following primary antibodies were used: anti-F4/80 (1:200, Cat# 70076, Cell Signaling Technology, USA), anti-CD206 (1:300, Cat# 24595, Cell Signaling Technology, USA), anti-CX3CR1 (1:250, Cat# ab250888, Abcam, USA), anti-CX3CL1 (1:200, Cat# 67735-1-Ig, Proteintech, Wuhan, China), anti-CD80 (1:300, Cat# 98958, Cell Signaling Technology, USA), anti-Ki67 antibody (1:500, Cat# ab15580, Abcam, USA), and anti-SOX9 antibody (1:400, Cat# 82630, Cell Signaling Technology, USA), anti-Epcam antibody (1:200, Cat# 21050-1-AP, Proteintech, USA), anti-CD4 antibody (1:200, Cat# 25229, Cell Signaling Technology, USA), anti-CD8 antibody (1:500, Cat# 98941, Cell Signaling Technology, USA), and anti-CD3 antibody (1:500, Cat# 78588, Cell Signaling Technology, USA).

2.10 Public data acquisition and processing

Publicly available genomic datasets were obtained from the following sources: single-cell RNA sequencing (scRNA-seq) data from the Gene Expression Omnibus (GEO) and the Broad Institute Single Cell Portal; bulk RNA sequencing data from The Cancer Genome Atlas Prostate Adenocarcinoma (TCGA-PRAD) cohort via the UCSC Xena browser.
Human datasets: The study incorporated the following human prostate cancer cohorts: [1] GSE181294, containing scRNA-seq data from 18 untreated primary prostate tumors and 5 benign prostate samples; [2] GSE274229, comprising scRNA-seq profiles from 6 metastatic castration-resistant (mCRPC), 25 metastatic hormone-sensitive (mHSPC), and 13 localized prostate cancer samples; [3] SCP1415, a scRNA-seq cohort of human prostate tumors; and [4] TCGA-PRAD, including bulk RNA-seq data from 501 primary tumors and 52 matched normal tissues.
Mouse datasets: Mouse scRNA-seq datasets included: [1] GSE146811, representing healthy prostate tissues under androgen manipulation; and [2] GSE262893, containing profiles from a murine prostate cancer model.
All datasets were processed using standardized quality control, normalization, and analysis pipelines appropriate for each data type before integrative analysis.

2.11 scRNA-seq data analysis

Analysis of scRNA-seq data was conducted using the Seurat package (v4.3.0) in R. Low-quality cells and doublets were filtered out using DoubletFinder (v2.0.3). Following normalization and scaling, principal component analysis (PCA) was performed for dimensionality reduction. The top significant principal components were selected for subsequent uniform manifold approximation and projection (UMAP) visualization and graph-based clustering. Cell types were annotated according to established marker genes. Differential expression analysis between defined cell clusters or conditions was carried out using the FindMarkers function with a Wilcoxon rank-sum test. Gene set enrichment analysis (GSEA) and gene ontology (GO) enrichment analysis were performed using the clusterProfiler package (v4.12.6). Cell-cell communication analysis was inferred using CellChat (v1.6.1). Immunosuppression signature scores were computed for individual cells using the Seurat “AddModuleScore” function, based on a curated gene set derived from published immunosuppression-related signatures [26].

2.12 Quantification and statistical analysis

All experiments were performed with at least three independent biological replicates, as indicated in the figure legends. Statistical analyses were conducted using R software and GraphPad Prism 8. Data normality was assessed using the Shapiro-Wilk test. Normally distributed data are presented as mean ± Standard Error of the Mean (SEM), and non-normally distributed data are expressed as median with interquartile range. Comparisons between two groups were performed using an unpaired two-tailed Student’s t-test (for parametric data) or the Mann-Whitney U test (for non-parametric data). Comparisons between three or more groups were performed using Tukey’s multiple comparisons test. Statistical significance was defined as a p-value ≤ 0.05. Exact p-values are provided in the figures and figure legends.

3 Results

3.1 Luminal 2 cells and CX3CR1+ macrophages accumulate in the prostate cancer TME

Our analysis of TCGA-PRAD data revealed a significant association between the CX3CL1-CX3CR1 axis and prostate cancer progression (Fig. S1A). This finding prompted us to employ an integrative phenomic approach, analyzing public scRNA-seq datasets to define the bidirectional interplay between CX3CL1+ and CX3CR1+ cells across stages of tumor development (Fig. S1B). The GSE274229 cohort includes 44 PCa samples across multiple disease stages with epithelial cell enrichment [26], and the GSE181294 dataset contains five healthy and 18 localized PCa samples with broad immune cell representation [27] (Fig. 1A, B; Fig. S1C-F).
Analysis of these datasets revealed that CX3CL1 was expressed across stromal and epithelial cell types, with the highest levels detected in the progenitor luminal 2 epithelial subpopulation (Fig. 1A, B; Fig. S1G, I). This subpopulation was defined according to the luminal progenitor gene set described across several independent reports [4, 27, 28]. Supporting this classification, violin plots show the expression of Tacstd2, Krt4, Ly6d, and Sox9, together with the corresponding Karthaus luminal progenitor module scores, confirming the enrichment of CX3CL1 within this luminal progenitor-like population (Fig. S1N-P). Conversely, CX3CR1 expression was predominantly restricted to the immune compartment, particularly within myeloid cells, where over 80% of CX3CR1+ cells were macrophages (Fig. 1A, B; Fig. S1E-H). The proportion of CX3CR1+ macrophages was significantly elevated in tumor tissues (1.83%, 1,168 of 63,693 cells) compared to normal prostate samples (0.86%, 155 of 17,943) (Fig. 1B, Fig. S1I).
This expression pattern was conserved in murine models. Evaluation of scRNA-seq data from normal mouse prostate (GSE146811) and PbsnCre; Ptenf/f spontaneous tumors (GSE262893) showed a marked expansion of luminal 2 cells in tumors (52.1%, 17,477 of 33,553 cells) relative to normal tissues (2.5%, 429 of 17,356 cells). Concurrently, the proportion of CX3CR1+ macrophages increased from 3.22% (559 of 17,356 cells) in normal tissue to 4.40% (1,478 of 33,553 cells) in tumors (Fig. 1C; Fig. S1J, K).
We validated these findings at the protein level by immunofluorescence staining in orthotopic tumors generated from the RM-1 CRPC cell line. In normal prostate epithelium, EpCAM was predominantly localized to the cell membrane and showed minimal co-localization with CX3CL1. In contrast, prostate tumor cells displayed a distinct nuclear localization pattern of EpCAM, consistent with previous reports [29], and a markedly increased fraction of EpCAM+ cells exhibited co-localization with CX3CL1 (Fig. 1D). Notably, this co-localization was observed with a tendency toward enrichment in EpCAM+ SOX9+ prostate cancer progenitor–like (luminal 2) cells (Fig. S1L, M).
Immunofluorescence staining confirmed an approximately threefold increase in F4/80+ CX3CR1+ macrophages in tumor tissues compared to normal tissues (10.45% vs. 3.56%, p < 0.0001; Fig. 1E-G). Together, these results demonstrate that the PCa TME is characterized by the coordinated accumulation of CX3CL1-expressing luminal 2 cells and their putative targets, CX3CR1+ macrophages.
Fig. 1
Expression of CX3CL1 and CX3CR1 in human and mouse prostate and PCa. (A) UMAP plot of human PCa samples (GSE274229), processed using the Seurat pipeline. Feature plots illustrate the expression of CX3CL1 and CX3CR1 in each group. (B) UMAP visualization of human prostate and prostate cancer samples from GSE181294, revealing 13 distinct clusters. Feature plot showing CX3CL1 and CX3CR1 expression patterns within these clusters. (C) UMAP representation of healthy mouse prostate cells (GSE146811) and mouse PCa (GSE262893) cells, identifying 9 clusters. Feature plots illustrate the expression of Cx3cl1 and Cx3cr1 in each group. (D) Schematic of in vivo orthotopic transplantation experiments using RM-1 cells in C57BL/6J mice. Representative immunofluorescence images showing co-staining of CX3CL1 and EpCAM in mouse prostate and RM-1-derived orthotopic prostate tumor tissue, Scale bars: 20 μm. (E) Representative immunofluorescence images of F4/80 and CX3CR1 co-staining in healthy prostate and RM-1 orthotopic tumor tissues. Scale bars: 20 μm. Arrows indicate typical F4/80+ CX3CR1+ double-positive cells. (F) Quantification of F4/80+CX3CR1+ double-positive cells in healthy prostate versus prostate cancer tissue (n = 3 per group, each dot represents a field of view, p < 0.0001, two-tailed unpaired t-test)
Bild vergrößern

3.2 Luminal 2-derived CX3CL1 recruits pro-tumoral CX3CR1+ macrophages

Having established luminal 2 stem-like cells and macrophages as the primary expressors of CX3CL1 and CX3CR1, respectively, we next asked whether these populations interact via the CX3C signaling pathway. Cell-cell communication analysis (CellChat) of the SCP1415 dataset identified CX3C signaling as a dominant network, with luminal 2 cells serving as the main senders and macrophages as the principal receivers (Fig. 2A, B; Fig. S2A). Supporting this, Gene Set Enrichment Analysis (GSEA) of CX3CL1hi luminal 2 cells in the GSE274229 dataset revealed significant enrichment of pathways related to cell chemotaxis (Fig. 2C, D). Correspondingly, CX3CR1hi macrophages from spontaneous PCa mouse models showed enrichment for gene sets involved in directed migration and locomotion (Fig. 2E, F).
To functionally validate these predictions, we performed transwell migration assays using BMDMs. We silenced CX3CL1 in RM-1 cells by siRNA and found that conditioned medium from CX3CL1-silenced RM-1 cells markedly reduced macrophage migration at both 12 h and 24 h compared with control RM-1 conditioned medium (both p < 0.0001), demonstrating that tumor-cell-derived CX3CL1 is required for macrophage chemotaxis in vitro (Fig. S2C). Conditioned medium from RM-1 cells induced strong migration of WT BMDMs, whereas migration was significantly impaired in Cx3cr1−/− BMDMs (Fig. S2B), confirming the necessity of CX3CR1 for tumor-cell-mediated macrophage recruitment.
Upon recruitment into the tumor microenvironment, macrophages encounter diverse polarizing signals, including cytokines from tumor and stromal cells (e.g., IL-4, IL-13, TGF-β), apoptotic cell debris, metabolic products including lactate and lipid intermediates, hypoxia, and direct cell–cell interactions. These signals collectively reprogram transcriptional and metabolic pathways to promote tissue remodeling, angiogenesis, and immunosuppressive functions, thereby favoring M2-like macrophage states. Given this pro-M2 environment, we next sought to characterize the phenotype of recruited macrophages in orthotopic RM-1 tumors.
Immunofluorescence analysis showed that tumor-infiltrating CX3CR1+ TAMs were predominantly polarized towards an M2-like, pro-tumoral phenotype, marked by CD206 expression. The proportion of CD206+CX3CR1+ TAMs was more than tenfold greater than that of CD80+ CX3CR1+ M1-like TAMs (4.86% vs. 0.43%; Fig. 2G-I). In vitro, addition of recombinant CX3CL1 to WT BMDMs promoted M2-like polarization with little effect on M1-like polarization. Notably, this pro-M2 effect was CX3CR1-dependent, as recombinant CX3CL1 did not enhance M2 polarization in CX3CR1-knockout BMDMs (Fig. S2D).
Together, these data suggested that luminal 2-derived CX3CL1 recruits CX3CR1+ macrophages into TME, where they adopt a pro-tumoral phenotype.
Fig. 2
Interaction between luminal 2 cells and macrophages. (A) UMAP plot of human PCa samples (SCP1415), processed using the Seurat pipeline. Feature plots show expression of CX3CL1 and CX3CR1 across cell groups. (B) Heatmap showing the relative importance of each cluster in SCP1415 based on the network centrality measures within the CX3C signaling networks. (C) GSEA of the top five enriched pathways in CX3CL1hi versus CX3CL1lo luminal 2 cells from human PCa samples (GSE274229). (D) GSEA enrichment plot for the “cell chemotaxis” pathway, which is significantly enriched in CX3CL1hi luminal 2 cells (NES = 1.685, FDR < 0.0001). (E) GSEA of the top five enriched pathways in Cx3cr1hi macrophages from mouse PCa (GSE262893) compared to control macrophages (GSE146811). (F) GSEA enrichment plot for the “regulation of cell migration” signaling pathway in Cx3cr1hi macrophages (NES = 1.685, FDR < 0.0001). (G) Representative immunofluorescence images of CD206+ (green, upper) or CD80+ (green, bottom) macrophages co-stained with CX3CR1 (red) in healthy mouse prostate and orthotopic PCa tissue. Scale bar: 20 μm. (H) Quantification of the percentage of CD206+/CX3CR1+ double-positive cells relative to total cells in control prostate and tumor tissues (n = 3 per group, each dot represents one field of view. p = 0.0005, two-tailed Mann-Whitney test). (I) Quantification of the percentage of CD80+/CX3CR1+ double-positive cells relative to total cells in control prostate and tumor tissues (n = 3 per group, each dot represents one field of view. p = 0.0022, two-tailed Mann-Whitney test)
Bild vergrößern

3.3 A stage-specific crosstalk between CX3CL1hi luminal 2 cells and CX3CR1hi TAMs during disease progression

To determine how the interaction between CX3CL1hi luminal 2 cells and CX3CR1hiTAMs evolves during disease progression, we analyzed scRNA-seq data from the GSE274229 cohort, which includes samples from localized PCa, metastatic hormone-sensitive prostate cancer (mHSPC), and mCRPC. CellChat analysis confirmed active CX3CL1-CX3CR1-mediated communication across all stages (Fig. 3A, B). As the disease advanced, the proportion of CX3CL1hi luminal 2 cells decreased, from 28.6% in localized PCa to 14.3% in mCRPC (Fig. 3C). Two‑dimensional signaling space visualization revealed a shift in communication patterns: luminal 2 cells served as the dominant signal sender in early-stage disease, whereas CX3CR1hi TAMs became a prominent signal source in mCRPC (Fig. 3D-F). GO analysis further indicated stage-specific functional adaptations in luminal 2 cells, which were enriched in ribosome biogenesis pathways in mHSPC and shifted toward extracellular signaling and multicellular interaction pathways in mCRPC (Fig. S3A, B).
We next examined these dynamics under androgen deprivation therapy (ADT) pressure using a murine scRNA-seq dataset (GSE146811) that tracks prostate tissue through castration-induced atrophy and subsequent dihydrotestosterone (DHT) -induced regeneration. This model mimics the transition from HSPC to CRPC. CellChat analysis showed sustained unidirectional signaling from luminal 2 cells to Cx3cr1hi macrophages throughout the castration–regeneration cycle (Fig. 3G, H). Luminal 2 cells expanded during castration-induced atrophy, peaking at day 28 post-castration, whereas Cx3cr1hi macrophages declined initially but rebounded during the DHT-mediated regeneration (Fig. 3I-L). These results illustrate a coordinated, stage-dependent interplay in which luminal 2 cells dominate early TME organization, while TAMs assume a more active signaling role in advanced, treatment-resistant disease.
Fig. 3
Dynamic interplay between luminal 2 cells and CX3CR1hi macrophages in human PCa and mouse castration-regeneration (C/R) cycle. (A) UMAP plot of the human PCa scRNA-seq dataset (GSE274229), processed by the Seurat pipeline. (B) CellChat analysis of inferred interaction strengths between CX3CL1hi luminal 2 cells and other epithelial or TAM populations. (C) Proportion of CX3CL1hi luminal 2 cells (within total epithelial cells) and CX3CR1hi TAMs (within total TAMs) across three clinical stages of human PCa (GSE274229). (D-F) CellChat analysis of communication probabilities between major cell types at three clinical stages of PCa stages (GSE274229): mHSPC, localized PCa, and mCRPC. (G) UMAP plot of mouse prostate tissue throughout a C/R cycle (GSE146811), processed using Seurat. Cx3cl1hi luminal 2 cells (1,870 cells) and Cx3cr1hi macrophages (2,985 cells) form distinct clusters. (H) CellChat analysis visualized as a chord diagram, revealing the differential interaction strengths between luminal 2 and other epithelial or macrophage subsets. (I) Fitted curves showing the dynamic changes in Cx3cr1+ macrophages and luminal cells proportions during ADT and DHT-induced regeneration. (J-L) CellChat analysis of interaction strengths at three timepoints in the C/R cycle (GSE146811): 28 days post-castration, 1 day post-regeneration, and 14 days post-regeneration. Cell populations with high outgoing interaction strength are putative signal senders; those with high incoming strength are signal receivers. “Count” refers to the number of inferred ligand-receptor pairs associated with each cell group
Bild vergrößern

3.4 CX3CR1hi TAMs exhibit an immunosuppressive, pro-metabolic phenotype following ADT

We next characterized the functional phenotype of CX3CR1+ TAMs across disease stages. In treatment-naïve human PCa, CX3CR1hi TAMs accounted for 33.4% of all TAMs and were predominantly composed of lipid-associated macrophages (LA-TAMs, 25.1%) and angiogenic macrophages (7.7%) (Fig. 4A, B, Fig. S4A-B). A similar pro-tumoral composition was observed in the Pten-deficient mouse models, where Cx3cr1hi TAMs expanded to 77.8% of the TAM compartment, with LA-TAMs (40.8%) and angiogenic TAMs (31.0%) representing the major subsets (Fig. 4C-F), indicating cross-species conservation of a pro-metabolic and pro-angiogenic phenotype.
Following ADT, the abundance and phenotype of Cx3cr1hi TAMs underwent marked changes. Their proportions declined to 20.3%, 7%, and 7.7% in localized, mHSPC, and mCRPC samples, respectively. These TAMs predominantly clustered into LA-TAM and regulatory TAM (Reg-TAM) subtypes (Fig. 4G-J, Fig. S5A). In mCRPC, pathway analysis revealed significant enrichment of cholesterol transport and storage processes in Cx3cr1hi TAMs (Fig. S5C-D), aligning with their LA-TAMs identity and suggesting a role in metabolic support of tumor growth.
Beyond metabolic reprogramming, these TAMs also displayed strong immunosuppressive properties. Cx3cr1hi TAMs exhibited significantly higher immunosuppressive signature scores compared to other myeloid subsets (Fig. 4K, L; Fig. S5E). Moreover, their interaction patterns with CD8+ T cells resembled those of SPP1hi TAMs, a population linked to immune checkpoint inhibitor resistance in mCRPC (Fig. S5F).
Together, these findings establish CX3CR1hi TAMs as multifunctional mediators of disease progression post-ADT, contributing to both metabolic support and immune suppression in the tumor microenvironment.
Fig. 4
Heterogeneity of CX3CR1hi macrophage in human PCa, mouse prostate, and mouse PCa. (A-B) UMAP plot and donut chart of TAM subclusters in human PCa samples (GSE181294). (C-D) UMAP plot and donut chart illustrating macrophage subsets in the mouse prostate (GSE146811). (E-F) UMAP plots and donut chart depicting TAM subpopulations in mouse PCa (GSE262893). Macrophage subsets are annotated as follows: Prolif, proliferative; IFN, interferon-responsive; Reg, regulatory; LA, lipid-associated; Angio, angiogenic. (G-J) UMAP plots and donut chart of TAM clusters in human PCa (GSE274229). (K) Feature plot showing the immunosuppression signature score within myeloid cells from human PCa (GSE274229). (L) Quantitative comparison of immunosuppression signature expression between SPP1hi TAM and CX3CR1hi TAM (p = 0.0002, two-tailed Mann-Whitney test)
Bild vergrößern

3.5 Genetic ablation of CX3CR1 disrupts the CSC-TAM axis and suppresses tumor progression

Given the pro-tumoral roles of the CX3CL1-CX3CR1 axis, we evaluated the therapeutic potential of its disruption using Cx3cr1−/− mice in both a spontaneous PbsnCre; Ptenf/f model and an RM-1cell-derived CRPC implantation model. In the Pten-deficient model, genetic deletion of Cx3cr1 significantly delayed tumor progression relative to controls (Fig. 5A-C). This was accompanied by a marked reduction in tumor cell proliferation, as shown by decreased Ki67+ staining (Fig. 5D-E; Fig. S6A).
The therapeutic effect was more pronounced in the aggressive CRPC model. At 21 days post-implantation, Cx3cr1−/− mice bearing subcutaneous RM1 tumors exhibited 76.5% and 79.6% reduction in tumor weight and volume, respectively, compared to WT controls (Fig. 5F-H). This suppression was driven primarily by a decreased proliferation (Fig. 5I, K) rather than increased apoptosis (Fig. 5J, L).
Notably, CX3CR1 ablation led to a marked reduction of F4/80+ TAMs in the spontaneous prostate cancer TME of Pten conditional knockout mice (Fig. S6B-I). Similarly, in the RM-1 orthotopic tumor model, CX3CR1 deficiency was associated with a significant decrease in F4/80+ TAMs. While the total number of CD80+F4/80+ M1-like macrophages remained largely unchanged, the number of CD206+F4/80+ M2-like macrophages was substantially reduced (Fig. S6K, L). Moreover, although the overall number of CD3+ T cells was not markedly altered, CX3CR1 ablation was accompanied by a decrease in CD4+ T cells and a notable increase in CD8+ T cells within the TME (Fig. S6M, N).
Importantly, disrupting the CX3CL1-CX3CR1 axis also directly affected the tumor progenitor compartment. The number of SOX9+ cells, especially the CX3CL1-expressing subpopulation, was substantially reduced in Cx3cr1−/− tumors (Fig. 5M-O; Fig.S6O, P). Co-staining of Ki67 and CX3CL1 further revealed a pronounced decrease in the proliferation of CX3CL1+ progenitors, indicating that TAM-derived signals contribute to the maintenance of the progenitors’ niche (Fig. 5P-R).
Together, these results support a functional role for the CX3CL1–CX3CR1 axis in maintaining the progenitor-TAM niche and suggest that disruption of this signaling pathway is associated with attenuated PCa progression (Fig. 6).
Fig. 5
Depletion of CX3CR1 inhibits prostate cancer progression in mouse models. (A) Gross morphology of the prostate from control, PbsnCre; Ptenf/f and PbsnCre; Ptenf/f; Cx3cr1−/− mice at 12 weeks of age (n = 6). (B-C) Tumor weight and volume in the spontaneous tumor model across the three genotypes (n = 6; p = 0.0112 and p = 0.0182, respectively; two-tailed unpaired t-test. (D-E) Representative images and quantification of Ki67+ cells in tumor sections from PbsnCre; Ptenf/f and PbsnCre; Ptenf/f; Cx3cr1−/− mice (n = 4–5), p = 0.0005, two-tailed unpaired t-test). Scale bar: 20 μm. (F) Schematic of the ectopic allograft model using RM-1 cells and gross images of subcutaneous tumors from WT and Cx3cr1−/− mice 3 weeks post-implantation. Scale bar: 1 cm. (G-H) Tumor weight and volume of RM-1 allografts in WT and Cx3cr1−/− mice (n = 10, p < 0.0001, two-tailed Mann-Whitney test). (I-L) Representative IHC images and quantifications of Ki67+ cells (n = 6; p < 0.0001) and Cleaved Caspase-3+ (n = 9; p = 0.7503) in RM-1 allograft tumors (two-tailed unpaired t-test). (M) Representative immunofluorescence images of SOX9 and CX3CL1 co-staining in orthotopic RM-1 tumors from WT and Cx3cr1−/− mice, Scale bars: 20 μm. (N-O) Quantification of SOX9+ cells (n = 6, p = 0.0001) and SOX9+ CX3CL1+ cells (n = 9; p < 0.0001; two-tailed unpaired t-test). (P) Representative immunofluorescence images of Ki67 and CX3CL1 co-staining in orthotopic RM-1 tumors. Scale bars: 20 μm. (Q-R) Quantification of Ki67+ cells and Ki67+CX3CL1+ double-positive cells (n = 6 and n = 9, respectively p < 0.0001; two-tailed unpaired t-test)
Bild vergrößern
Fig. 6
Targeting the CX3CL1-CX3CR1 Axis Disrupts CSC-TAM Crosstalk and Suppresses Prostate Cancer Progression
Bild vergrößern
Graphical summary of the CX3CL1–CX3CR1 axis in prostate cancer. In CX3CR1-competent tumors, CSC-derived CX3CL1 recruits CX3CR1+ TAMs, which deliver trophic signals that sustain CSC survival and proliferation, fostering tumor progression, particularly under stress such as androgen-deprivation therapy (ADT). Disruption of CX3CR1 signaling abolishes TAM recruitment and paracrine support, impairing CSC expansion and suppressing tumor growth in androgen-independent prostate cancer. These findings highlight CX3CR1 inhibition as a strategy to dismantle CSC–TAM reciprocity and limit progression to castration-resistant disease.

4 Discussion

Our study reveals that the CX3CL1-CX3CR1 chemokine axis is a central orchestrator of prostate cancer progression, establishing a self-sustaining, co-evolutionary circuit between therapy-resistant cancer progenitors and immunosuppressive macrophages. While previous work has linked this axis to myeloid cell recruitment and bone metastasis [2931], our findings, derived from a comprehensive phenomics analysis, uncover cancer progenitors -TAMs interaction circuit dominated by the CX3CL1–CX3CR1 signaling axis. These progenitors-TAMs reciprocity maintains the progenitor pool in prostate cancer, drives TAM recruitment and metabolic/immunological reprogramming, and promotes therapy resistance under androgen deprivation therapy (ADT) pressure.
Across multiple human samples and two complementary animal models, CX3CL1 expression is consistently enriched in a luminal 2-like CSC cluster, whereas CX3CR1 is restricted to a distinct TAM subset. CX3CL1+ CSCs expand under the selective pressure of ADT and exhibit reduced AR expression (Fig. S6J), enabling them to survive and thrive in a hormone-depleted environment. This phenotype may be driven by transcriptional reprogramming, potentially mediated by factors like FOXA1, which can suppress luminal differentiation while activating chemokine networks [32]. Beyond simple recruitment, the CX3CL1-mediated crosstalk initiates a profound metabolic reprogramming in the recruited TAMs. These macrophages adopt a lipid-associated phenotype, upregulating cholesterol transport and storage pathways to function as metabolic “fuel stations” for proliferating cancer cells. These findings elevate CX3CL1 beyond its conventional role as a chemokine to that of a local stromal “organizer” – it not only promotes macrophage chemotaxis but also facilitates their lodging near the tumor epithelium and their functional education.
The TAMs recruited via this axis are not passive bystanders but are dynamically reprogrammed into potent multifunctional effectors. In the mCRPC stage, CX3CR1hi TAMs become lipid-licensed, characterized by the upregulation of genes like ABCA1 and CD36, which facilitate cholesterol handling. Concurrently, they express high levels of ectonucleotidases such as ENTPD1 (CD39), which hydrolyze extracellular ATP to generate immunosuppressive adenosine, further shielding the tumor from immune attack [26]. This functional plasticity is remarkable; during earlier, hormone-sensitive stages, these same TAMs can express antigen-presenting machinery, suggesting they may play a dual role that adapts to the therapeutic pressures exerted on the tumor.
The reciprocal interaction we have defined constitutes a co-evolutionary circuit that drives PCa progression through metabolic-immune symbiosis. Our preclinical data compellingly show that genetic disruption of CX3CR1 breaks this circuit, leading to TAM depletion, reduced CSC proliferation, and a delay in CRPC development. These findings have significant translational implications. Clinical intervention must be timed precisely: early blockade of CX3CL1 during the mHSPC stage could prevent the establishment of this symbiotic niche, whereas in late-stage mCRPC, combining CX3CR1 inhibitors with therapies that target lipid metabolism (e.g., LXR agonists) may be necessary to dismantle the established immunosuppressive environment [33].
In summary, our study identifies the CX3CL1–CX3CR1 axis as a central metabolic–immune hub that sustains progenitors and underlies adaptation to androgen deprivation. CX3CL1-expressing luminal progenitors recruit and reprogram CX3CR1+ TAMs, establishing a lipid-rich, immunosuppressive niche that fuels tumor persistence and progression. Targeting this axis, particularly through biomarker-guided, stage-specific combination regimens, offers a promising avenue to counteract therapeutic resistance and improve outcomes in advanced prostate cancer.
However, the mechanistic basis for the reduced proliferation we observed following CX3CR1 loss is likely to reflect broad effects on tumor-associated macrophages (TAMs) rather than the depletion of a single pro-tumour subset. Previous studies indicate that CX3CR1 can support macrophage survival and accumulation within the tumor microenvironment, and that its absence may reduce macrophage numbers and impair macrophage functions such as cytokine production and tumour-supporting activity. In our models, the CX3CL1–CX3CR1 axis not only contributes to macrophage recruitment, but also appears to bias macrophages toward M2-related gene expression and, in turn, can influence the proliferative support provided to cancer cells. Nevertheless, the full in-vivo role of this axis likely depends on the interplay of multiple signals and remains to be fully elucidated. Achieving mechanistic clarity will require higher-resolution immune profiling, targeted functional perturbations, and complementary in-vivo experiments in future studies.
Despite these insights, our study has limitations. The cross-sectional nature of our human datasets restricts inference of temporal dynamics in tumor progenitors–TAM remodeling. Future longitudinal studies that integrate spatial transcriptomics with single-cell data are needed to visualize these tumor progenitors-TAMs interaction “hotspots” in situ and track their evolution during ADT resistance. Moreover, although the RM-1 transplant and PbsnCre; Ptenf/f models exhibit consistent phenotypes, the murine immune system differs from that of humans, necessitating validation in patient-derived xenograft or humanized models for clinical relevance. Additionally, the role of neuronal-derived CX3CL1 in perineural invasion, an established hallmark of PCa progression [34], was not examined here but represents a promising avenue for future investigation, given the parallels with neural remodeling in other cancers.

Acknowledgements

We thank Dr. Ying Hu for her insightful discussions.

Declarations

All animal procedures were performed in accordance with institutional guidelines and with the authorization of the Institutional Animal Care and Use Committee, Tsinghua University (Approval No. 13-LZH1).

Competing interests

The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Download
Titel
CX3CL1-CX3CR1 signaling orchestrates malignant progression of prostate cancer through luminal progenitor-macrophage crosstalk
Verfasst von
Yu Jiang
Yuchen Guo
Lizhuang Han
Shiwei Wang
Fang Wang
Yongliang Zhao
Jiajia Wang
Junyan Han
Miaomiao Liu
Zhihua Liu
Qin Zhang
Publikationsdatum
01.04.2026
Verlag
Springer International Publishing
Erschienen in
Cellular Oncology / Ausgabe 2/2026
Print ISSN: 2211-3428
Elektronische ISSN: 2211-3436
DOI
https://doi.org/10.1007/s13402-026-01179-5

Supplementary Information

Below is the link to the electronic supplementary material.
1.
Zurück zum Zitat S. Li, Y. Tian, Y. Sun, T. Xu, W. Wang, Molecular stratification of prostate cancer through sensory perception-related multi-omics analysis reveals chemoresistant mechanisms. Cell. Oncol. (Dordr). 48(5), 1609–1614 (2025)CrossRefPubMedPubMedCentral
2.
Zurück zum Zitat N.D. James, I. Tannock, J. N’Dow, F. Feng, S. Gillessen, S.A. Ali et al., The lancet commission on prostate cancer: planning for the surge in cases. Lancet (London England). 403(10437), 1683–1722 (2024)CrossRefPubMed
3.
Zurück zum Zitat K.I. Takayama, T. Fujimura, Y. Suzuki, S. Inoue, Identification of long non-coding RNAs in advanced prostate cancer associated with androgen receptor splicing factors. Commun. Biol. 3(1), 393 (2020)CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat B. Zhang, M. Liu, F. Mai, X. Li, W. Wang, Q. Huang et al., Interruption of KLF5 acetylation promotes PTEN-deficient prostate cancer progression by reprogramming cancer-associated fibroblasts. J. Clin. Invest. 2024;134(14)
5.
Zurück zum Zitat W. Guo, L. Li, J. He, Z. Liu, M. Han, F. Li et al., Single-cell transcriptomics identifies a distinct luminal progenitor cell type in distal prostate invagination tips. Nat. Genet. 52(9), 908–918 (2020)CrossRefPubMedPubMedCentral
6.
Zurück zum Zitat W.R. Karthaus, P.J. Iaquinta, J. Drost, A. Gracanin, van R. Boxtel, J. Wongvipat et al., Identification of multipotent luminal progenitor cells in human prostate organoid cultures. Cell. 159(1), 163–175 (2014)CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat D. Zhang, S. Zhao, X. Li, J.S. Kirk, D.G. Tang, Prostate luminal progenitor cells in development and cancer. Trends Cancer. 4(11), 769–783 (2018)CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat L.T.H. Phi, I.N. Sari, Y.G. Yang, S.H. Lee, N. Jun, K.S. Kim et al., Cancer stem cells (CSCs) in drug resistance and their therapeutic implications in cancer treatment. Stem Cells Int. 2018, 5416923 (2018)CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Y. Li, Z. Wang, J.A. Ajani, S. Song, Drug resistance and cancer stem cells. Cell. Communication Signaling: CCS. 19(1), 19 (2021)CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat E. Cendrowicz, Z. Sas, E. Bremer, T.P. Rygiel, The role of macrophages in cancer development and therapy. Cancers. (Basel). 2021;13(8)
11.
Zurück zum Zitat M. Bied, W.W. Ho, F. Ginhoux, C. Blériot, Roles of macrophages in tumor development: a Spatiotemporal perspective. Cell Mol. Immunol. 20(9), 983–992 (2023)CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat T. Fujiwara, M.A. Yakoub, A. Chandler, A.B. Christ, G. Yang, O. Ouerfelli et al., CSF1/CSF1R signaling inhibitor pexidartinib (PLX3397) reprograms Tumor-Associated macrophages and stimulates T-cell infiltration in the sarcoma microenvironment. Mol. Cancer Ther. 20(8), 1388–1399 (2021)CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat S.T. Barry, D.I. Gabrilovich, O.J. Sansom, A.D. Campbell, J.P. Morton, Therapeutic targeting of tumour myeloid cells. Nat. Rev. Cancer. 23(4), 216–237 (2023)CrossRefPubMed
14.
Zurück zum Zitat B.A. Siddiqui, B.F. Chapin, S. Jindal, F. Duan, S. Basu, S.S. Yadav et al., Immune and pathologic responses in patients with localized prostate cancer who received daratumumab (anti-CD38) or edicotinib (CSF-1R inhibitor). J. Immunother. Cancer. 2023;11(3)
15.
Zurück zum Zitat K.A. Autio, C.A. Klebanoff, D. Schaer, J.S.W. Kauh, S.F. Slovin, M. Adamow et al., Immunomodulatory activity of a Colony-stimulating Factor-1 receptor inhibitor in patients with advanced refractory breast or prostate cancer: A phase I study. Clin. Cancer Res. 26(21), 5609–5620 (2020)CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat H.T.T. Do, C.H. Lee, J. Cho, Chemokines and their receptors: multifaceted roles in cancer progression and potential value as cancer prognostic markers. Cancers. (Basel). 2020;12(2)
17.
Zurück zum Zitat M. Lee, Y. Lee, J. Song, J. Lee, S.Y. Chang, Tissue-specific role of CX(3)CR1 expressing immune cells and their relationships with human disease. Immune Netw. 18(1), e5 (2018)CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat J. Korbecki, D. Siminska, K. Kojder, S. Grochans, I. Gutowska, D. Chlubek et al., Fractalkine/CX3CL1 in neoplastic processes. Int. J. Mol. Sci. 2020;21(10)
19.
Zurück zum Zitat P. Liu, Y. Liang, L. Jiang, H. Wang, S. Wang, J. Dong, CX3CL1/fractalkine enhances prostate cancer spinal metastasis by activating the Src/FAK pathway. Int. J. Oncol. 53(4), 1544–1556 (2018)PubMedPubMedCentral
20.
Zurück zum Zitat S. Chen, D. Luo, W.J. Streit, J.K. Harrison, TGF-beta1 upregulates CX3CR1 expression and inhibits fractalkine-stimulated signaling in rat microglia. J. Neuroimmunol. 133(1–2), 46–55 (2002)CrossRefPubMed
21.
Zurück zum Zitat W.L. Jamieson, S. Shimizu, J.A. D’Ambrosio, O. Meucci, A. Fatatis, CX3CR1 is expressed by prostate epithelial cells and androgens regulate the levels of CX3CL1/fractalkine in the bone marrow: potential role in prostate cancer bone tropism. Cancer Res. 68(6), 1715–1722 (2008)CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat S.A. Shulby, N.G. Dolloff, M.E. Stearns, O. Meucci, A. Fatatis, CX3CR1-fractalkine expression regulates cellular mechanisms involved in adhesion, migration, and survival of human prostate cancer cells. Cancer Res. 64(14), 4693–4698 (2004)CrossRefPubMed
23.
Zurück zum Zitat D. Castellana, F. Zobairi, M.C. Martinez, M.A. Panaro, V. Mitolo, J.-M. Freyssinet et al., Membrane microvesicles as actors in the establishment of a favorable prostatic tumoral niche: a role for activated fibroblasts and CX3CL1-CX3CR1 axis. Cancer Res. 69(3), 785–793 (2009)CrossRefPubMed
24.
Zurück zum Zitat A. DiNatale, R. Kaur, C. Qian, J. Zhang, M. Marchioli, D. Ipe et al., Subsets of cancer cells expressing CX3CR1 are endowed with metastasis-initiating properties and resistance to chemotherapy. Oncogene. 41(9), 1337–1351 (2022)CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat L.-J. Xiao, Y.-Y. Chen, P. Lin, H.-F. Zou, F. Lin, L.-N. Zhao et al., Hypoxia increases CX3CR1 expression via HIF-1 and NF–κB in androgen-independent prostate cancer cells. Int. J. Oncol. 41(5), 1827–1836 (2012)CrossRefPubMed
26.
Zurück zum Zitat A. Lyu, Z. Fan, M. Clark, A. Lea, D. Luong, A. Setayesh et al., Evolution of myeloid-mediated immunotherapy resistance in prostate cancer. Nature. 637(8048), 1207–1217 (2025)CrossRefPubMed
27.
Zurück zum Zitat T. Hirz, S. Mei, H. Sarkar, Y. Kfoury, S. Wu, B.M. Verhoeven et al., Dissecting the immune suppressive human prostate tumor microenvironment via integrated single-cell and Spatial transcriptomic analyses. Nat. Commun. 14(1), 663 (2023)CrossRefPubMedPubMedCentral
28.
Zurück zum Zitat W.R. Karthaus, M. Hofree, D. Choi, E.L. Linton, M. Turkekul, A. Bejnood et al., Regenerative potential of prostate luminal cells revealed by single-cell analysis. Science. 368(6490), 497–505 (2020)CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Y. Liu, H. Ma, T. Dong, Y. Yan, L. Sun, W. Wang, Clinical significance of expression level of CX3CL1-CX3CR1 axis in bone metastasis of lung cancer. Clin. Transl Oncol. 23(2), 378–388 (2021)CrossRefPubMed
30.
Zurück zum Zitat J.F. Liu, Y.T. Tsao, C.H. Hou, Fractalkine/CX3CL1 induced intercellular adhesion molecule-1-dependent tumor metastasis through the CX3CR1/PI3K/Akt/NF-kappaB pathway in human osteosarcoma. Oncotarget. 8(33), 54136–54148 (2017)CrossRefPubMed
31.
Zurück zum Zitat X. Yao, L. Qi, X. Chen, J. Du, Z. Zhang, S. Liu, Expression of CX3CR1 associates with cellular migration, metastasis, and prognosis in human clear cell renal cell carcinoma. Urol. Oncol. 32(2), 162–170 (2014)CrossRefPubMed
32.
Zurück zum Zitat M. Teng, S. Zhou, C. Cai, M. Lupien, H.H. He, Pioneer of prostate cancer: past, present and the future of FOXA1. Protein Cell. 12(1), 29–38 (2021)CrossRefPubMed
33.
Zurück zum Zitat S.J. Bensinger, M.N. Bradley, S.B. Joseph, N. Zelcer, E.M. Janssen, M.A. Hausner et al., LXR signaling couples sterol metabolism to proliferation in the acquired immune response. Cell. 134(1), 97–111 (2008)CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat L. Cassetta, J.W. Pollard, Targeting macrophages: therapeutic approaches in cancer. Nat. Rev. Drug Discov. 17(12), 887–904 (2018)CrossRefPubMed

Neu im Fachgebiet Pathologie

Praktische forensische Todeszeitschätzung am Fundort im frühen postmortalen Intervall

Die forensische Todeszeitschätzung im frühen postmortalen Intervall dient der Eingrenzung eines wahrscheinlichen Zeitintervalls des Versterbens einer Person. Zur Anwendung kommt die sog. Komplexmethode, die sich aus der temperaturbasierten …

KI-basierte Bilder zu forensischen Demonstrationszwecken

Die Wissenschaft lebt vom Sehen, davon, dass das, was unaussprechlich ist, sichtbar (gemacht) wird – in Bildern, Skizzen, Simulationen, Schemata. Wer sich mit nichtnatürlichen Todesfällen befasst, bewegt sich stets an der Grenze zwischen …

Alternativer Ansatz zur Ableitung der Abbaukinetik von Methamphetamin und Tetrahydrocannabinol aus Blutproben von Straßenverkehrsdelikten

In den letzten 20 Jahren sind im Freistaat Sachsen, der an die Tschechische Republik grenzt, die Zahl der drogenbezogenen Straftaten, die Menge an beschlagnahmten Btm durch die Zoll- und Polizeibehörden sowie der Konsum von Betäubungsmitteln nach …

Diskriminierungserfahrungen und -wahrnehmung bei Rechtsmediziner*innen und Medizinstudierenden

Die medizinische Wissenschaft fordert längst, Sensibilität für Diskriminierungseffekte u. a. im ärztlichen Sprachgebrauch und in der medizinischen Ausbildung aufzubauen [ 9 , 20 , 22 , 24 ]. Bisherige Studien zu Diskriminierungserfahrungen im …