Background
Traumatic brain injury (TBI) is a leading cause of death and disability in young adults [
1,
2]. Effective management of TBI must consider that after trauma, tissue damage comprises both primary and secondary mechanisms [
3,
4]. Secondary injuries last for hours to days or even a lifetime [
4]. Secondary damage can be induced by processes triggered by initial injury; examples of such processes include ischemia, increased intracranial pressure, infection, inflammation, and neurodegeneration. Neuroinflammation may also persist for months to years [
5].
Neuroinflammation contributes to mechanism of secondary injury [
6]. Persistent neuroinflammation may influence spread of abnormal proteins and can cause neurodegeneration following TBI [
7]. Earliest inflammatory activation after tissue injury is assumed to be triggered by extravasated blood products, intracellular components, reactive oxygen, and nitrogen species. These are detected by microglia and astrocytes, which sense perturbation of tissue homeostasis [
8,
9]. This is followed by excitotoxicity, oxidative stress, and apoptosis [
10‐
12].
Multiple cytokines are necessary to maintain normal brain function and repair TBI. However, they may play a pivotal role in the pathogenesis of neuroinflammation-mediated secondary damage following TBI [
6,
13]. Gene profiling has shown that multiple cytokines (e.g., interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α, IL-10, and transforming growth factor (TGF)-β1) are strongly upregulated during acute phase after TBI [
14,
15]. Over time, increased cytokines may participate in maladaptive secondary injury reactions [
6]. Consistent with this phenomenon, cytokine suppression effectively ameliorates neurological damages, such as seizure, epilepsy, Alzheimer’s disease, Parkinson’s disease, autism, and multiple sclerosis, following TBI in animal models [
16]. Proinflammatory cytokines increase brain excitability and seizure susceptibility by upregulating excitatory glutamatergic transmission and downregulating inhibitory gamma-aminobutyric acid-ergic transmission [
17‐
19].
Mild TBI (mTBI) can produce long-lasting cognitive dysfunction without damaging neurons, and functional changes in intact neurons may contribute to these symptoms [
20,
21]. Network dysfunction following mTBI may be attributed to altered neuronal excitability in intact neurons. Voltage-gated sodium channels (VGSCs) are crucial ion channels for the production of action potentials and neuronal excitability [
23‐
26]. VGSCs are involved in diffuse axonal injury following TBI in mice [
27]. Mechanical trauma of axons initiates a Na
+ influx through VGSCs and subsequently triggers Ca
2+ influx and neuronal death [
28].
The influence of damaged or dead cells on distal intact neurons needs to be further explored, especially on ion channel function and neuronal excitability in the acute phase of TBI. We have previously shown that TNF-α significantly enhances Na
+ currents by upregulating VGSC expression and that brain-derived neurotrophic factor (BDNF) likely protects neurons from excitatory toxicity by downregulating Na
+ currents in neurons [
29,
30]. Here, we use an in vitro TBI model comprising mixed cultures of primary cortical astrocytes and neurons was used to evaluate the effects of inflammatory cytokine cascades on VGSCs and the excitability of distal intact neurons after TBI. The potential therapeutic role of BDNF in mechanical trauma injury was also examined.
Methods
Animal procedures
Pregnant C57 BL/6J mice were ordered from the Shantou University Medical College Experimental Animal Center, Shantou, China. Animals were conducted according to the NIH Guide for Care and Use of Laboratory Animals.
Cortical neuron culture
Primary cultures of mouse cortical neurons were established, as previously described [
29,
30], by using post-natal day 1 (P1) mice. In brief, cerebral cortices (without hippocampus) were trypsinized for 2 min with 4 mL 0.25% trypsin (Invitrogen) at 37 °C and 0.5 mL fetal bovine serum (Invitrogen). Cells were collected by centrifugation at 900
g for 10 min, resuspended in minimum essential medium (Invitrogen), and seeded onto 12 mm × 12 mm glass cover slips (2 × 10
3 cells/mm
2) pretreated with 12.5 μg/mL poly-
d-lysine (Sigma). Glutamine (2 mM, Sigma) and 2% B-27 supplement (Invitrogen) were added to neurobasal medium immediately before use. Cultures were incubated in 2 mL culture medium at 37 °C in 5% CO
2 atmosphere. Half of the culture medium was changed every 3 days. At day 3, cultures were exposed for 24 h to selective replication inhibitor arabinosylcytosine C at a final concentration of 4 μM to eliminate glial cells.
Cortical neuron–astrocyte mixed cultures and mechanical trauma injury model
Neurons and astrocytes were cultured together as previously described [
31]. Briefly, cortical tissues from P1 mice were isolated and dissociated, and individual cells (2 × 10
3 cells/mm
2) were seeded on previously prepared confluent 2-week-old astrocyte cultures with Dulbecco’s Modified Eagle Medium (DMEM)/F12 medium containing 10% fetal calf serum (Invitrogen). After 10–12 days, cocultures were subjected to mechanical injury (trauma) to mimic TBI in vitro [
22,
31]. A sterile 21-gauge needle was used to make parallel scratches across circular wells of culture plates (9 × 9 scratches in six-well plates and 6 × 6 scratches in 12-well plates). Control wells were left uninjured. Medium was replaced with serum-free DMEM/F12 medium, and cultures were incubated at 37 °C.
Effects of trauma-conditioned medium on primary cortical cultures
At 6 or 24 h after injury, the medium conditioned by cells subjected to injury was collected and added to primary uninjured cortical neurons. Uninjured (intact) neurons were plated in 12-well plates (1 × 105 cells per well), incubated for 24 h, and washed thrice with prewarmed neurobasal medium. Intact cultures were exposed for 6 or 24 h in mixed medium containing 500 μL of trauma-conditioned medium [with or without BDNF (30 ng/mL, CST)] and 500 μL of fresh neurobasal medium. Control cells were incubated in a mixed medium containing 500 μL of medium conditioned by uninjured cells and 500 μL of fresh neurobasal medium. Cells were incubated for 6 or 24 h in mixed medium for electrophysiological recording.
Electrophysiological properties of VGSCs
Electrophysiological recording of cortical cultures was performed as previously described [
29,
30]. The bath solution during whole-cell recording of voltage-gated Na
+ currents contained 140 mM NaCl, 5 mM KCl, 1 mM MgCl
2, 2 mM CaCl
2, 10 mM HEPES, 4 mM TEA-Cl, 0.1 mM CdCl
2, and 10 mM glucose. The pH was adjusted to 7.3 using NaOH. The pipette solution contained 145 mM CsCl, 1 mM MgCl
2, 1 mM CaCl
2, 1 mM EGTA, 10 mM HEPES, and 5 mM Na
2ATP. The pH was adjusted to 7.3 using CsOH.
Patch pipettes were pulled from borosilicate glass capillaries to a tip resistance of 2–5 MΩ using a P-97 micropipette puller (Sutter Instruments). Voltage-clamp recording was performed using an EPC-10 amplifier (HEKA), with series resistance compensated by 70–90%, and data frequency was recorded at 200 kHz. To examine the activation of VGSCs, neurons were held at −100 mV and depolarized to 100 mV in 5 mV steps, each of which lasted 20 ms and occurred at a frequency of 0.5 Hz. To examine the inactivation of VGSCs, Na+ currents were recorded at 0 mV following a pre-pulse from −70 to 50 mV for 40 ms with 5 mV steps.
Action potentials were recorded in current-clamp mode to measure spike thresholds and firing rates. Cells were held at 0 pA, and potentials were elicited using 120 ms depolarizing currents that were varied stepwise from −50 to 70 pA in 10 pA steps or a ramp current of 0–500 pA lasting 100 ms. The external solution contained 140 mM NaCl, 3 mM KCl, 2 mM MgCl2, 0.1 mM CdCl2, 1 mM CaCl2, and 10 mM HEPES. The pH was adjusted to 7.3 using NaOH. The pipette solution contained 140 mM KCl, 10 mM EGTA, 5 mM Mg-ATP, and 5 mM HEPES. The pH was adjusted to 7.3 using KOH. All experiments were performed at 23–25 °C.
Expression of proinflammatory cytokines
Total RNA was extracted from mouse primary mixed neuron–astrocyte cultures after mechanical injury as described above. An aliquot of total RNA (5 μg) was reverse-transcribed using oligo (dT) primers and Super-Script II reverse transcriptase (Invitrogen) in a total volume of 20 μl. Levels of messenger RNAs (mRNAs) encoding pro-inflammatory cytokines were quantified by quantitative real-time PCR (qPCR) using the primers in Table
1 and the Power SYBR Green PCR Master Mix Kit (Invitrogen) in a 7500 real-time PCR system (Applied Biosystems) according to the manufacturer’s instructions. Specificity of the SYBR Green PCR signal was confirmed by melting curve analysis. In each experiment, mouse GAPDH mRNA was amplified as an internal control.
Table 1
Primers used for qPCR
mIL-1β | GTGGCTGTGGAGAAGCTGTG | GAAGGTCCACGGGAAAGACAC |
mIL-6 | CCAGAAACCGCTATGAAGTTCC | TTGTCACCAGCATCAGTCCC |
mTNF-α | ACAGAAAGCATGATCCGCG | GCCCCCCATCTTTTGGG |
mIL-10 | TGCTATGCTGCCTGCTCTTA | TCATTTCCGATAAGGCTTGG |
mTGF-β1 | GACTCTCCACCTGCAAGACC | CGTCAAAAGACAGCCACTCA |
mMCP-1 | TTAAAAACCTGGATCGGAACCAA | GCATTAGCTTCAGATTTACGGGT |
mCCL-5 | GCTGCTTTGCCTACCTCTCC | TCGAGTGACAAACACGACTGC |
mCX3CL1 | ACGAAATGCGAAATCATGTGC | CTGTGTCGTCTCCAGGACAA |
mCD200 | CTCTCCACCTACAGCCTGATT | AGAACATCGTAAGGATGCAGTTG |
mNGF | CCAGTGAAATTAGGCTCCCTG | CCTTGGCAAAACCTTTATTGGG |
mBDNF | TCATACTTCGGTTGCATGAAGG | AGACCTCTCGAACCTGCCC |
mTrkB.FL | AGCAATCGGGAGCATCTCT | CTGGCAGAGTCATCGTCGT |
mTrkB.T1 | AGCAATCGGGAGCATCTCT | TACCCATCCAGTGGGATCTT |
p75NTR | CTAGGGGTGTCCTTTGGAGGT | CAGGGTTCACACACGGTCT |
mGAPDH | GTGCTCTCTGCTCCTCCCTGT | CGGCCAAATCCGTTCACACCG |
To complement these mRNA analyses, cytokine expression was measured in the medium of mixed cultures using commercially available enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems).
Levels of functional VGSCs in cortical neuron membranes
Membrane fractions were prepared from mouse cortical neurons treated by the conditioned medium using discontinuous sucrose gradient centrifugation. Briefly, lysate in 0.32 M sucrose/5 mM Tris (pH 7.4) was layered onto 1.2 M sucrose/5 mM Tris (pH 7.4) and centrifuged at 10,000g for 30 min. The layer at 0.8–1.2 M sucrose was collected, diluted twofold with 0.8 M sucrose/5 mM Tris (pH 7.4), and centrifuged at 20,000g for 20 min. The resulting pellet was re-suspended in a RIPA buffer containing 25 mM Tris, 150 mM NaCl, 1 mM EDTA, and 2% Triton X-100 (pH 7.4) and then centrifuged at 20,000g for 20 min to yield the final membrane preparation (supernatant). Complete protease inhibitor (Roche) was included throughout the procedure.
The membrane protein preparations were fractionated by SDS-PAGE (100 μg protein per well) and the gel band with pan-Nav and β-actin was cut horizontally and transferred onto a Hydrophobic PVDF membrane (Millipore) separately. The membrane was blocked with 5% non-fat milk. The pan-Nav and β-actin band were separately probed with a mouse anti-pan-Nav antibody (1:1000; Sigma) and rabbit anti-β-actin antibody (1:1000; Sigma) overnight at 4 °C. The membrane was washed with TBS/Tween-20, incubated in horseradish peroxidase-conjugated secondary antibody (goat anti-mouse 1:2000 or goat anti-mouse 1:2000 Sigma), washed again with TBS/Tween-20, and visualized by standard chemiluminescence. Ensure the signal images of pan-Nav or β-actin in every independent repeat experiments have a similar but not saturated exposure. Quantification of western blots was obtained from three separate experiments.
Statistical analysis
Data were expressed as means ± SEM and analyzed using Origin (Origin Lab Corporation, Northampton) and SPSS 15.0 (IBM, Chicago, IL, USA) software. One-way ANOVA and subsequent Tukey’s post hoc test were used to evaluate differences in voltage of half-maximal activation or inactivation (V
1/2), slope (k) of activation and inactivation, peak current density, standard cell viability, and threshold and firing rate for action potential. Differences in cytokine secretion tested by ELISA and normative protein expression levels were analyzed using two-way ANOVA analysis. Treatment and exposure time were considered independent variables. Student’s t test was performed to compare differences in mRNA relative expression of BDNF receptors of the two groups. Efficiency of target amplification and normalization of products was within 0.9–1.1 in real-time PCR. Results were calculated using the 2−(ΔΔCT) method. p value of <0.05 was considered statistically significant.
Discussion
This study demonstrated that multiple cytokine cascades were induced by mechanical injury and significantly increased VGSCs, Na+ currents, and excitability in intact primary cortical neurons. These findings directly implicate VGSC dysfunction in intact cortical neurons in later stages of TBI-related inflammatory microenvironment and presence of multiple pro-inflammatory cytokines. BDNF largely eliminated effects of trauma-conditioned media by inhibiting enhancement of functional membrane VGSC expression. This finding suggests that BDNF partly exerted neuroprotective effects on ion channel functions and neuronal excitability by regulating VGSC expression.
Effective management and treatment of TBI depends on short- and intermediate-term pathological assessment after injury. The majority of trauma-induced fatalities occur immediately after trauma, and a smaller number occur within 24 h of injury, which is usually caused by severe head trauma [
32,
33,
34]. Trauma patients who survived the first 24 h present increased risks of immunological dysfunction and inflammatory pathology [
35]. This inflammatory pathology results from increase in pro-inflammatory cytokines IL-1β, IL-6, and TNF-α [
36,
37]. More accurately, multiple cytokines are released in inflammatory microenvironment of acute phase TBI [
16]. Increased production of multiple cytokines was correlated with poor prognosis in TBI patients [
38,
39], and cytokine suppression represents an effective method for ameliorating secondary injury after TBI [
16]. Our results showed that mechanical traumatic injury not only upregulates all three pro-inflammatory cytokines at both mRNA and protein levels early after injury but also increases expressions of chemokine MCP-1 and anti-inflammatory cytokine IL-10 and TGF-β1. These results are consistent with findings of previous clinical studies [
38‐
40]. Therefore, our mixed astrocyte–neuron culture model simulated inflammatory microenvironment of acute TBI.
Observed increase in Na
+ currents may cause cell toxicity through several mechanisms. One potential mechanism is that augmented Na
+ currents can increase energy required to maintain Na
+ gradient across plasma membranes [
26], leading to concurrent ATP deficiency and oxidant stress. Augmented Na
+ currents can also activate sodium–calcium pumps, thereby increasing Ca
2+ influx [
27,
28]. Elevated Ca
2+ levels induce excessive release of glutamic acid from presynaptic membrane, resulting in local or more far-reaching excitotoxicity and neuronal death in central nervous system [
41]. Excitotoxicity participates in numerous brain diseases and injuries [
42,
43]. Our results showed that augmented Na
+ currents in healthy tissues exposed to injury-inflammatory microenvironment concurs with possible excitotoxic mechanism of secondary injury after TBI.
Multiple cytokines take part in VGSC expression through various pathways. Our study and other previous works showed that TNF-α and IL-1β enhanced VGSC currents by upregulating TTX-sensitive VGSC via p38 MAPK pathway in primary cortical neurons [
29,
44]. Both CXCL13/CXCR5 and CXCL12 upregulated TTX-resistant Nav1.8 in primary sensory neurons via p38 MAPK and in primary nociceptive neurons via ERK [
45,
46]. Oppositely, anti-inflammatory IL-10 can decrease VGSC current by downregulating TTX-resistant Nav1.8 expression in dorsal root ganglion neurons [
47]. In the present study, we focused on combined effects of multiple cytokines on VGSCs of intact neurons in inflammatory microenvironment. Thus, enhancement in VGSC Na
+ currents induced by conditioned medium possibly results from combined effects of multiple cytokines via various pathways; these observations still require further exploration.
We also showed that among the three types of BDNF receptors, only low-affinity p75NTR significantly increases after mechanical trauma injury; this finding is similar to those of previous studies [
48‐
50]. p75NTR is highly expressed in developing brain during synaptogenesis and is downregulated in adult brain unless the brain is injured, in which case, it is re-expressed [
51]. TrkB and P75NTR form a receptor complex for mature BDNF, and p75NTR acts indirectly to increase the number of high-affinity binding sites for TrkB [
52,
53]. At least, our results indicated that BDNF may partly exert neuroprotective effects by dose dependently reversing enhancement of Na
+ currents in secondary damage of TBI model. These findings may help in elucidating how inflammatory mediators influence electrophysiological behavior and effect of BDNF on ion channels and neuronal excitability after TBI.
Several limitations of this study should be considered. First, application of conditioned medium was lacking in lasting secretion of soluble inflammatory mediators, thus poorly simulating long duration persistence of inflammatory microenvironment in brain after TBI. Second, tests did not determine protective effects of BDNF on VGSC function of injured neurons. As shown in Fig.
2h, difference in reversal potential possibly resulted from technical problems and limited cell number for recording in each group. Difference in reversal potential disappeared with increasing number of cells for recording in each group (data not shown here). Finally, further studies should be conducted to determine whether and how inflammatory mediators directly contribute to electrophysiological behavior of non-damaged brain tissues and protective roles of BDNF by regulating VGSC function in TBI animal models.
Acknowledgements
We acknowledge Dr. Yingji Li from the ICE Bioscience (Beijing, China) for his assistance with electrophysiological experiments.