Chryseobacterium gleum in a man with prostatectomy in Senegal: a case report and review of the literature

A 68-year-old man of Wolof ethnicity (an ethnic group in Senegal, West Africa) presented to our Department of Urology with severe dehydration and general deterioration of condition 1 month after prostatectomy via transurethral resection performed at a regional hospital. At hospital admittance, a clinical examination found a high blood pressure (180/90 mmHg) and a fever of 38.5 °C. Blood tests found leukocytosis with a level of 17,100/mL white blood cells (WBC), anemia with a level of 10 g/dL, and creatinine with a level of 513.3 μmol/L. Serum electrolytes showed hyponatremia with a level of 111 mEq/L, hypokalemia with a level of 3.3 mEq/L, and hypochloremia with a level of 77 mEq/L. At presentation, he had an indwelling urinary catheter draining urine incorrectly that required a urine bacteriology examination.

Treatment consisted of fluid and electrolyte replacement, daily dressing of the wound, and empiric antibiotic therapy with amikacin. This drug was chosen because of the severity of the infection and because our patient had previously received treatment with fluoroquinolone. Seven days after hospitalization, the outcome was favorable with a clean surgical wound and normalization of serum potassium and chloride levels. However, hyponatremia persisted at 119 mEq/L, and his serum creatinine level was 150.45 μmol/L. Removal of the urinary catheter was performed on day 7 of hospitalization, and he returned home the same day.

The cloudy urine collected for bacteriology examination at hospitalization was inoculated on a cysteine lactose electrolyte deficient (CLED) agar plate according to the usual techniques for medical bacteriology. Direct examination showed a rich bacterial flora, many white cells, and Gram-negative bacilli by Gram staining. The CLED agar grew yellow-colored 1 to 2 mm circular colonies (>10⁶ CFU/mL) with regular margins.

After culture, Chryseobacterium species was suspected because of the yellow-colored colonies due to flexirubin production. Identification using the Appareil et Procédés d’Identification 20 NE identification system (bioMérieux, France) gave Myroides species and C. indologenes after, respectively, 24 hours and 48 hours of incubation (Table 2).

Antimicrobial susceptibility testing using disc diffusion and E-tests (bioMérieux) for the minimum inhibitory concentration (MIC) using Pseudomonas aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 for internal quality control was completed and interpreted per the Comité d’Antibiogramme de la Société Française de Microbiologie (CA-SFM) recommendations of 2015. The isolated strain was susceptible to piperacillin (MIC = 6 μg/mL), ceftazidime (MIC = 0.75 μg/mL), cefepime (MIC = 0.125 μg/mL), ciprofloxacin (MIC = 0.25 μg/mL), imipenem (MIC = 2 μg/mL), and resistant to meropenem (MIC = 8 μg/mL), aztreonam (MIC ≥256 μg/mL), ticarcillin (MIC ≥256 μg/mL), ticarcillin-clavulanic acid (MIC = 64 μg/mL), and cefotaxime (MIC >32 μg/mL; Table 3).

Due to the decreased susceptibility to carbapenem, a combined test with imipenem and ethylenediaminetetraacetic acid (EDTA) was positive, indicating the production of metallo-β-lactamase (MBL). To characterize the gene encoding MBL, polymerase chain reaction (PCR) was performed using genomic deoxyribonucleic acid (DNA) obtained by phenol–chloroform extraction, using the template primers CGB1_exp/fw (5′-GGGAATTCCATATGAAAAAAAGCATTCCGTTTTTTA) and CGB1_exp/rv (CGCGGATCCTTATTTTTTATTTAAAAGATCAAG) as described previously by Bellais and colleagues [9]. DNA sequence analysis of the 726-base pairs (bp) amplified fragments encoding a 242-amino acid preprotein showed 99% similarity with CGB-1 (Fig. 1).

C. gleum is an unusual human pathogen that has been reported as the cause of early neonatal respiratory infection in three neonates [3]. The most common species causing human disease is F. meningosepticum followed by C. indologenes and C. gleum [10]. Typically thought of as an organism of low virulence, C. gleum may cause serious infections, particularly among immunocompromised patients. Colonization of this organism in patients can occur via contaminated medical devices involving fluids, such as intubation tubes, respirators, humidifiers, and incubators for newborns, as previously reported [11]. Almost, all publications available in the literature refer to long hospital stays with prolonged antibiotic treatment (>14 days), oncological disease, and most of the patients had immunosuppression or indwelling devices [8‐11]. A recent case published in 2016 from Saudi Arabia, reported C. gleum pneumonia in a 6-month-old baby with nephrotic syndrome [6]. The patient, intubated, was previously on multiple courses of antibiotics including meropenem, ceftriaxone, and vancomycin. Virok et al. reported in 2014 a case of early neonatal respiratory infection due to C. gleum in Hungary [3]. In Croatia, Dijana et al. published in 2015 a case of C. gleum infection in a patient with malnutrition and hepatic lesion [5]. The patient with respiratory insufficiency had developed septic shock, which necessitated intubation and mechanical ventilation. Our patient underwent a prostatectomy in a regional hospital with indwelling catheter; he had a urinary tract infection due to C. gleum, similar to an Indian case reported by Ramya et al. in 2015 [4].

Little is known about the virulence factor(s) of the members of Chryseobacterium, although reports have indicated that biofilm and protease production are important mechanisms involved in the virulence of Elizabethkingia meningoseptica (formerly Chryseobacterium meningosepticum) and C. indologenes [11]. Biofilm production by C. indologenes in central venous catheter-related bloodstream infection was recently noted [12]. E. meningoseptica isolates demonstrated 100% biofilm-forming ability in Luria-Bertani (LB) media, and increasing biofilm production is associated with the mortality rates of infected patients [13]. Lo and Chang performed a focused study on 14 C. gleum isolates [14], and the strains were epidemiologically unrelated and originated primarily from urine and sputum. Their study demonstrated that 40% of C. gleum isolates could form a biofilm. The biofilm-forming potential of C. gleum appeared to be much lower than that of E. meningoseptica. Therefore, it was suggested that C. gleum might be less virulent than E. meningoseptica and C. indologenes. In fact, we previously reported a fatal case of urinary tract infection due to C. indologenes in a woman with acute leukemia [8]. This outcome is in contrast to the present case, where the patient survived despite an advanced state of malnutrition.

Only 0.27% (50 of 18,569) of all processed non-fermenting Gram-negative bacilli (NFGNBs) and 0.03% (50 of 15,5811) of isolates collected by the SENTRY Antimicrobial Surveillance Program during the 5-year period from 1997 to 2001 were members of the genera Chryseobacterium or Elizabethkingia (formerly Chryseobacterium), with the most frequent organisms being E. meningoseptica, C. indologenes, and C. gleum [15]. All 50 isolates were obtained from hospitalized patients, among which only two isolates (4%) were identified as C. gleum. The present case is the first reported case of a urinary tract infection in Africa by C. gleum, although C. indologenes was previously reported in Burkina Faso in 2007 [16], in Senegal in 2014 [8], and in Tunisia in 2015 [17]. However, in Senegal, two cases of meningitis due to F. meningosepticum were diagnosed in the late 1970s [7].

There are few data available on antimicrobial susceptibility and no standardized breakpoints for Chryseobacterium species in CA-SFM guidelines due to the small number of clinical isolates. Thus, selecting an antimicrobial agent for the treatment of Chryseobacterium species infections remains difficult, especially because of chromosomal resistance to many antibiotics used for Gram-negative bacteria. According to the SENTRY Antimicrobial Surveillance Program, the antimicrobials most active against Chryseobacterium species are quinolones and sulfamethoxazole-trimethoprim (≥95% susceptibility) followed by piperacillin-tazobactam (90% susceptibility). Ciprofloxacin, cefepime, ceftazidime, piperacillin, and rifampicin showed reasonable activity (85% susceptibility), whereas aminoglycosides, other β-lactams, chloramphenicol, linezolid, and glycopeptides are not appropriate for treating infections caused by this organism [15]. This conclusion is in concordance with the drug susceptibility pattern of the strain isolated in Senegal. In fact, most C. gleum infections have been preferentially treated by newer generations of quinolones than by the combination of piperacillin-tazobactam (Table 1). However, the strain isolated in Saudi Arabia was resistant to piperacillin-tazobactam. In addition, it was previously published that C. gleum CIP 103039 carried at least two likely chromosome-encoded β-lactamases, Amber class A CGA-1 and Amber class B CGB-1, and was resistant to penicillins, cephalosporins, cefotaxime, and aztreonam, intermediate to carbapenems, and susceptible to piperacillin. Our strain showed the same drug susceptibility pattern as C. gleum CIP 103039 (Table 4). In contrast, the focused study of 14 C. gleum isolates conducted in Taiwan by Lo and Chang revealed that all isolates were resistant to piperacillin and imipenem [14].

To the best of our knowledge, this is the first case of a C. gleum infection reported in Africa. Despite their low virulence, Chryseobacterium species should be considered a potential opportunistic pathogen that can cause infection in hospitalized patients. This report highlights the emergence of Chryseobacterium infections in Africa and emphasizes the importance of strengthening hospital hygiene measures as well as the necessity to survey environmental bacteria that could cause hospital-acquired infections.