Deregulation of histone lysine methyltransferases contributes to oncogenic transformation of human bronchoepithelial cells

First, we examined the expression levels of HKMTs in 5 non-small cell lung cancer cell lines, namely A549, Calu-1, SK-LU-1, SK-MES-1 and SW900. Most HKMTs were up-regulated in the majority of NSCLC cell lines compared to NHBE cells, while only SET9 remained at the same level as in NHBE cells (Fig. 1a). We next found that the expression levels of H3-K4 MTs, SET9 and SMYD3 remained at similar ranges after introduction of LT and activated H-Ras into NHBE cells, while all of the other HKMTs, i.e.; H3-K9, H3-K27, H3-K79 HKMTs, increased after immortalization and transformation (Fig. 1b).

To evaluate the function of these HKMTs in the immortalized and the transformed cells, we treated transformed NHBE cells with siRNAs for 7 HKMTs, namely SET9, SMYD3, SETDB1, SUV39H, EZH2, G9A and DOT1L (Fig. 2). The level of each gene mRNA expression was evaluated by quantitative RT-PCR at 48 hours after transient transfection of siRNA (Fig. 2A). Among the 3 or 4 siRNAs tested for each HKMT, the most efficient siRNA sequence was selected for each gene for further experiments. We then evaluated cell proliferation using a colorimetric assay for immortalized cells and transformed cells treated with each siRNA. The cell proliferation was significantly reduced in both immortalized and transformed NHBE cells after 72 hours for the siRNA treatment of EZH2, G9A and SUV39H compared to the random non-targeting control oligonucleotides treatment, while H3-K4 or H3-K79 knock down did not change the cell proliferation levels (Fig. 2B and 2C). We also prepared cell growth curve for immortalized and transformed NHBE cells treated with siRNA. During the cultivation period, as we observed the recovery of the mRNA expression levels had increased by up to about 70% of the untreated level at day 7 (data not shown), we performed a second transient siRNA transfection on day 8 to observe the cell growth only. The cell growth rates for both immortalized and transformed NHBE cells were significantly slowed by siRNA treatment of EZH2, G9A and SUV39H compared to the control oligonucleotide treatment, however, siRNA treatment of SET9, SMYD3, SETDB1 and DOT1L did not alter the cell growth rate (Fig. 2D and 2E). The reduction of cell growth was more notable when a H3-K27 MT, EZH2, was knocked down compared to when any other H3-K9 MTs was suppressed.

Since the expression levels of H3-K9 MTs and H3-K27 MT were almost identical between the immortalized and the transformed NHBE cells, the roles of these HKMTs for transformation induced by activated H-Ras were not clear. To determine if the H3-K9 and H3-K27 MTs play roles in transformation after immortalization, we evaluated the ability of anchorage independent cell growth of transformed NHBE cells treated with siRNA for each HKMT. Compared to control siRNA treated transformed NHBE cells, The cells knocked down with siRNAs for either of 3 H3-K9 MTs or H3-K27 MT formed significantly reduced number of colonies in soft agar compared to the cells treated with the random control siRNA, while H3-K4 MTs or H3-K79 MT knocked down cells did not show any change in the number of colonies or the morphology of the cells (Fig. 3A and 3B). Notably, SETDB1 is also essential for transformation, despite no apparent role in immortalization.

We evaluated the DNA synthesis using a BrdU incorporation assay. DNA synthesis was reduced by suppression of H3-K27 MT, EZH2, in both immortalized and transformed NHBE cells. Meanwhile, suppression of H3-K9 MTs did not affect the DNA synthesis level in these cells (Fig. 4A and 4B). We also evaluated the cell cycle, specifically G1 arrest, by calculating S phase cells based on cellular DNA content in immortalized and transformed cells treated with siRNAs. We found results similar to those of the BrdU incorporation assay, that is, total S phase was only reduced in the cells treated with siRNA for EZH2 (Fig. 4C and 4D).

Next, we analyzed apoptosis levels in cells treated with siRNAs to ascertain whether the cell growth inhibition observed was related to apoptosis. Although statistical significance was not reached, apoptosis levels in G9A or SUV39H knocked down cells were much higher than the negative control in immortalized NHBE cells, while apoptosis levels appeared to be unaffected by suppressing any HKMTs in transformed NHBE cells (Fig. 5A and 5B).

Phoenix producer cells were transfected with the following plasmids using FuGene 6 (Roche Molecular Biochemicals, Indianapolis, IN, USA): pBABE-puro-hTERT and pBABE-hygro-ras-V12 (kind gifts from RA Weinberg, Massachusetts Institute of Technology, Cambridge, MA, USA), and pBABE-puro-U19 and pLXSN-U19 (a kind gift from J DeCaprio, Dana Farber Cancer Institute, Boston, MA, USA). U19 is an SV40 large T (LT) antigen variant lacking the SV40 origin DNA binding motif (Rios, 1990 J Cell Physiol 145:434). Supernatants were used to infect NHBE cells (TaKaRa Bio, Shiga, Japan).

Five NSCLC cell lines; A549, Calu-1, SK-MES-1, SK-LU-1 and SW-900, were cultured in complete Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum and incubated at 37°C with 5% CO₂. Immortalized and transformed models of NHBE cells were cultured in Small Airway Growth Medium (SAGM; TaKaRa Bio, Shiga, Japan) at 37°C in 5% CO₂. (Logarithmically growing cell cultures were used for all experiments described below.)

Total cellular RNA was prepared from the cells by using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and 0.5 mg of the RNA was then reverse transcribed to cDNA using an Omniscript RT kit (Qiagen). For quantitative RT-PCR analysis, the cDNA was combined with gene-specific forward and reverse primers for each HKMT and a SYBR Green PCR master mix and subjected to real time fluorescence detection PCR using an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization of cDNA input. The thermal cycling conditions were as follows: initial denaturation at 95°C for 15 min, 45 cycles of 95°C for 15 s, 58°C for 15 s and 72°C for 30 s, followed by melting temperature analysis (72–99°C with 1°C increments). The amplification was specific as judged by melting temperature analysis and agarose gel analysis. The experiments were performed in duplicate and twice. The following oligonucleotides were used as primers.

SET9 forward primer: TTCACTCCAAACTGCATCTACGA

SET9 reverse primer: GGGTGCGGATGCATTTG

SMYD3 forward primer: CCCAACTGTTCGATTGTGTTCA

SMYD3 reverse primer: TCCTCTCCCACCTCGATGTC

SUV39H forward primer: CTGCCCATCTACGAGTGCAA

SUV39H reverse primer: TACCCTTCTGTACCACACGATTTG

SETDB1 forward primer: GACTCTCTGAGACAACTTCCAAGGA

SETDB1 reverse primer: CAGGGATTGAGGGAGGAACA

G9A forward primer: CTCCGCTGATTTTCGAGTGTAA

G9A reverse primer: CTCTGTACGACCCGGTTCTTG

EZH2 forward primer: CAAGCAGTGCCCGTGCTA

EZH2 reverse primer: AGCGGCTCCACAAGTAAGACA

DOT1L forward primer: CATCCGATGGGTCTGTGA

DOT1L reverse primer: TGGTGTCATAGTCAATTAAAACGTAATTC

For siRNA-mediated down-regulation of HKMTs, each target specific sequence was designed using siDirect software provided by RNAi Co., Ltd (Tokyo, Japan) and synthesized by Proligo Japan KK (Kyoto, Japan). Three or four target sequences were designed for each HMT gene and transient transfection of siRNAs was performed. All siRNA experiments were conducted at a final concentration of 20 nmol/L duplex siRNA. For transfection into the cells, Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) was used according to the manufacturer's protocol. Knockdown of each HKMT expression was confirmed using quantitative reverse transcription-PCR. Non-targeting control siRNA was provided by RNAi Co., Ltd as well. The following were used as siRNA targeting sequences that were most effective for each gene:

Non-targeting control; GUACCGCACGUCAUUCGUAUC

SET9; GGGAGUUUACACUUACGAAGA

SMYD3; CCGCGUCGCCAAAUACUGUAG

SUV39H; GAAAUGGCGUGGAUAUCCAGA

SETDB1; CAGCCCGGCGUCGAGUUAACC

G9A; CAUGACUGCGUGCUGUUAUUC

EZH2; GAAUGCCCUUGGUCAAUAUAA

DOT1L; GGCGAGCCAGUCAAUAGCAGC

Cell Proliferation Reagent WST-1 (Roche, Indianapolis, IN, USA) was used for the colorimetric cell enumeration assay according to the manufacturer's protocol. One day before siRNA transfection, 1 × 10⁴ cells were plated in 100 μl of the growth medium for each 96-well culture plate. Following the siRNA transfection, cells were incubated for 24, 48, 72 and 96 hours at 37°C in a 5% CO₂ environment. WST-1 reagent was then added to each well, cells were incubated for an additional 4 hours, and then the absorbance of the samples was measured at a wavelength of 450 nm against a background control using a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA). For cell growth rate analysis, one day before siRNA transfection, 3 × 10⁵ cells were plated in growth medium in 12-well culture wells and then the cells were collected by trypsinization 48 hours, and 7, 10 and 14 days after the siRNA treatment and counted using a cell counter, Z1™ Series COULTER COUNTER^® (Beckman Coulter, Fullerton, CA, USA).

Three ml of 0.6% agarose containing SAGM per well was prepared in a standard 6-well cell culture plate. Then, 1.5 ml of 0.3% agarose containing SAGM with a suspension of 0.5 × 10⁴ cells treated with siRNAs was added on top of the basal 0.6% agarose containing medium. After 14 days of incubation at 37°C in 5% CO₂, colony growth in soft agar was assayed by visually counting the colonies. A colony was defined as >100 cells in one site. Experiments were performed in triplicate with two independent experiments.

Cell Proliferation ELISA BrdU (Roche, Indianapolis, IN, USA) was used for the BrdU incorporation assay. Cells (1 × 10⁴) were plated in 100 μL of SAGM in 96-well culture plates and cultured for 48 hours after the treatment at 37°C in a 5% CO₂ incubator. The newly synthesized DNAs were labeled with BrdU for an additional 4 hours of incubation, and then the cells were fixed and the DNA was denatured. After incubation with anti-BrdU-POD for 90 minutes, a POD substrate (tetramethyl-benzidine) was added to develop a color to be quantified by measuring the absorbance at the 370 nm with a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA).

For starvation, 1.5 × 10⁶ cells were incubated for 24 hours in 1.0 ml of SAGM without growth supplements for each 6-well cell culture plate at 37°C in a 5% CO₂ incubator before treatment with siRNAs. Forty-eight hours after the siRNA transfection, the cells were trypsinized and resuspended in 0.5 ml of phosphate Buffered Saline (PBS) and then fixed with 4.5 ml of 70% ethanol for 2 hours on ice. After one wash with PBS, for DNA staining the fixed cells were incubated with DNA fluorochrome, propidium iodine (PI) along with 0.1% Triton X-100 and ribonuclease A for over 30 min at room temperature. Cell fluorescence was measured by a flow cytometry, FACS Flow (BD Biosciences, San Jose, CA, USA). Deconvolutions of the DNA content frequency histograms were analyzed using CellQUEST software (BD Biosciences).

Apoptosis assay was performed using Cell Death Detection ELISA PLUS according to the manufacturers' protocol (Roche, Indianapolis, IN, USA). Cells (1 × 10⁴) were plated in 100 μl of SAGM in each 96-well culture platse and cultured for 48 hours after siRNA treatment at 37°C in a 5% CO₂ incubator. After cell lysis, intact nuclei were pelleted by centrifugation and then placed into a streptavidin-coated well of a microplate. A mixture of anti-histone-biotin and anti-DNA-POD were added and incubated. After unbound antibodies were removed by a wash, POD retained in the immunocomplex was determined by adding substrates to develop a color to be quantified by measuring the absorbance at 370 nm with a microplate reader (Bio-Rad Laboratories, Hercules, CA, USA).