Deregulation of neuronal miRNAs induced by amyloid-β or TAU pathology

All animal experiments were conducted according to protocols approved by the local Ethical Committee of Laboratory Animals of the KU Leuven (governmental licence LA1210591, ECD project number P202–2013) following governmental and EU guidelines. APPtg (APP^swe/PS1^L166P [21]) mice express APP^Swe and PSEN1^L166P transgenes under the Thy1.2 promoter; TAUtg (THY-Tau22 [22]) mice, express the 412 aa isoform of the human 4-repeat MAPT gene containing the G272 V and P301S mutation under the Thy1.2 promoter. All mice have been backcrossed to C57BL/6 J for more than 9 generations. Male mice (transgenic (tg) and wild-type (wt) littermate controls) were sacrificed at 4 months (4 M, average 123.8 days, SD 1.84 days) or 10 months of age (10 M, average 299.8 days, SD 2.22 days), giving rise to 8 experimental groups (n = 12 per group): APPwt 4 M, APPwt 10 M, APPtg 4 M, APPtg 10 M, TAUwt 4 M, TAUwt 10 M, TAUtg 4 M, TAUtg 10 M. An independent cohort of 4 M and 10 M APPtg and APPwt littermates (n = 7–9/group) was used for qPCR validation. Following cervical dislocation, both left and right hippocampi were microdissected and snap-frozen in liquid nitrogen. Samples were stored at -80 °C.

Hippocampal tissue samples were obtained from the London Neurodegenerative Diseases Brain Bank and collected in accordance to British legislation and their ethical board [23]. The human study was evaluated and approved by the ethical committees of Leuven University and UZ Leuven [23].

The left hippocampus was homogenized in TRIzol (Invitrogen, Carlsbad, CA, USA) using 1 ml syringes and 22G/26G needles and purified on mirVana spin columns according to the manufacturer’s instructions (Ambion, Austin, TX, USA). RNA purity (260/280 and 260/230 ratios) and integrity was assessed using Nanodrop ND-1000 (Nanodrop Technologies, Wilmington, DE, USA) and Agilent 2100 Bioanalyzer with High Sensitivity chips (Agilent Technologies, Inc., Santa Clara, CA, USA) and Qubit 3.0 Fluorometer (Life Technologies, Carlsbad, CA, USA), respectively (see Additional file 1: Table S1).

The miRNA library was prepared by the Genomics Core (UZ Leuven) using Illumina TruSeq Small RNA Sample Prep Kit (Illumina, San Diego, CA, USA), adding 2 μl of 50% PEG8000 in the 3′ ligation and with 13 cycles of cDNA amplification. Library construction of 96 samples was performed in 4 different batches of 24 samples, with 1–5 samples per experimental group within each batch. Three libraries were pooled and all RNAs between 5 and 40 bps in length were selected using the BluePippin (Sage Science, Beverly, MA, USA). Equimolar concentrations of 8 pools of 3 samples were loaded per lane and 4 lanes in total were used to sequence 50 bps single-end reads using the Illumina HiSeq 2500 (Illumina, San Diego, CA, USA).

Raw reads were trimmed with Flexbar (version 2.5.35, [24]) and filtered to remove unwanted adaptors, low-quality reads and reads with ambiguous nucleotides. Reads with ≥15 nucleotides were mapped to the mm10/GRCm38 Mus musculus assembly using Bowtie2 (version 2.2.1, [25]) allowing 1 mismatch. Stranded miRNA read counts were produced by FeatureCounts from the Subread package (version 1.4.4, [26]) using the miRBase gff3 annotation file (version 20, [27]).

We found in 2 of the 12 mice in the APPtg 10 M group a 46% lower expression levels of hsa-APPswe, a 26% lower expression of hsa-Psen1L166p and a 24% reduction in mmu-Thy1 gene, whose promoter drives the expression of the transgenes, compared to the other APPtg 10 M mice. In the absence of an explanation, these two mice were excluded from all further analyses (data not shown).

miRNAs with an average of raw read counts < 5 were discarded, leaving 644 miRNAs for differential expression (DE) analysis. Non-biological variation was removed by the removeBatchEffect function from limma package 3.22.7 Bioconductor/R [28], preserving biological variation of genotype, age and their interactions in a generalized linear model for the APPtg and TAUtg dataset combined, as well as separately, while removing technical effects such as batch effect, RNA extraction group effects, RNA concentration effects. DE analysis was conducted using a 2-way interaction model (age, genotype, age*genotype) and performing Benjamini-Hochberg p-value adjustment for multiple testing. All miRNAseq data has been submitted to the GEO database under accession number GSE110743.

Predicted miRNA targets were obtained from TargetScan Mouse v7.1. Gene Ontology (GO) category overrepresentation among predicted targets for each upregulated miRNA was assessed using the unranked option in GOrilla [29]. Only GO categories with > 5 predicted targets overlapping were considered for the analysis, using FDR-corrected p-value < 0.05 for significance.

One hundred ng of RNA was used for reverse transcription of miRNAs using the miRCURY LNA™ Universal cDNA synthesis kit II (Exiqon, Denmark). Real time semi-quantitative PCR used ExiLENT Sybr Green master mix kit and LNA PCR primers (Exiqon, Denmark). Cp (crossing points) were determined by using the second derivative method. Fold changes were calculated with the ΔΔCt method (Livak & Schmittgen, 2001) using the geometric mean of mmu-let7g-5p and mmu-miR-23b-3p as normalizer.

The right hippocampi (n = 5–6/group) of our miRNAseq mouse samples were homogenized using a mechanical homogenizer, Fastprep tubes and T-PER Tissue Protein Extraction Reagent (#78510, Thermo Fisher Scientific, Belgium) with phosphatase (P0044 and P5726, Merck, Germany) and cOmplete protease inhibitors (#11836145001, Roche/Merck, Germany). The soluble proteins were separated from the insoluble pool by collecting the supernatant after ultracentrifugation (1 h, 4 °C, 55000 rpm; TLA 100.4 rotor, Beckman Coulter, France). For insoluble Aβ extraction, the pellet was resuspended in 2 volumes (vol: wet weight of tissue) of GuHCl (6 M GuHCl/50 mM Tris-HCl, pH 7.6) with cOmplete protease inhibitors and sonicated for 30s. After 1 h incubation at 25 °C and ultracentrifugation (20 min, 70.000 rpm, 4 °C; TLA 100.4 rotor, Beckman Coulter, France), the supernatant is diluted 12× in GuHCl diluent buffer (20 mM phosphate, 0.4 M NaCl, 2 mM EDTA, 10% Block Ace, 0.2% BSA, 0.0% NaN3, 0.075% CHAPS, pH 7.0) with cOmplete protease inhibitors. Both soluble and insoluble protein fractions were used for detection of human Aβ40 and Aβ42 by standard sandwich ELISA as described before [30].

For detection of total and phosphorylated TAU, the soluble protein fractions were diluted in 1× SDS-PAGE loading buffer with 5% β-mercaptoethanol, boiled (5 min at 96 °C) and briefly centrifuged. Electrophoreses was performed with 7.5 μg (total TAU) or 15 μg (phosphorylated TAU) of protein on NuPAGE Novex 4–12% Bis-Tris gels (Life Technologies, Thermo Fisher Scientific, Belgium), and after transfer, nitrocellulose membranes were blocked for 1 h in blocking solution (5% milk powder in 0.1% TBS-Tween20). Antibody incubation was performed in blocking solution; for the primaries (mouse TAU-5 (total TAU, 1/1000; Ab80579, Abcam, UK); AT8 (1/500; MN1020) and AT270 (1/500; MN1050, Pharmingen, BD Biosciences, Belgium); β-actin (1/100.000; A5441, Sigma-Aldrich, Belgium)) overnight at 4 °C, and for the secondary (goat anti-mouse, 1/10.000; 170–6516, Bio-Rad, USA) for 1 h at room temperature. Blots were developed using chemiluminescence (Perkin Elmer, USA) and normalized to β-actin expression.

Given that not all data was normally distributed, Spearman correlation analysis and False Discovery Rate (FDR) p-value adjustment (padj) was performed between the mouse miRNAseq-derived and normalized miRNA expression values, ELISA-based soluble and insoluble human Aβ40 and Aβ42 levels and immunoblotting-based total TAU and phosphorylated TAU levels. The same was done for the human qPCR-based miRNA expression values (this study) and the immunoblotting-based levels of total TAU, AT8, AT270, full length APP, soluble APPβ, and APP C-terminal fragments (CTFs) in the same samples, which were analyzed in a previous study [31].

In situ hybridization (ISH) probes (Ribotask and Exiqon, Denmark) against the mature sequence of miRNAs [32‐34] were used (Additional file 1: Table S1). Slices (50 μm) of 4% paraformaldehyde perfused mouse brain (APPtg 4 M, APPtg 10 M, APPwt 4 M, APPwt 10 M) were mounted, dried at room temperature (RT), post-fixed with 4% ice-cold paraformaldehyde, heated 3× to boil in the microwave in sodium citrate buffer (10 mM, 0.05% Tween 20, pH 6.0), washed in methylimidazole buffer (2 × 10 min; 0.13 M 1-methylimidazole, 300 mM NaCl, pH 8.0) and fixed with EDC (0.16 M, pH 8.0) in methylimidazole buffer for 1.5 h at 25 °C in a humidified chamber using hybridization covers. After PBS washes, slides were acetylated (1 min, RT) and pre-hybridized (1 h) in hybridization solution (50% formamide, 5xSSC, 1× Denhardt’s solution and 500 μg/ml yeast t-RNA for Ribotask probes). miRNA or scrambled probes (40 nM) were linearized in hybridization buffer (4 min, 94 °C). Sections were hybridized (1.5 h, for temperature see Additional file 1: Table S1). Following stringency washes (at hybridization temperature: 3 × 0.2xSSC and 1 × 0.5xSSC; at RT 1× 2xSSC), slides were incubated with 3% H₂O₂ (7 min, RT), and in blocking buffer 1 (1 h, RT; 0.1 M Tris-HCl, 0.15 M NaCl, 0.5% Blocking Reagent (Roche Diagnostics, Belgium) and 0.5% BSA). Subsequently, sections were incubated (1 h, RT) with anti-fluorescein HRP-conjugated antibody (Roche Diagnostics, Belgium) in blocking buffer 1 and developed with TSA Plus Fluorescein reagent (8 min, RT; Perkin Elmer, USA).

Antibodies 6E10 (1/150, Biolegend, USA, #803002), GFAP (1/200, Dako-Agilent, USA, #Z033401) were used for immunofluorescence. Sections were blocked with blocking buffer 2 (1 h, RT; 5% normal goat serum in 0.2% PBS-TritonX 100). Primary antibodies were incubated overnight at 4 °C (6E10) or for 2 h (GFAP) at RT in incubation solution (0.5% goat serum in 0.2% PBS-T), followed by incubation with the secondary antibody (2 h, RT). DAPI counterstain (10 min, RT; 1/5000, Sigma-Aldrich, Belgium, #D9542) was performed and mounting was carried out in mowiol. Images (z-stacks) were acquired using a Nikon A1R Eclipse Ti confocal microscope.

Male mice (C57BL/6 J, 18–26 weeks old, n = 9–12 per treatment group) were implanted with a guide cannula in the lateral ventricle (from bregma AP: − 0.1 mm, ML: − 1.0 mm, DV: − 3.0 mm) under isoflurane anesthesia (5% induction, 2–2.5% maintenance). Mice were infused 1× per week with 2 μl of miR-mimic or negative control oligonucleotide (mature sequence, based on C. elegans cel-miR-67: UCACAACCUCCUAGAAAGAGUAGA (miRbase ID: MIMAT0000039) Dharmacon, GE Healthcare, Belgium) mixed in a 1:1 ratio with lipofectamine 2000 (Thermo Fischer Scientific, Belgium).

A titration experiment (n = 2 per dose) was performed to determine an adequate dose of miR-mimic infusion (Dharmacon, GE Healthcare, Belgium), i.e. not exceeding 100-fold overexpression after 1 week of infusion (see Additional file 2: Figure S1). MiR-mimic treated mice were sacrificed either 1 week or 48 h after infusion via cervical dislocation and the expression levels of the appropriate miRNA were assessed in the right hippocampus using semi-quantitative PCR (see above). The degree of miRNA overexpression in the miR-mimic treated mice was expressed as fold change compared to equimolar or higher concentrations of negative control-treated mice (i.e. 150 pmol miR-mimic against 150 pmol control; 75 & 15 pmol miR-mimic against 75 pmol control; 1.5 to 0.0015 pmol miR-mimic against 1.5 pmol control oligonucleotide).

For the behavioral experiments mice were subjected to either 3wks (individual miRNAs) or 7 wks (miR-mix) of miR-mimic overexpression followed by behavioral assessment (see Fig. 4a), splitting the mice over four separate batches of behavioral experiments: miR-142a (15 pmol) vs negative control (15 pmol); miR-146a (15 pmol) & miR-155 (1 pmol) vs negative control (15 pmol); miR-10a (0.1 pmol), miR-211 (0.1 pmol) & miR-455 (0.15 pmol) vs negative control (0.15 pmol); miR-mix (31.35 pmol) vs negative control (31.35 pmol). Behavioral assessment was performed using the open field, T-maze, context- and cue-dependent fear conditioning, Morris Water Maze (MWM), novel object recognition (NOR) and social preference/social novelty test (SPSN). Mice were sacrificed by cervical dislocation 7 days after the last injection and hippocampi were dissected, snap frozen and stored at − 80 °C, before processing samples for semi-quantitative PCR (see above).

After 30 min dark adaptation, the mouse was placed in a brightly lit (465 lx) 50 × 50 cm square arena of transparent plexiglass, 1 min habituation and 10 min recording [35]. Mice were tracked in the arena with ANY-maze^tm Video Tracking System software (Stoelting Co., IL, USA), recording total path length (locomotor behavior) and time spent and number of entries in the corners (7 × 7 cm), walls and center circle of the open field (anxiety-like behavior).

The mouse was placed in the start arm of the T-maze and free to enter the left or right arm (familiar arm), after which the other arm (novel arm) was blocked. After 30 min, the mouse was re-introduced into the maze with all arms accessible, and the total path length, number of entries and total time spent in each arm was recorded using ANY-maze^tm software.

Mice were habituated to the contextual fear response (CFR) cage (StartFear cage, Panlab, Cornella de Llobregat, Spain) for 5 min. Context- and cue-dependent fear conditioning was induced on day 2 by presenting 2 conditioned stimuli (i.e. 30s tone, 4 kHz, 80 dB, inter-stimulus interval 1 min) which co-terminated with a 2 s 0.3 mA foot shock [36]. Freezing behavior was recorded 24 h later (sensitive Weight Transducer System (Panlab, Cornella de Llobregat, Spain)) as a proxy for memory retention in the conditioned context (no lights, grid floor, ethanol-based odor for 5 min), and in a novel context (lights on, white plastic floor and mint odor, 3 min) and in combination with the auditory cue (3 min).

Mice were trained for 2 × 5 days in a 150 cm circular Morris water maze (MWM) pool filled with opaque (non-toxic white paint) water (26 °C) [35], where a 15 cm round platform was submerged in a fixed position 1 cm below water level. Daily training session consisted of 4 trials (15-30 min intervals) starting from 4 randomized starting positions. Mice that failed to locate the platform within 2 min, were gently guided to the platform and left there for 10s. Probe trials were conducted on day 6 and 12 during the 10-day training period, where the platform was removed from the pool and mice swam freely for 100 s. ICV injections were administered after the probe trial. Mice were tracked with EthoVision tracking equipment and software (Noldus, Wageningen, the Netherlands), calculating escape latency, path length and swimming velocity during training, and, during the probe trial, time spent in each quadrant and latency to first enter the target quadrant and target position.

In the novel object recognition (NOR), mice were presented for 10 min with 2 randomized identical objects (blue or yellow LEGO® blocks built in different ways, a liquid filled 50 ml falcon tube or a Playmobil® Christmas tree) placed 10 cm from the corners on the diagonal line of the open field arena. After 1 h, the left or right object was replaced by a different object. Exploration lasted 5 min and was scored manually for each object, being defined as directing its nose to the object (< 1 cm distance) and/or touching the object with its nose. Memory performance was calculated by the D2 discrimination index: (time spent exploring novel object – time spent exploring the familiar object)/ total time spent exploring both objects [37].

Sociability and social memory were assessed in the social preference/social novelty test (SPSN), as described in [38]. In short, a test mouse was placed in the middle compartment of a 3-compartment transparent Plexiglas arena (94x28x30 cm), divided by manually guided sliding doors. After 5 min habituation, a stranger mouse was placed in a cylindrical cup in the left or right compartment, and the test mouse could explore all 3 compartments for 10 min during this sociability trial. Subsequently, during the social novelty test a second stranger mouse was placed in a cylindrical cup in the free compartment (left or right) and the test mouse could again explore all 3 compartments for 10 min. Using nose tracking and a virtual 5 cm perimeter around the cylindrical cups holding the stranger mouse, social exploration and distance travelled was assessed using ANY-maze^tm software.

Overall, the significant (adjusted p-value after false discovery rate correction (padj) < 0.05) observed changes in miRNA expression are modest (log2-fold change (LFC): − 0.95 - + 2.23), similar to what we reported in AD patients [40]. Combining the APPtg and TAUtg dataset during differential expression analysis highlights miRNAs that are commonly deregulated. Eight miRNAs are significantly up-regulated with more than 20% change (LFC > 0.26) in the age*genotype interaction when both APPtg and TAUtg mice are taken together, although the pattern of deregulation of miR-451a and miR-301b-3p is less outspoken compared to the other six (see Fig. 1c). miR-10a-5p (LFC: + 0.76), miR-155-5p (LFC: + 1.04) and miR-211-5p (LFC: + 1.02) show the highest up-regulation (see Fig. 1c and Additional file 1: Table S2). Nine out of these 13 miRNA were previously found up-regulated in post mortem AD brains compared to controls [9, 40‐46]. Remarkably, no significantly down-regulated miRNAs are observed in the analysis of the two genotypes combined.

The strongest effect appears in APPtg mice in the age*genotype interaction resulting in 18 miRNA that are significantly differentially expressed (Additional file 4: Figure S3). Four out of these 18 miRNAs are also significantly differentially expressed due to genotype alone in APPtg mice (miR-211-5p, miR-142a-5p, miR-146a-5p and miR-301b-3p; Fig. 1c). This indicates that their expression is already profoundly affected at 4 M of age and their deregulation exacerbates at 10 M in APPtg.

Although 6 out of the 8 miRNA derived from the combined genotype*age interaction (see Fig. 1c) show a similar trend in the TAUtg-specific analysis compared to the APPtg-specific analysis (Fig. 1c and Additional file 1: Table S2), the overall deregulation of miRNAs is rather subtle in the TAUtg model, with no miRNAs reaching significance in the age*genotype comparison.

When comparing the effect of transgene expression alone in the combined APPtg and TAUtg data set, 23 miRNAs are affected in a statistically significant manner (padj < 0.05, see Additional file 4: Figure S3), but effect sizes are modest with maximal changes for miR-146a-5p (LFC: + 0.36) and miR-147-3p (LFC: + 0.34), or miR-451a (LFC: − 0.40) and miR-301b-3p (LFC: − 0.27). By assessing the transgene effects in APPtg and TAUtg mice separately, it becomes clear that TAUtg mice have more significantly differentially expressed miRNAs than the APPtg mice (24 vs 6 miRNAs; padj< 0.05), although the effects are weak. Not only do TAUtg mice display more down-regulated miRNAs (n = 19, LFC: -0.74 to − 0.14, for instance miR-487b-5p and miR-451a) than APPtg mice (n = 1, miR-301b-3p, LFC: − 0.32), their LFCs are also more pronounced. Conversely, TAUtg and APPtg mice both show 5 significantly up-regulated miRNAs (APPtg, LFC: + 0.23 to + 0.63, including miR-211-5p and miR-146a-5p; TAUtg, LFC: + 0.14 to + 0.31, including miR-7b-5p and miR-344d-3p), although the extent of up-regulation is more pronounced in APPtg mice, and there is no overlap in affected miRNAs.

Assessment of the effects of aging (comparing 4 M to 10 M mice) in APPtg and TAUtg mice combined, results in 50 significantly differentially expressed miRNAs (padj < 0.05; see Additional file 4: Figure S3). The most strongly up-regulated “age associated” miRNAs include miR-193a-3p (LFC: + 0.25) and miR-16-1-3p (LFC: + 0.22) and the most strongly down-regulated miRNAs include miR-298-3p (LFC: − 0.92), miR-296-5p (LFC: − 0.78) and miR-296-3p (LFC: − 0.65).

When assessing APPtg and TAUtg mice separately, aging induces slightly more significantly differentially expressed miRNAs in TAUtg than in APPtg mice (30 vs 23, padj< 0.05). Aging is expected to produce similar miRNA changes among the two different transgenes, and we find 8 down-regulated miRNAs (including miR-298-3p (APPtg LFC: − 0.95; TAUtg LFC: − 0.90) and miR-296-5p (APPtg LFC: − 0.76; TAUtg LFC: − 0.80)) and 1 miRNA up-regulated (miR-210-3p (APPtg LFC: 0.14; TAUtg LFC: 0.23)) in both models. Overall, aging induces moderate changes in miRNA expression that are similar among APPtg and TAUtg mice.

To summarize, we can conclude that APPtg and TAUtg transgenes induce transgene-specific and transgene-indistinct changes in miRNA networks. Transgene-specific alterations can occur due to the distinct nature of the mouse models’ pathology, and it is therefore highly intriguing to find overlaps. These overlaps may contribute to shared features in the phenotypes of both mouse models, for instance the shared cognitive phenotype as previously described [5, 21, 22]. We focus our study further on the 8 miRNAs discussed above that show a significant age*genotype effect (padj< 0.05) when combining the APPtg and TAUtg datasets (i.e. commonly deregulated) and show more than 20% change (i.e. LFC > + 0.26 or LFC < − 0.32; see Fig. 1c).

It is important to corroborate changes in miRNA expression by independent methods [40]. We therefore measure expression of the eight selected miRNAs in an independent new cohort of APPtg mice using semi-quantitative qPCR. The changes in miR-301b-3p and miR-451a, in APPtg mice as mentioned above were small and could not be confirmed using qPCR in the new APPtg cohort (Fig. 1d). However, the age*genotype interaction effect for miR-142a-5p, miR-146a-5p, miR-155-5p, miR-211-5p and miR-455-5p (p < 0.01; Fig. 1d) is confirmed in the new cohort. miR-10a-5p shows significant main effects for age and genotype, but not for the age*genotype interaction. Thus, the qPCR confirms that miR-10a-5p, miR-142a-5p, miR-146a-5p, miR-155-5p, miR-211-5p and miR-455-5p are truly upregulated in 10 M APPtg mice.

We next analyze the expression of the human homologues of the 6 verified miRNAs in hippocampal material from 28 neuropathologically verified AD patients and 20 non-demented control cases, previously used in [31]. Semi-quantitative qPCR data indicates increased miRNA expression in AD cases of hsa-miR142-5p (+ 72%), hsa-miR-146a-5p (+ 26%), hsa-miR-155-5p (+ 78%) and hsa-miR-455-5p (+ 54%; see Fig. 1e). Hsa-miR-211-5p shows too much variability across the samples, and therefore its alteration in human patients cannot be confirmed. Hsa-miR-10a-5p is too lowly expressed in human hippocampal tissue to be detected (qPCR cycle threshold > 35). We can conclude that miR-142a-5p, miR-146a-5p, miR-155-5p and miR-455-5p are upregulated in both mouse models of neurodegeneration (albeit more strongly in APPtg mice), in an independent cohort of APPtg mice, and in AD patients, whereas the increase in miR-10a-5p and miR-211-5p expression is only found in the APPtg mouse model for AD.

We further assessed whether the increase in miRNA expression was correlated to levels of pathology in both the mouse models of neurodegeneration and in sporadic AD patients. Spearman correlation and FDR p-value adjustment was performed on the miRNAseq-based expression of the 6 miRNAs and levels of soluble and insoluble Aβ40 and Aβ42 in APPtg mice and the levels of total TAU and phosphorylated TAU (AT8 and AT270 staining) in TAUtg mice. High (0.97<R > 0.58) and significant (padj< 0.005) correlations are found between all Aβ species and the miRNAs of interest in the amyloidosis mouse model (see Additional file 3: Figure S2B. By contrast, significant correlations could only be found between total TAU and miR-155-5p and miR-455-5p and between TAU Thr181 phosphorylation (AT270) and miR-146a-5p and miR-155-5p in the tauopathy mice (see Additional file 3: Figure S2E). In human samples, correlating protein levels of TAU, AT8, AT270, full length APP, soluble APPα and APP c-terminal fragments, as measured in [31], with the qPCR-based expression levels of the 5 expressed miRNAs, demonstrated that miR-155-5p is also significantly and positively correlated (R = 0.51, padj< 0.01) with levels of TAU Thr181 phosphorylation (AT270; see Additional file 3: Figure S2F).

The two major cellular alterations in the mouse models used here are gliosis and loss of synapses and/or neurons [21, 22]. We therefore used fluorescent in situ hybridization (FISH) to find out in which cells the identified miRNAs are expressed. Five out of six miRNAs (miR-10a-5p, miR-146a-5p, miR-155-5p, miR-211-5p, miR-455-5p) are expressed predominantly in neurons, as shown by the clear binding of miRNA probe within the neuronal layers of the hippocampus (see Fig. 2). Specific miR-142a-5p FISH signal (i.e. different from scrambled probe) is not achieved in our hands, although this miRNA displays a predominant neuronal expression in Simian monkey brain [34]. Very little to no FISH-positive signal is observed in Gfap-positive astrocytes (see Fig. 2) or Iba1-positive microglia for all 5 miRNAs (data not shown). Thus, our data suggests that the 5 miRNAs, and likely miR-142a-5p, are mostly expressed in neurons.

We identified their predicted targets by TargetScan Mouse v7.1, [47] (see Additional file 1: Table S3 for an overview). Predicted targets of 5 miRNAs (miR-455-5p did not show significant enrichment (FDR-adjusted p-value < 0.05) of gene ontology (GO) categories), demonstrate significant enrichment for GO categories as ‘Regulation of neurogenesis’ (GO: 0050767), ‘Signal transduction’ (GO: 0007165) and ‘Regulation of dendritic spine development’ (GO: 0060998; see Fig. 3). Targets of miR-155-5p also enrich significantly for immune-related GO categories, among which ‘Regulation of immune system process’ (GO: 0002682), ‘T cell activation’ (GO: 0042110), ‘T cell differentiation’ (GO: 0030217) and ‘Regulation of myeloid cell differentiation’ (GO: 0045637), most probably due to its reported immune-related function in myeloid cells [48]. However, the importance of this for the alterations in our mouse models is unclear given the high expression of this miRNA in neurons (see Fig. 2).

Given that the upregulated miRNAs mainly target neuronal and synaptic transcripts, we wondered whether upregulation of these miRNAs would be sufficient to induce the cognitive alterations observed in APPtg and TAUtg mice [5, 21, 22]. We implanted intracerebroventricular guide cannulas into male C57BL/6 J mice (18–26 weeks of age, n = 9–12 per treatment group) and injected weekly a miR-mimic oligonucleotide to overexpress the 6 miRNAs individually or in a mix combining all 6 miR-mimics (miR-mix), or equimolar negative control oligonucleotide, to assess their impact on cognition (see Fig. 4a). Overexpression of one miRNA did not lead to overexpression of any of the other 5 miRNAs (data not shown). The miR-mix treated mice underwent a more extensive cognitive test battery (see Fig. 4a).

Weekly ICV injections of individual miR-mimics or miR-mix leads to a significant increase in the hippocampal expression of each miRNA (see Fig. 4b). miRNA overexpression is well tolerated, with no signs of heightened anxiety or altered locomotor behavior as shown by the open field test (see Additional file 5: Figure S4A, B). However, none of miR-mimic treatments significantly affect cognitive behavior, as measured by the ability to recognize the familiar arm in the T-maze (Additional file 5: Figure S4C), or freezing behavior when presented with the same context or the cued tone that was previously coupled to the shock in the contextual fear conditioning paradigm (see Fig. 4c-e, f). MiR-mix treatment is also not able to induce changes in spatial learning (Fig. 4g), nor in the ability to locate the hidden platform in the Morris Water Maze after 10 days of training (see Additional file 5: Figure S4D). Although both control-treated and miR-mix-treated mice are unable to distinguish the novel stranger from the familiar stranger mouse in the Social Preference/Social Novelty test (see Additional file 5: Figure S4E), their ability to distinguish a familiar and novel object remains intact (see Additional file 5: Figure S4F). Overall, these results indicate that overexpression of the 6 deregulated miRNAs does not induce robust cognitive impairments in C57BL/6 mice.