Skip to main content
Erschienen in: Virology Journal 1/2017

Open Access 01.12.2017 | Research

Detection and epidemic dynamic of ToCV and CCYV with Bemisia tabaci and weed in Hainan of China

verfasst von: Xin Tang, Xiaobin Shi, Deyong Zhang, Fan Li, Fei Yan, Youjun Zhang, Yong Liu, Xuguo Zhou

Erschienen in: Virology Journal | Ausgabe 1/2017

Abstract

Background

In recent years, two of the crinivirus, Tomato chlorosis virus (ToCV) and Cucurbit chlorotic yellows virus (CCYV) have gained increasing attention due to their rapid spread and devastating impacts on vegetable production worldwide. Both of these viruses are transmitted by the sweet potato whitefly, Bemisia tabaci (Gennadius), in a semi-persistent manner. Up to now, there is still lack of report in Hainan, the south of China.

Methods

We used observational and experimental methods to explore the prevalence and incidence dynamic of CCYV and ToCV transmitted by whiteflies in Hainan of China.

Results

In 2016, the chlorosis symptom was observed in the tomato and cucumber plants with a large number of B. tabaci on the infected leaves in Hainan, China, with the incidence rate of 69.8% and 62.6% on tomato and cucumber, respectively. Based on molecular identification, Q biotype was determined with a viruliferous rate of 65.0% and 55.0% on the tomato and cucumber plants, respectively. The weed, Alternanthera philoxeroides near the tomato and cucumber was co-infected by the two viruses. Furthermore, incidence dynamic of ToCV and CCYV showed a close relationship with the weed, Alternanthera philoxeroides, which is widely distributed in Hainan.

Conclusion

Our results firstly reveal that the weed, A. philoxeroides is infected by both ToCV and CCYV. Besides, whiteflies showed a high viruliferous rate of ToCV and CCYV. Hainan is an extremely important vegetable production and seed breeding center in China. If the whitefly can carry these two viruses concurrently, co-infection in their mutual host plants can lead to devastating losses in the near future.
Hinweise
A correction to this article is available online at https://​doi.​org/​10.​1186/​s12985-019-1121-0.
Abkürzungen
CCYV
Cucurbit chlorotic yellows virus
CP
Coat protein
HSP70h
Heat shock 70-like protein
RT-PCR
Reverse transcript–polymerase chain reaction
ToCV
Tomato chlorosis virus
TYLCV
Tomato yellow leaf curl virus

Background

Plant virus causes serious threat in the growth and product of crops and vegetables in the world [1]. Plant viruses depend on insect vectors for transmission in a non-persistent, semi-persistent and persistent manner, respectively [2]. The prevalence of plant viruses is closely related to the dynamics of insect vectors [3, 4].
The whitefly, Bemisia tabaci (Gennadius) (hemiptera; Aleyrodidae) is a main vector for plant virus transmission in greenhouse, which has rapidly increased all over the world followed by outbreaks of whitefly-transmitted viruses, causing great losses in agricultural production [57]. The most destructive vector in China is B. tabaci B (MEAM1) and Q (MED) [8]. B. tabaci B has been documented in China since the mid-1990’s, but Tomato yellow leaf curl virus (TYLCV) was not detected until Q became established in 2003 [9, 10], and epidemic of TYLCV is associated with the increasing number of Q [10, 11]. Plant virus can be transmitted by whiteflies in a persistent or semi-persistent manner. Up to now, most research has been focused on the persistent-transmitted virus such as TYLCV but less attention is paid on semi-persistent transmitted viruses. To note, research on the relationship between epidemiology of the crinivirus and whitefly is important to prevent virus outbreak.
Tomato chlorosis virus (ToCV), genus crinivirus, family closteroviridae [12], is transmitted by B. tabaci in a semi-persistent manner [1, 13]. The disorder and yellow symptoms such as the interveinal chlorosis, the leaf brittleness, and the limited necrotic flecking can be used to determine the virus [1, 14, 15]. ToCV was first reported in Florida [16], and then it transmitted to Spain [17], Africa [18, 19], the Middle East [17], and Asia [20, 21]. ToCV can be infected in 24 species of 7 family plants [1]. In Spain Q whiteflies has been determined on ToCV-infected leaves [17]. In Costa Rica Q whiteflies has also been detected on ToCV-infected leaves [22]. In China ToCV was first found in Taiwan [23], and then was found in Shandong [21] and many other northern places, such as Shanxi, Beijing and Neimenggu [24]. Up to now, there is still lack of report in the south of mainland China such as Hainan. With the increasing number of whiteflies in recent years, the potential threat should be noticed.
Cucurbit chlorotic yellows virus (CCYV) belongs to genus crinivirus, family closteroviridae [25]. CCYV can cause chlorotic leaf spots and yellowing of leaves in pumpkin, melon, watermelon, and tobacco [25, 26]. CCYV is transmitted by B. tabaci B and Q in a semi-persistent manner. It was first determined in Japan in 2010 [27], and then it was found in China [28], Sudan [29], Greece [30] and Iran [31]. CCYV was also found in many northern places in China, such as Beijing, Hebei, and Anhui provinces (unpublished data). There is still lack of reports on whitefly biotype detection on virus-infected plants, which has an important role in research of the relationship between epidemiology of the crinivirus and whitefly.
In this research, we found the severe typical chlorotic symptoms on tomato and cucumber in many vegetable growing areas in Hainan province—the south of China. We found that numerous whiteflies gathered on infected plant leaves in cultivated places. We then collected the whiteflies and infected leaves with typical symptoms and then brought them into laboratory to detect the whitefly biotype and to determine the virus. ToCV and CCYV were identified, and B. tabaci Q was determined in all infected leaves. The weeds, Alternanthera philoxeroides nearby were also collected and determined, and the dynamics of ToCV and CCYV were then determined on tomato, cucumber and weeds in four growth stages in Yongfazhen where ToCV and CCYV showed a high virus incidence. Our results provide a basis for monitoring and prevention of viral diseases.

Methods

Field survey

To determine the incidence of the chlorosis disease in tomato and cucumber crops, a survey was undertaken in the Hainan province. Five sites (Yunlongzhen, Xinzhuzhen, Yongfazhen, Tianyazhen, and Yachengzhen), representing the main vegetable-growing areas were surveyed (Fig. 1). For each site, over 200 to 300 plants including tomato and cucumber were surveyed and the incidence of the chlorosis disease was calculated. At each site, the chlorosis tomato and cucumber plants were selected and taken to the laboratory for molecular detection. Meanwhile, whiteflies on the symptomatic plants were collect randomly with aspirating equipment and taken to the laboratory for molecular detection.

Whitefly biotype and viruliferous rate detection

The whitefly samples were divided into four parts, of which two parts were used to detect the whitefly biotype on tomato and cucumber, and the other two parts were used to detect the viruliferous rate of ToCV and CCYV. The whitefly biotype was detected using the CAPS-cleavage amplified polymorphic sequence of mitochondrial cytochrome oxidase I gene (mtCOI) with the restriction endonuclease AseI [32]. The viruliferous rate detection method was described in section of virus detection in plants. In each part, 20 whiteflies were detected, and each of the detection was repeated three times.

RNA extraction and reverse transcription from infected leaves

Total RNA was extracted separately from 0.1 g infected tomato and cucumber leaves using the total RNA extraction kit (Tiangen Biotech, Beijing, China) following the manufacturer’s instruction. Each of 20 samples was extracted from tomato and cucumber respectively. Each of the detection was repeated three times. Reverse transcription of RNA from the total nucleic acid extracts was performed using cDNA synthesis kit (Takara, Beijing, China), following the manufacturer’s instruction.

Virus detection in plants

ToCV detection: We selected 60 chlorosis tomato leaves for detection, of which 20 leaves were detected each time, and all the leaves were detected for 3 times. Reverse transcript–polymerase chain reaction (RT-PCR) was carried out using the primers designed in the HSP70h gene of ToCV using Primer Premier 5 software (Table 1). The PCR of ToCV was performed in 20 μl of reaction mixtures containing 7 μl of ddH2O, 10 μl of mix, 1 μl of each primer, and 1 μl of cDNA. The PCR procedures are as follows: initial denaturation at 94 °C for 2 min, followed by 35 cycles of 94 °C for 15 s, 56 °C for 30 s and 72 °C for 30s, and a final elongation step at 72 °C for 10 min. The PCR products of ToCV were obtained and then separated by electrophoresis using 1.0% agarose gels.
Table 1
Primers of the ToCV, CCYV and whitefly
Name
Primer
Sequence
ToCV
F
AAACTGCCTGCATGAAAAGTCTC
R
GGTTTGGATTTTGGTACTACATTCAGT
CCYV
F
CGCAATCAATAAGGCGGCGACC
R
ACTACAACCTCCCGGTGCCAACT
Whitefly
F
TTGATTTTTTGGTCATCCAGAAGT
R
CTGAATATCGRCGAGGCATTCC
CCYV detection: We selected 60 chlorosis cucumber leaves for detection, of which 20 leaves were detected each time, and all the cucumber leaves were detected for 3 times. The PCR of the cucumber samples was carried out using the primers designed in the coat protein (CP) gene of CCYV using Primer Premier 5 software (Table 1). The PCR of CCYV was performed in 20 μl of reaction mixtures including 7 μl of ddH2O, 10 μl of mix, 1 μl of each primer, and 1 μl of cDNA. The PCR procedures are as follows: initial denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 15 s, 53 °C for 30 s and 72 °C for 1 min, and a final extension at 72 °C for 10 min. The PCR products of CCYV were obtained and then separated by electrophoresis using 1.0% agarose gels.
ToCV and CCYV detection on weeds: In Yongfazhen, where ToCV and CCYV were detected with a high incidence, we collected the weeds, A. philoxeroides which are close to the infected tomato and cucumber to detect ToCV and CCYV. We collected 60 weed leaves for detection of ToCV and CCYV in three replicates.

Nucleotide sequencing analysis

The target PCR products were purified by the AxyPrep DNA gel extraction kit (Axygen, Zhejiang, China), following the manufacturer’s instructions. The purified products were then sequenced at the Sangon biotech (Shanghai, China). The sequence data of the whiteflies, ToCV and CCYV on tomato, cucumber and weeds were analysed using the BioEdit software. Sequences were compared with the NCBI nucleotide database via the BLAST tools on NCBI online server.

Virus incidence dynamic on tomato, cucumber and weeds

The incidence dynamics of ToCV and CCYV were determined on tomato, cucumber and the weeds nearby: In four growth stages, transplanting, seedling, flowering and ripening of tomato and cucumber, plants were collected to our lab to detect the viruliferous rate of ToCV and CCYV. The weed, A. philoxeroides that was grown near the tomato and cucumber plants was also collected to detect the viruliferous rate of ToCV and CCYV. In each of the five sites of Yongfazhen where ToCV and CCYV were detected with a high incidence, 100 tomato leaves were collected for detection of ToCV, and 100 cucumber leaves were collected for detection of CCYV. The tomato plants and cucumber plants were adjacent, therefore 100 weed leaves nearby were collected for detection of ToCV and CCYV. That is to say, 500 tomato leaves, 500 cucumber leaves and 500 weed leaves were collected in one growth stage.

Data analysis

Statistical analyses were performed with SPSS (version 19.0, Chicago, IL, USA). One-way ANOVA was used to compare the viruliferous rate of plants in different growth stages and weeds.

Results

Incidence of chlorosis disease

The total number of 300 tomato plants and 240 cucumber plants was count in infected places of Xinzhuzhen, Yongfazhen and Yazhouzhen to calculate the virus incidence. The total number of 210 tomato plants and 150 cucumber plants was observed to show chlorosis symptom, with the average incidence of 69.8% and 62.6%, respectively (Fig. 1, Table 2). In Yongfazhen, the viruliferous rate of ToCV and CCYV on the weed was 15.0% and 11.7%, respectively (Fig. 1, Table 2).
Table 2
Incidence of ToCV and CCYV
Virus
Host plants
Geographic locations
Number of plants surveyed
Number of infected plants
Incidence of chlorosis disease (%)
Average incidence of chlorosis disease (%)
ToCV
Tomato
Yunlongzhen
145
0
0.0
69.8
Xinzhuzhen
146
93
63.7
Yongfazhen
154
117
76.0
Yachengzhen
165
0
0.0
Tianyazhen
150
0
0.0
CCYV
Cucumber
Yunlongzhen
92
0
0.0
62.6
Xinzhuzhen
90
48
53.3
Yongfazhen
84
62
73.8
Yachengzhen
66
40
60.6
Tianyazhen
81
0
0.0
ToCV
Weed
Yongfazhen
60
9
15.0
15.0
CCYV
Weed
Yongfazhen
60
7
11.7
11.7

Whitefly biotype and viruliferous rate detection

PCR amplification confirmed that all the whiteflies gathered in symptomatic tomato and cucumber plants were B. tabaci Q. The percentage of viruliferous whitefly was 65.0% and 55.0%, respectively (Fig. 2; Table 3).
Table 3
Whitefly biotype and viruliferous rate
Virus
Number of whiteflies
Whitefly biotype
Number of viruliferous whiteflies
Viruliferous rate
ToCV
60
Q
39
65.0%
CCYV
60
Q
33
55.0%

Virus detection in plants

The size of 804 bp based on amplification of CP (coat protein) gene of CCYV was amplified, which revealed that the symptomatic cucumber plants collected in Xinzhuzhen, Yongfazhen and Yazhouzhen and the weeds collected in Yongfazhen of Hainan province was infected by CCYV (Figs. 3 and 5a).
The size of 466 bp based on amplification of heat shock 70-like protein (HSP70h) gene of ToCV was amplified, which showed that the chlorosis tomato plants collected in Xinzhuzhen and Yongfazhen and the weeds collected in Yongfazhen of Hainan province was infected by ToCV (Figs. 4 and 5b).

Nucleotide sequencing analysis

The sequencing results were shown in Table 4. The sequence of the whitefly samples shows a similarity of 99% with the cytochrome oxidase subunit I (COI) gene of B. tabaci Q (KT265875.1). Virus samples in tomato were 100% similar with the RNA1 of ToCV (KC887999.1), and the virus samples in cucumber showed 97% similar with the CP gene of CCYV (KX118632.1). The virus samples in weed showed a similarity of 99% and 97% with the RNA1 of ToCV (KC887999.1) and the CP of CCYV (KX118632.1), respectively.
Table 4
Nucleotide sequencing analysis of B. tabaci and plant viruses
Sample
Sequencing description
Accession
Max score
Total score
Query cover
E value
Identities
Tomato
Tomato chlorosis virus isolate ToCV-BJ segment RNA2
KC887999.1
863
863
45%
0.0
100%
Cucumber
Cucurbit chlorotic yellows virus isolate GX-BH capsid protein gene
KX118632.1
1354
1354
97%
0.0
99%
B. tabaci
Bemisia tabaci biotype Q cytochrome oxidase subunit 1 (COI) gene
KT265875.1
1062
1062
99%
0.0
99%
Weed
Tomato chlorosis virus isolate ToCV-BJ segment RNA2
KC887999.1
856
856
41%
0.0
99%
Weed
Cucurbit chlorotic yellows virus isolate GX-BH capsid protein gene
KX118632.1
1055
1055
77%
0.0
97%

Virus incidence dynamic on tomato, cucumber and weeds

Virus incidence dynamic of ToCV on tomato, and the weed, A. philoxeroides and CCYV on cucumber and A. philoxeroides changes significantly in the four growth stages of plants (ToCV on tomato: F 3,16 = 160.737, P < 0.001; ToCV on weed: F 3,16 = 91.701, P < 0.001; CCYV on cucumber: F 3,16 = 136.496, P < 0.001; CCYV on weed: F 3,16 = 75.522, P < 0.001). In the transplanting stage, viruliferous rate of both ToCV on tomato and CCYV on cucumber was 0%. However, in the ripening stage, viruliferous rate of ToCV and CCYV on tomato and cucumber was highest, with the viruliferous rate of 77% and 62.4%, respectively. Viruliferous rate of ToCV and CCYV on A. philoxeroides showed an opposite trend, which was highest in the transplanting stage of plants and lowest in the ripening stage of plants. In the transplanting stage, the viruliferous rate of ToCV and CCYV on A. philoxeroides was 76.8% and 66.6%, respectively. In the ripening stage, the viruliferous rate of ToCV and CCYV on A. philoxeroides was 15.4% and 12.6%, respectively. Notably, the weed A. philoxeroides that was adjacent from tomato and cucumber can carry both ToCV and CCYV at the same time, with the co-infection viruliferous rate of 32.2% and 6.4% in the transplanting stage and ripening stage, respectively (Fig. 6).

Discussion

B. tabaci is a most important insect vector in agricultural areas and has caused great losses in economy and crop production worldwide [25, 33]. The indirect damage caused by virus transmission is much serious than the direct feeding on the host. For example, TYLCV is transmitted by whitefly in a persistent manner, which causes destructive damage in China [9, 34]. In recent years, TYLCV has attracted the large attention and a series of measure has been used to prevent the disease by researchers in China [11, 3537]. However, up to now, we still pay less attention to most of the semi-persistent viruses transmitted by the whitefly. Furthermore, those plant viruses such as ToCV and CCYV are huge potential crises to agricultural production.
In our research, we found that high density rates of Q at open field in Hainan province and at the same areas we determined that the leaves were infected by ToCV and CCYV, with the incidence of 69.8% and 62.6% on tomato and cucumber plants, respectively. Besides, the viruliferous rate of Q was 65.0% and 55.0% on the tomato and cucumber plants, respectively. Plant virus disease prevalence is closely related to the spread of insect vector. Although B. tabaci B has been shown to be an effective vector of ToCV [1], recently, Q has become a major threat to the quality and yields by transmitting ToCV [22]. Besides, B. tabaci Q plays more roles than B in carrying CCYV [38]. In this research, we notice that the prevalence of CCYV in cucumber and ToCV in tomato was high which was consistent with the high viruliferous rate of Q. Therefore we can speculate that high viruliferous rate of Q may facilitate transmission of ToCV and CCYV.
The weed A. philoxeroides, which was grown near the infected tomato and cucumber, was also infected by ToCV and CCYV. The virus dynamic was then detected on tomato, cucumber and the weeds nearby. In the four growth stages, virus showed a different dynamic on plants and on weeds. On tomato and cucumber plants, viruliferous rate of ToCV and CCYV increased gradually from transplanting stage to ripening stage. On weeds, viruliferous rate of ToCV and CCYV decreased gradually from ripening stage to transplanting stage. Furthermore, both of the ToCV and CCYV were detected on the weed, A. philoxeroides, which is a widely distributed weed in Hainan. To our knowledge, this is the first report of ToCV and CCYV on the weed, A. philoxeroides. From our results we can see that the weed, A. philoxeroides is co-infected and may promote the virus transmission, it’s a pity that we didn’t detect whether the whiteflies were co-infected on weeds, and this needs further confirmation. Notably, Hainan is the mainly vegetable production and breeding center especially for breeding tomato and cucumber in China. In winter season, vegetables in Hainan are transported to all of the north provinces of China because of the low temperature in north provinces. Therefore, the break out of these two viruses may cause fast transmission of ToCV and CCYV to other places via infected seed or viruliferous whiteflies.

Conclusion

This report firstly shows ToCV and CCYV detected in the same area with a high incidence in Hainan province, with a high viruliferous rate of Q on infected leaves. Furthermore, the virus dynamic shows a close relationship with the weed nearby, and the weed is infected by both ToCV and CCYV. Hainan is an extremely important vegetable production and seed breeding center in China. If the whitefly can carry these two viruses concurrently, co-infection in their mutual host plants can lead to devastating losses in the near future. Further research should be done to investigate the role of weed in the transmission of virus.

Acknowledgments

Not applicable.

Funding

This work was supported by the Special Fund for Agro-scientific Research in the Public Interest (No. 201303028), the National Natural Science Foundation of China (No. 31501643, 31571982 and 31571981), and the Agriculture Research System of China (CARS-25-B-05). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Not applicable.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Wintermantel WM, Wisler GC. Vector specificity, host range, and genetic diversity of Tomato chlorosis virus. Plant Dis. 2006;90:814–9.CrossRef Wintermantel WM, Wisler GC. Vector specificity, host range, and genetic diversity of Tomato chlorosis virus. Plant Dis. 2006;90:814–9.CrossRef
2.
Zurück zum Zitat Brault V, Uzest M, Monsion B, Jacquot E, Blanc S. Aphids as transport devices for plant viruses. C R Biol. 2010;333:524–38.PubMedCrossRef Brault V, Uzest M, Monsion B, Jacquot E, Blanc S. Aphids as transport devices for plant viruses. C R Biol. 2010;333:524–38.PubMedCrossRef
3.
Zurück zum Zitat Pinheiro PV, Kliot A, Ghanim M, Cilia M. Is there a role for symbiotic bacteria in plant virus transmission by insects? Curr Opin Insect Sci. 2015;8:69–78.CrossRef Pinheiro PV, Kliot A, Ghanim M, Cilia M. Is there a role for symbiotic bacteria in plant virus transmission by insects? Curr Opin Insect Sci. 2015;8:69–78.CrossRef
4.
Zurück zum Zitat Whitfield AE, Rotenberg D. Disruption of insect transmission of plant viruses. Curr Opin Insect Sci. 2015;8:79–87.CrossRef Whitfield AE, Rotenberg D. Disruption of insect transmission of plant viruses. Curr Opin Insect Sci. 2015;8:79–87.CrossRef
5.
Zurück zum Zitat Wintermantel WM. Transmission efficiency and epidemiology of criniviruses. In Bemisia: bionomics and management of a global pest. Springer. 2009; 319–331. Wintermantel WM. Transmission efficiency and epidemiology of criniviruses. In Bemisia: bionomics and management of a global pest. Springer. 2009; 319–331.
6.
Zurück zum Zitat Navas-Castillo J, Fiallo-Olivé E, Sánchez-Campos S. Emerging virus diseases transmitted by whiteflies. Annu Rev Phytopathol. 2011;49:219–48.PubMedCrossRef Navas-Castillo J, Fiallo-Olivé E, Sánchez-Campos S. Emerging virus diseases transmitted by whiteflies. Annu Rev Phytopathol. 2011;49:219–48.PubMedCrossRef
7.
Zurück zum Zitat Wisler G, Duffus J, Liu HY, Li R. Ecology and epidemiology of whitefly-transmitted closteroviruses. Plant Dis. 1998;82:270–80.CrossRef Wisler G, Duffus J, Liu HY, Li R. Ecology and epidemiology of whitefly-transmitted closteroviruses. Plant Dis. 1998;82:270–80.CrossRef
8.
Zurück zum Zitat De Barro PJ, Liu SS, Boykin LM, Dinsdale AB. Bemisia tabaci: a statement of species status. Annu Rev Entomol. 2011;56:1–19.PubMedCrossRef De Barro PJ, Liu SS, Boykin LM, Dinsdale AB. Bemisia tabaci: a statement of species status. Annu Rev Entomol. 2011;56:1–19.PubMedCrossRef
9.
Zurück zum Zitat Pan H, Chu D, Yan W, Su Q, Liu B, Wang S, Wu Q, Xie W, Jiao X, Li R, et al. Rapid spread of Tomato yellow leaf curl virus in China is aided differentially by two invasive whiteflies. PLoS One. 2012;7:e34817.PubMedPubMedCentralCrossRef Pan H, Chu D, Yan W, Su Q, Liu B, Wang S, Wu Q, Xie W, Jiao X, Li R, et al. Rapid spread of Tomato yellow leaf curl virus in China is aided differentially by two invasive whiteflies. PLoS One. 2012;7:e34817.PubMedPubMedCentralCrossRef
10.
Zurück zum Zitat Pan H, Chu D, Liu B, Shi X, Guo L, Xie W, Carriere Y, Li X, Zhang Y. Differential effects of an exotic plant virus on its two closely related vectors. Sci Rep-UK. 2013;3:2230.CrossRef Pan H, Chu D, Liu B, Shi X, Guo L, Xie W, Carriere Y, Li X, Zhang Y. Differential effects of an exotic plant virus on its two closely related vectors. Sci Rep-UK. 2013;3:2230.CrossRef
11.
Zurück zum Zitat Shi X, Pan H, Zhang H, Jiao X, Xie W, Wu Q, Wang S, Fang Y, Chen G, Zhou X. Bemisia tabaci Q carrying Tomato yellow leaf curl virus strongly suppresses host plant defenses. Sci Rep-UK. 2014;4:5230.CrossRef Shi X, Pan H, Zhang H, Jiao X, Xie W, Wu Q, Wang S, Fang Y, Chen G, Zhou X. Bemisia tabaci Q carrying Tomato yellow leaf curl virus strongly suppresses host plant defenses. Sci Rep-UK. 2014;4:5230.CrossRef
12.
Zurück zum Zitat Wintermantel WM, Wisler GC, Anchieta AG, Liu HY, Karasev AV, Tzanetakis IE. The complete nucleotide sequence and genome organization of Tomato chlorosis virus. Arch Virol. 2005;150:2287–98.PubMedCrossRef Wintermantel WM, Wisler GC, Anchieta AG, Liu HY, Karasev AV, Tzanetakis IE. The complete nucleotide sequence and genome organization of Tomato chlorosis virus. Arch Virol. 2005;150:2287–98.PubMedCrossRef
13.
Zurück zum Zitat Orfanidou C, Pappi P, Efthimiou K, Katis N, Maliogka V. Transmission of Tomato chlorosis virus (ToCV) by Bemisia tabaci biotype Q and evaluation of four weed species as viral sources. Plant Dis. 2016;100:2043–9.PubMedCrossRef Orfanidou C, Pappi P, Efthimiou K, Katis N, Maliogka V. Transmission of Tomato chlorosis virus (ToCV) by Bemisia tabaci biotype Q and evaluation of four weed species as viral sources. Plant Dis. 2016;100:2043–9.PubMedCrossRef
14.
Zurück zum Zitat Fortes IM, Navas-Castillo J. Potato, an experimental and natural host of the crinivirus Tomato chlorosis virus. Eur J Plant Pathol. 2012;134:81–6.CrossRef Fortes IM, Navas-Castillo J. Potato, an experimental and natural host of the crinivirus Tomato chlorosis virus. Eur J Plant Pathol. 2012;134:81–6.CrossRef
15.
Zurück zum Zitat García-Cano E, Navas-Castillo J, Moriones E, Fernández-Muñoz R. Resistance to Tomato chlorosis virus in wild tomato species that impair virus accumulation and disease symptom expression. Phytopathology. 2010;100:582–92.PubMedCrossRef García-Cano E, Navas-Castillo J, Moriones E, Fernández-Muñoz R. Resistance to Tomato chlorosis virus in wild tomato species that impair virus accumulation and disease symptom expression. Phytopathology. 2010;100:582–92.PubMedCrossRef
16.
Zurück zum Zitat Wisler GC, Li RH, Liu HY, Lowry DS, Duffus JE. Tomato chlorosis virus: a new whitefly-transmitted, phloem-limited, bipartite closterovirus of tomato. Phytopathology. 1998;88:402–9.PubMedCrossRef Wisler GC, Li RH, Liu HY, Lowry DS, Duffus JE. Tomato chlorosis virus: a new whitefly-transmitted, phloem-limited, bipartite closterovirus of tomato. Phytopathology. 1998;88:402–9.PubMedCrossRef
17.
Zurück zum Zitat Navas-Castillo J, Camero R, Bueno M, Moriones E. Severe yellowing outbreaks in tomato in Spain associated with infections of Tomato chlorosis virus. Plant Dis. 2000;84:835–7.CrossRef Navas-Castillo J, Camero R, Bueno M, Moriones E. Severe yellowing outbreaks in tomato in Spain associated with infections of Tomato chlorosis virus. Plant Dis. 2000;84:835–7.CrossRef
18.
Zurück zum Zitat Gharsallah C, Halima AB, Fakhfakh H, Gorsane F. Insights into the genetic diversity and the phylogenetic analysis of Tunisian isolates of Tomato chlorosis virus. Phytoparasitica. 2014;43:87–96.CrossRef Gharsallah C, Halima AB, Fakhfakh H, Gorsane F. Insights into the genetic diversity and the phylogenetic analysis of Tunisian isolates of Tomato chlorosis virus. Phytoparasitica. 2014;43:87–96.CrossRef
19.
Zurück zum Zitat Moodley V, Gubba A, Mafongoya P. Occurrence of Tomato chlorosis virus (ToCV) on Datura stramonium near tomato crops (Solanum lycopersicum) in South Africa. Plant Dis. 2016; Moodley V, Gubba A, Mafongoya P. Occurrence of Tomato chlorosis virus (ToCV) on Datura stramonium near tomato crops (Solanum lycopersicum) in South Africa. Plant Dis. 2016;
20.
Zurück zum Zitat Kil EJ, Lee YJ, Cho S, Auh CK, Kim D, Lee KY, Kim MK, Choi HS, Kim CS, Lee S. Identification of natural weed hosts of Tomato chlorosis virus in Korea by RT-PCR with root tissues. Eur J Plant Pathol. 2015;142:419–26.CrossRef Kil EJ, Lee YJ, Cho S, Auh CK, Kim D, Lee KY, Kim MK, Choi HS, Kim CS, Lee S. Identification of natural weed hosts of Tomato chlorosis virus in Korea by RT-PCR with root tissues. Eur J Plant Pathol. 2015;142:419–26.CrossRef
21.
Zurück zum Zitat Zhao LM, Li G, Gao Y, Liu YJ, Sun GZ, Zhu XP. Molecular detection and complete genome sequences of Tomato chlorosis virus isolates from infectious outbreaks in China. J Phytopathol. 2014;162:627–34.CrossRef Zhao LM, Li G, Gao Y, Liu YJ, Sun GZ, Zhu XP. Molecular detection and complete genome sequences of Tomato chlorosis virus isolates from infectious outbreaks in China. J Phytopathol. 2014;162:627–34.CrossRef
22.
Zurück zum Zitat Guevara-Coto JA, Barboza-Vargas N, Hernandez-Jimenez E, Hammond RW, Ramirez-Fonseca P. Bemisia tabaci biotype Q is present in Costa Rica. Eur J Plant Pathol. 2011;131:167.CrossRef Guevara-Coto JA, Barboza-Vargas N, Hernandez-Jimenez E, Hammond RW, Ramirez-Fonseca P. Bemisia tabaci biotype Q is present in Costa Rica. Eur J Plant Pathol. 2011;131:167.CrossRef
23.
Zurück zum Zitat Tsai W, Shih S, Green S, Hanson P, Liu H. First report of the occurrence of Tomato chlorosis virus and Tomato infectious chlorosis virus in Taiwan. Plant Dis 2004; 88:311–311. Tsai W, Shih S, Green S, Hanson P, Liu H. First report of the occurrence of Tomato chlorosis virus and Tomato infectious chlorosis virus in Taiwan. Plant Dis 2004; 88:311–311.
24.
Zurück zum Zitat Zheng HX, Xia JX, Zhou XM, Zhang YJ. Be on alert of rapid diffusion of Toamto chlorosis virus transmitted by whitefly in China. China Vegetables. 2016; 22–26 (Chinese with English abstrct). Zheng HX, Xia JX, Zhou XM, Zhang YJ. Be on alert of rapid diffusion of Toamto chlorosis virus transmitted by whitefly in China. China Vegetables. 2016; 22–26 (Chinese with English abstrct).
25.
Zurück zum Zitat Abrahamian PE, Abou-Jawdah Y. Whitefly-transmitted criniviruses of cucurbits: current status and future prospects. Virus disease. 2014;25:26–38.PubMedCrossRef Abrahamian PE, Abou-Jawdah Y. Whitefly-transmitted criniviruses of cucurbits: current status and future prospects. Virus disease. 2014;25:26–38.PubMedCrossRef
26.
Zurück zum Zitat Orfanidou C, Maliogka V, Katis N. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis 2015; 99:734–734. Orfanidou C, Maliogka V, Katis N. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis 2015; 99:734–734.
27.
Zurück zum Zitat Okuda M, Okazaki S, Yamasaki S, Okuda S, Sugiyama M. Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus crinivirus. Phytopathology. 2010;100:560–6.PubMedCrossRef Okuda M, Okazaki S, Yamasaki S, Okuda S, Sugiyama M. Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus crinivirus. Phytopathology. 2010;100:560–6.PubMedCrossRef
28.
Zurück zum Zitat Zeng R, Dai FM, Chen WJ, Lu JP. First report of Cucurbit chlorotic yellows virus infecting melon in China. Plant Dis 2011; 95:354–354. Zeng R, Dai FM, Chen WJ, Lu JP. First report of Cucurbit chlorotic yellows virus infecting melon in China. Plant Dis 2011; 95:354–354.
29.
Zurück zum Zitat Hamed K, Menzel W, Dafalla G, Gadelseed AMA, Winter S. First report of Cucurbit chlorotic yellows virus infecting muskmelon and cucumber in Sudan. Plant Dis 2011; 95:1321–1321. Hamed K, Menzel W, Dafalla G, Gadelseed AMA, Winter S. First report of Cucurbit chlorotic yellows virus infecting muskmelon and cucumber in Sudan. Plant Dis 2011; 95:1321–1321.
30.
Zurück zum Zitat Orfanidou C, Maliogka VI, Katis NI. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis 2014; 98:1446–1446. Orfanidou C, Maliogka VI, Katis NI. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis 2014; 98:1446–1446.
31.
Zurück zum Zitat Bananej K, Menzel W, Kianfar N, Vahdat A, Winter S. First report of Cucurbit chlorotic yellows virus infecting cucumber, melon, and squash in Iran. Plant Dis 2013; 97:1005–1005. Bananej K, Menzel W, Kianfar N, Vahdat A, Winter S. First report of Cucurbit chlorotic yellows virus infecting cucumber, melon, and squash in Iran. Plant Dis 2013; 97:1005–1005.
32.
Zurück zum Zitat Chu D, Wan FH, Zhang YJ, Brown JK. Change in the biotype composition of Bemisia tabaci in shandong province of China from 2005 to 2008. Environ Entomol. 2010;39:1028–36.PubMedCrossRef Chu D, Wan FH, Zhang YJ, Brown JK. Change in the biotype composition of Bemisia tabaci in shandong province of China from 2005 to 2008. Environ Entomol. 2010;39:1028–36.PubMedCrossRef
33.
Zurück zum Zitat Brown JK, Czosnek H. Whitefly transmission of plant viruses. Adv Bot Res. 2002;36:65–76.CrossRef Brown JK, Czosnek H. Whitefly transmission of plant viruses. Adv Bot Res. 2002;36:65–76.CrossRef
34.
Zurück zum Zitat Liu B, Preisser EL, Chu D, Pan H, Xie W, Wang S, Wu Q, Zhou X, Zhang Y. Multiple forms of vector manipulation by a plant-infecting virus: Bemisia tabaci and Tomato yellow leaf curl virus. J Virol. 2013;87:4929–37.PubMedPubMedCentralCrossRef Liu B, Preisser EL, Chu D, Pan H, Xie W, Wang S, Wu Q, Zhou X, Zhang Y. Multiple forms of vector manipulation by a plant-infecting virus: Bemisia tabaci and Tomato yellow leaf curl virus. J Virol. 2013;87:4929–37.PubMedPubMedCentralCrossRef
35.
Zurück zum Zitat Shi X, Pan H, Xie W, Wu Q, Wang S, Liu Y, Fang Y, Chen G, Gao X, Zhang Y. Plant virus differentially alters the plant's defense response to its closely related vectors. PLoS One. 2013;8:e83520.PubMedPubMedCentralCrossRef Shi X, Pan H, Xie W, Wu Q, Wang S, Liu Y, Fang Y, Chen G, Gao X, Zhang Y. Plant virus differentially alters the plant's defense response to its closely related vectors. PLoS One. 2013;8:e83520.PubMedPubMedCentralCrossRef
36.
Zurück zum Zitat Fang Y, Jiao X, Xie W, Wang S, Wu Q, Shi X, Chen G, Su Q, Yang X, Pan H. Tomato yellow leaf curl virus alters the host preferences of its vector Bemisia tabaci. Sci Rep-UK. 2013;3:2876.CrossRef Fang Y, Jiao X, Xie W, Wang S, Wu Q, Shi X, Chen G, Su Q, Yang X, Pan H. Tomato yellow leaf curl virus alters the host preferences of its vector Bemisia tabaci. Sci Rep-UK. 2013;3:2876.CrossRef
37.
Zurück zum Zitat Ning W, Shi X, Liu B, Pan H, Wei W, Zeng Y, Sun X, Xie W, Wang S, Wu Q. Transmission of Tomato yellow leaf curl virus by Bemisia tabaci as affected by whitefly sex and biotype. Sci Rep-UK. 2015;5:10744.CrossRef Ning W, Shi X, Liu B, Pan H, Wei W, Zeng Y, Sun X, Xie W, Wang S, Wu Q. Transmission of Tomato yellow leaf curl virus by Bemisia tabaci as affected by whitefly sex and biotype. Sci Rep-UK. 2015;5:10744.CrossRef
38.
Zurück zum Zitat Lu SH. Li JH, Wang XL, Song DY, Bai R, Shi Y, Gu QS, Kuo YW, Falk BW. Yan FM A semipersistent plant virus differentially manipulates feeding behaviors of different sexes and biotypes of its whitefly vector Viruses. 2017;9:4. Lu SH. Li JH, Wang XL, Song DY, Bai R, Shi Y, Gu QS, Kuo YW, Falk BW. Yan FM A semipersistent plant virus differentially manipulates feeding behaviors of different sexes and biotypes of its whitefly vector Viruses. 2017;9:4.
Metadaten
Titel
Detection and epidemic dynamic of ToCV and CCYV with Bemisia tabaci and weed in Hainan of China
verfasst von
Xin Tang
Xiaobin Shi
Deyong Zhang
Fan Li
Fei Yan
Youjun Zhang
Yong Liu
Xuguo Zhou
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2017
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/s12985-017-0833-2

Weitere Artikel der Ausgabe 1/2017

Virology Journal 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.